A method for constructing a thy1-snca;clu knockout mouse model and application thereof
By constructing a Thy1-SNCA;Clu gene knockout mouse model and using the CRISPR/Cas9 system to knock out the Clu gene, the problem that existing PD models cannot fully simulate pathological features was solved, and the experimental advantages of early PD symptoms and high survival rate were achieved.
Patent Information
- Application Number
- CN202411086460.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-08
- Publication Date
- 2025-12-30
- Estimated Expiration
- 2044-08-08
AI Technical Summary
Existing animal models of Parkinson's disease cannot fully simulate the motor and non-motor pathological features, and the experimental period is long, lacking stability and high survival rate.
By constructing a Thy1-SNCA;Clu gene knockout mouse model, the Clu gene, especially the exon E3-E4 region, was knocked out using the CRISPR/Cas9 system to obtain Clu-KO mice. These mice were then crossed with Thy1-SNCA mice to form Thy1-SNCA;Clu-/- mice, which significantly accelerated the onset of PD-like symptoms.
It shortens the time to onset of PD-like symptoms, improves the stability of the model and animal survival rate, and shows obvious loss of tyrosine hydroxylase and α-syn accumulation at 6 months of age earlier than existing models, making it suitable for PD research and drug screening.
Smart Images

Figure CN118979061B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of Parkinson's disease research technology, specifically to a method for constructing and applying a Thy1-SNCA;Clu gene knockout mouse model. Background Technology
[0002] Parkinson's disease (PD) is the second most common neurodegenerative disease, characterized by motor and nonmotor disturbances. Pathological features include the loss of numerous dopaminergic neurons in the substantia nigra and the formation of Lewy bodies (LB). α-synuclein (α-syn, gene name SNCA) is a major component of LB.
[0003] Currently, animal models of motor disorder (PD) include: drug-induced neurotoxin models (such as MPTP, 6-OHDA, and rotenone) and transgenic models (such as SNCA, Parkin, LRRK2, PINK1, and DJ-1). The MPTP model is simple to operate and selectively damages dopamine neurons, successfully replicating PD characteristics and is used for movement disorder research. However, this model can only simulate the movement disorders of PD and cannot simulate other non-motor symptoms. The 6-OHDA model can selectively destroy dopamine neurons, exhibiting a high dopamine neuron-destructive effect, and is used for movement disorder research and drug screening. However, this model non-specifically destroys dopamine neurons and has a low survival rate. The rotenone model can simulate mitochondrial dysfunction and oxidative stress, and is therefore used for mitochondrial function research, but it has the disadvantages of complex operation and low survival rate. In the SNCA transgenic model, modifications include mutations (A53T, A30P, and E46K) or repetitive segments. These are helpful for studying α-nucleoprotein-related degeneration and the relationship between genetic and environmental factors in PD. However, some models do not show significant dopaminergic neuron loss or exhibit apoptosis patterns inconsistent with human PD pathology. In the LRRK2 transgenic model, LRRK2 is a familial PD pathogenic gene, and its modifications include mutations (G2019S and R1441C / G). It can be used for LRRK2-targeted drug testing and LRRK2 function studies, but its drawbacks include motor deficits without significant dopaminergic neuron loss and lack of LB pathological manifestations. In the Parkin transgenic model, mutations or knockouts of ubiquitin ligases may lead to the accumulation of neurotoxic substrates. This model is useful for Parkin function studies, but currently lacks phenotypic data. The DJ-1 gene knockout model can be effectively combined with neurotoxin models. Although this model shows motor deficits, it lacks LB pathological manifestations, significant dopaminergic neuron loss, and has limited phenotypic data. In PINK-1 transgenic models, PINK-1 is a neuroprotective kinase, and its modification methods include mutation and knockout. For example, G309D-PINK1 mice can exhibit dopamine reduction and motor deficit phenotypes. However, most PINK-1 models do not show a decrease in dopaminergic neurons or dopamine levels. Therefore, existing PD models all have certain limitations to varying degrees and cannot comprehensively reflect the motor and non-motor pathological characteristics of PD.
[0004] Thy1-SNCA is one of the most widely used animal models of Parkinson's disease (PD). It overexpresses human α-synuclein under the Thy1 promoter, with expression beginning on day 10 after birth. After 10 days, the protein expression steadily increases, but there are some differences between different brain regions. In the hippocampus, α-synuclein expression levels continuously increase from 2 months to 6 months of age. In the striatum, α-synuclein expression slightly decreases or remains unchanged between 2 and 6 months of age, decreasing by approximately 40% by 14 months. Tyrosine hydroxylase (TH) levels also decrease at 14 months of age, but only by about 20%. More importantly, before 14 months of age, the mortality, morbidity, and general health status of Thy1-SNCA mice are similar to those of wild-type mice, and Parkinson's-like motor dysfunction only becomes relatively apparent around 14 months of age. Summary of the Invention
[0005] In view of the shortcomings of existing PD animal models, this invention aims to develop a new PD animal model with a short experimental cycle and stable pathological changes.
[0006] To achieve the above objectives, the technical solution of the present invention is as follows:
[0007] The first aspect of this invention provides a method for constructing a Thy1-SNCA;Clu gene knockout mouse model, comprising the following steps:
[0008] Thy1-SNCA mice were crossed with Clu-KO mice to obtain the F1 generation, and Thy1-SNCA;Clu- / + mice were identified.
[0009] Thy1-SNCA;Clu- / + mice were backcrossed with Clu-KO mice to obtain the F2 generation, and the target genotype mice, namely Thy1-SNCA;Clu- / - mice, were identified.
[0010] In the construction method of this invention, Clu-KO mice have lost the function of the Clu gene compared to wild-type mice.
[0011] The inventors discovered that Clu can mediate α-synergistic degradation, alleviating PD symptoms; and that complete knockout of Clu in mice increases the accumulation of α-synergistic in vivo. Based on this discovery, the inventors hypothesized that Clu knockout is a key step in accelerating the development of PD-like symptoms in SNCA genes, and thus established the Thy1-SNCA;Clu gene knockout mouse model. Experimental data showed that the Thy1-SNCA;Clu gene knockout mouse model exhibited significant loss of tyrosine hydroxylase, large accumulation of phosphorylated α-synergistic, and significant gait asymmetry at 6 months of age, much earlier than Thy1-SNCA mice at 14 months of age, thus effectively shortening the experimental period.
[0012] Preferably, in the above construction method, the Clu-KO mouse lacks the sequence shown in SEQ ID NO.1 compared to the wild-type mouse. The Clu gene is located on chromosome 14 and has five transcripts. In some embodiments of the present invention, Clu-KO mice are obtained by knocking out the exon E3-E4 region (the specific sequence is shown in SEQ ID NO.1, with a total length of 2636 bp). The Clu-KO mouse is then crossed with Thy1-SNCA mice and backcrossed to obtain Thy1-SNCA mice. Clu gene knockout mice are superior to traditional animal models in terms of stability, pathology, behavioral characteristics, and the timing of their emergence, and have a high survival rate.
[0013] Preferably, in the above construction method, Clu-KO mice are constructed using the CRISPR / Cas9 system. In some embodiments of the present invention, the method for constructing Clu-KO mice includes the following steps: microinjecting the CRISPR / Cas9 system and the homologous recombination vector (Donor vector) into the fertilized eggs of female C57BL / 6N background mice, then transplanting the fertilized eggs into pseudopregnant female mice, allowing them to become pregnant and give birth, and extracting genomic DNA from the F0 generation mice for identification to obtain Clu-KO mice.
[0014] More preferably, in the CRISPR / Cas9 system, the gRNA target sequence is as shown in SEQ ID NO.2 and SEQ ID NO.3.
[0015] More preferably, when the Clu-KO mouse lacks the sequence shown in SEQ ID NO.1, the Clu-KO mouse can be identified by primer pairs with sequences shown in SEQ ID NO.4 and SEQ ID NO.5; and when the product size is 514bp, it is a Clu-KO mouse, and when the product size is 3150bp, it is a wild-type mouse.
[0016] Preferably, in the above construction method, the primers used to identify Thy1-SNCA mice or Thy1-SNCA;Clu- / + mice include primer pairs with sequences as shown in SEQ ID NO. 7-8 and primer pairs with sequences as shown in 9-10.
[0017] Preferably, in the above construction method, the primers used to identify the target genotype mice include: primer pairs as shown in SEQ ID NO. 7-8, primer pairs as shown in SEQ ID NO. 9-10, universal primers as shown in SEQ ID NO. 4, and reverse primers as shown in SEQ ID NO. 5 or SEQ ID NO. 6. Specifically, by extracting genomic DNA, PCR is performed using the above primer pairs, and mice possessing both Thy1-SNCA and Clu- / - genotypes are retained to obtain the target genotype mice.
[0018] The second aspect of this invention provides the application of the Thy1-SNCA;Clu gene knockout mouse model constructed in this invention in the preparation of a Parkinson's disease model. Pathological and behavioral tests of this model revealed that at 6 months of age, it exhibits significant loss of tyrosine hydroxylase, abundant phosphorylated α-syn, and significant gait asymmetry, demonstrating advantages over the Thy1-SNCA model. Therefore, it can effectively replace Thy1-SNCA mice in PD research.
[0019] The third aspect of this invention provides the application of the Thy1-SNCA;Clu gene knockout mouse model constructed in this invention in exploring the function and mechanism of action of the SNCA gene.
[0020] The fourth aspect of this invention provides the application of the Clu-KO mouse constructed in this invention in exploring the function, mechanism of action, and molecular pathways involved in the Clu gene in neurological diseases, as well as the application of the Clu-KO mouse as an animal model for drug screening with Clu as a molecular target.
[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0022] The inventors discovered for the first time that Clu can mediate the degradation of α-syn and alleviate PD symptoms. Based on this theoretical breakthrough, this invention developed a new PD animal model, the Thy1-SNCA;Clu- / - mouse. Compared to existing Thy1-SNCA mice, this model can effectively shorten the onset time of Parkinson's-like motor dysfunction, thereby shortening the experimental period.
[0023] The Clu-KO mouse provided by this invention is preferably obtained by knocking out the exon E3-E4 region compared with wild-type mice. The Thy1-SNCA;Clu- / - mice obtained by crossing and backcrossing with Thy1-SNCA mice not only have advantages over traditional animal models at time points, but also have significant advantages in terms of stability, pathology, and behavioral characteristics, and have a high survival rate.
[0024] The method of this invention is simple, easy to implement, and has a high survival rate. The resulting model can not only be used as a PD model, but also to explore the role, related mechanisms, and possible molecular pathways of SNCA and Clu in neurological diseases. This invention also provides a new animal model for drug screening with Clu as a molecular target. Attached Figure Description
[0025] Figure 1 This is a schematic diagram of the strategy for Clu-KO gene knockout mice in Example 1 of the present invention.
[0026] Figure 2 This is a PCR product detection diagram of the Clu-KO gene knockout mouse in Example 1 of the present invention.
[0027] Figure 3 The sequencing results of the PCR products of the Clu-KO gene knockout mice in Example 1 of this invention are shown.
[0028] Figure 4 This is an electrophoresis image of the Thy1-SNCA genotype identification of F1 generation mice in Example 2 of the present invention.
[0029] Figure 5 This is an electrophoresis image of the Thy1-SNCA genotype identification of F2 generation mice in Example 2 of the present invention.
[0030] Figure 6 This is an electrophoresis image of the Clu-KO genotype identification of F2 generation mice in Example 2 of this invention.
[0031] Figure 7 The image shows the ThS staining results of the striatum and substantia nigra compacta (SNc) of different mouse models at 1 month of age in Example 3 of this invention.
[0032] Figure 8 The images show the ThS staining results of the striatum and substantia nigra compacta of different mouse models at 3 months of age in Example 3 of this invention.
[0033] Figure 9 The images show the ThS staining results of the striatum and substantia nigra compacta of different mouse models at 6 months of age in Example 3 of this invention.
[0034] Figure 10 The images show the results of immunofluorescence co-staining of different mouse models at different ages in Example 3 of this invention.
[0035] Figure 11 The results of gait tests, open field tests, and rotating rod tests for each mouse model in Example 4 of this invention are as follows: at 1 month of age.
[0036] Figure 12The results of gait tests, open field tests, and rotating rod tests for each mouse model in Example 4 of this invention are as follows: at 3 months of age.
[0037] Figure 13 The results of gait tests, open field tests, and rotating rod tests for each mouse model in Example 4 of this invention are as follows: at 6 months of age. Detailed Implementation
[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The term "comprising" and any variations thereof in the specification and claims of this invention are intended to cover a non-exclusive inclusion.
[0039] To address the shortcomings of existing PD animal models, particularly the late onset of PD-like symptoms in the Thy1-SNCA model, this invention, based on the novel discovery that Clu can mediate α-syn degradation, proposes the idea of accelerating the onset of PD-like symptoms in the SNCA gene by knocking out Clu. This led to the successful construction of the Thy1-SNCA;Clu- / - mouse, whose construction method includes the following steps:
[0040] (1) Construct a Clu gene knockout mouse animal model, denoted as Clu-KO mouse;
[0041] (2) Thy1-SNCA mice were crossed with Clu-KO to obtain F1 generation, and Thy1-SNCA;Clu- / + mice were obtained after identification;
[0042] (3) Thy1-SNCA;Clu- / + mice from the F1 generation were backcrossed with Clu-KO mice, and the target gene mice (Thy1-SNCA;Clu- / -) were obtained after identification.
[0043] In the above construction methods, the rat tail alkali lysis method can be used for identification.
[0044] In the above construction method, Thy1-SNCA mice are an existing PD model, which can be purchased directly through commercial channels or constructed by ourselves based on existing technology. Therefore, the construction method of this invention will not be described in detail.
[0045] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. It should be understood that the embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.
[0046] Unless otherwise specified, the techniques or conditions described in the following examples are based on those described in the literature or the product instructions. Unless otherwise specified, the reagents or instruments used are all commercially available products.
[0047] Example 1: Construction of Clu-KO Mice
[0048] The Clu gene (gene ID: 12759) is located on chromosome 14 (14D1) and has five transcripts. The fifth transcript (NP_038520.2) contains a complete conserved protein-coding region (CCDS). This transcript encodes 9 exons, with the translation start site ATG located at exon 1 and the translation termination site TGA located at exon 9. The transcript is 1645 bp long and encodes 448 amino acids.
[0049] This invention selects the fifth transcript design and, based on CRISPR / Cas9 gene editing technology, knocks out the E3-E4 region of exon (total length 2636bp, specific base sequence as shown in SEQ ID NO.1) to construct Clu-KO mice.
[0050] This invention includes the following steps:
[0051] (1) Design, construct and transcribe gRNA in vitro according to the design scheme.
[0052] gRNA target sequence:
[0053] gRNA-B1 (matching gene positive strand sequence): ATGTGTCTGGCAACCGCATCAGG (SEQ ID NO.2);
[0054] gRNA-B2 (matching gene positive strand sequence): CCCTACCTGTGAGATTCACTTGG (SEQ ID NO.3).
[0055] (2) Construct a homologous recombination vector (Donor vector).
[0056] According to step (1), the two synthesized single-stranded oligonucleotide gRNA sequences are annealed to form double-stranded DNA, a gRNA expression vector is constructed, the recombinant plasmid is transformed into DH5a competent cells, and positive clone plasmids are screened and identified by kanamycin resistance and target DNA sequencing. Correct colony clones are selected, and after expansion culture, plasmids are extracted for use as templates for in vitro transcription.
[0057] A recombinant plasmid (Donor vector) carrying the homologous region of the target site and the target fragment was prepared. The recombinant plasmid was transformed into DH5α competent cells. Positive clone plasmids were screened and identified by ampicillin resistance and sequencing of the inserted fragment. Correct colony clones were selected, and after expansion culture, the plasmid was extracted and purified. The obtained donor fragment product was used for injection.
[0058] (3) Obtain Clu-KO mice.
[0059] The CRISPR / Cas9 system and Donor vector samples were microinjected into the fertilized eggs of female C57BL / 6N background mice. The fertilized eggs were then transferred into pseudopregnant female mice, allowing them to become pregnant and give birth. The F0 generation pups born to the recipient mice were tail-cropped and toe-cropped at 5-7 days of age for numbering. Genomic DNA was extracted for PCR and sequencing identification to confirm the genotype. The Clu-KO mouse genotype identification strategy of this invention is as follows: Figure 1 As shown, the PCR primers used include the following two pairs of primers:
[0060] PCR primer 1 (annealing temperature 60℃):
[0061] F1: 5'-AACCTCTTGCTCATAGCTGACC-3' (SEQ ID NO.4),
[0062] R1: 5'-GACCCAAGTTCCCACTGTTCTG-3' (SEQ ID NO.5);
[0063] PCR primer 2 (annealing temperature 60℃):
[0064] F1: 5'-AACCTCTTGCTCATAGCTGACC-3' (SEQ ID NO.4),
[0065] R2: 5'-AGTCACAGCTCAGAAACTCAGG-3' (SEQ ID NO. 6).
[0066] The detection was performed using the PCR primer 1 described above, and the product length was 514 bp (e.g., Figure 2 As shown in the figure, this indicates that the target region has been knocked out (the product length without knockout is 3150 bp). Further sequencing primers (i.e., Figure 1 F2 in A, with the sequence GTTCTCTCAGCACACTTCAAGG (SEQ ID NO.11), is effective against positive animals (such as...). Figure 2 Sequencing was performed on mouse number 39, and the sequencing results are as follows: Figure 3 As shown, the 2636bp segment represented by SEQ ID NO.1 has been deleted.
[0067] Example 2: Construction of Thy1-SNCA;Clu- / - mice
[0068] This example uses the Clu-KO mice prepared in Example 1 to prepare Thy1-SNCA;Clu- / - mice, specifically including the following steps:
[0069] (1) Hybridization to obtain Thy1-SNCA;Clu- / + mice.
[0070] After reaching sexual maturity, the F0 generation mice with positive Thy1-SNCA were mated with Clu- / - background mice (i.e., Clu-KO mice). The F1 generation mice were separated into different cages after 21 days, their tails and toes were clipped and numbered, and genomic DNA was extracted. PCR reactions were performed using the primers shown in Table 1 (the reaction system and reaction procedure are shown in Tables 2 and 3) to confirm the genotype.
[0071] Table 1 Primer information used for Thy1-SNCA genotyping
[0072]
[0073] Table 2 PCR reaction system used for Thy1-SNCA genotyping
[0074]
[0075] Table 3. PCR reaction procedures used for Thy1-SNCA genotyping.
[0076]
[0077] Some identification results of F1 generation mice are as follows: Figure 4 As shown, from Figure 4 It can be seen that mice numbered 3, 4, 8, 10, 11, 12, 13, 14, and 17 are all positive (i.e., Thy1-SNCA; Clu- / +).
[0078] (2) Thy1-SNCA;Clu- / - mouse construction.
[0079] Thy1-SNCA;Clu- / + adult mice were backcrossed with Clu- / - mice to obtain the F2 generation. The Thy1-SNCA genotype and Clu-KO genotype of the F2 generation mice were then identified to obtain Thy1-SNCA;Clu- / - mice.
[0080] The identification of the Thy1-SNCA genotype follows the same procedure (1). Partial electrophoresis results of the F2 generation Thy1-SNCA mice are shown below. Figure 5 As shown: Mice numbered 1, 3, 4, 5, 10, 11, and 12 are Thy1-SNCA positive, and the remaining mice are WT.
[0081] Clu-KO genotyping strategies, such as Figure 1 As shown in B, the primers used are listed in Table 4. Primer AB-Clu in Table 4 is... Figure 1 In B, F1, A-Clu is... Figure 1 B in R1, B-Clu is Figure 1 The PCR reaction system and reaction procedure used for genotyping of B-R2 Clu-KO are shown in Tables 5 and 6, respectively.
[0082] Table 4 Primer information used for Clu-KO genotyping
[0083]
[0084] Table 5 PCR reaction system used for Clu-KO genotyping
[0085]
[0086] Table 6. PCR reaction procedures used for Clu-KO genotyping.
[0087]
[0088] When using the two primer pairs shown in Table 4, homozygotes showed only one band (514 bp), while heterozygotes showed two bands (514 bp and 749 bp). Specifically, the partial electrophoresis results of the F2 generation Clu mice in this example are as follows: Figure 6 As shown: Mice numbered 4, 6, 7, 8, 11, 13, 14, 15, 16 are Clu- / -, while mice numbered 1, 2, 3, 5, 9, 10, 12 are Clu- / +.
[0089] Example 3
[0090] This case involved pathological examination of Thy1-SNCA mice, Thy1-SNCA;Clu- / + mice, and Thy1-SNCA;Clu- / - mice, specifically including the following steps:
[0091] (1) Brain tissue section.
[0092] Animals were anesthetized with isoflurane and chloral hydrate (3%) and perfused with 4% paraformaldehyde (PFA) in 0.1 M phosphate-buffered saline (PBS, pH 7.4) via the heart. Brains were harvested, post-fixed overnight at 4°C in the same fixative, dehydrated with 30% sucrose in PBS, and serially sectioned on a vibrating microtome (Leica).
[0093] (2) The aggregation of phosphorylated α-syn (p-α-syn) was detected by thiosulfate (Ths) staining.
[0094] To investigate the coexistence of p-S129α-synuclein and ThS in the mouse brain, slides were incubated overnight at 4°C with mouse anti-p-S129α-synuclein primary antibody (Abcam, #ab51253, 1:500), followed by washing three times with PBS for 5 minutes each time. Then, the slides were incubated with Alexa Fluor594-labeled anti-mouse antibody at room temperature for 1 hour. After a brief rinse in PBS, the slides were stained with 0.5% ThS in 50% ethanol for 5 minutes, washed with 50% ethanol, and placed in distilled water. Finally, the slides were mounted with DAPI, covered with a glass dome, and examined under a confocal microscope (Leica Microsystems STELLARIS 5, Germany). This process was repeated at least three times.
[0095] Experimental results are as follows Figure 7-9 As shown: at 1 month old ( Figure 7 ) and 3 months old ( Figure 8 At 6 months of age, there was no significant difference in the accumulation of phosphorylated α-syn in mice of the three genotypes: Thy1-SNCA, Thy1-SNCA;Clu- / +, and Thy1-SNCA;Clu- / -; Figure 9 In Thy1-SNCA;Clu- / - mice, a large amount of phosphorylated α-syn was found aggregated in the substantia nigra. This indicates that, compared to Thy1-SNCA (14M), the Thy1-SNCA;Clu- / - mice provided by this invention exhibit significant PD pathology at an early stage (6M).
[0096] (3) TH and p-α-syn were co-stained by immunofluorescence.
[0097] Sections were permeabilized in PBS / 0.1% Triton X-100 for 10 min and blocked for 1 h at room temperature with 4% normal bovine serum in PBS / 0.1% Triton X-100. Sections were then incubated overnight at 4°C with primary antibody p-S129 (Abcam, #ab51253, 1:500) and TH (CST #58844S) in PBS / 0.1% Triton X-100 with 2% serum. Sections were then washed with PBS and incubated for 1 h at room temperature with secondary antibodies conjugated to Alexa Fluor 594 and Alexa Fluor 488 (i.e., TH secondary antibody and P-α-syn secondary antibody, Invitrogen). After washing with PBS, sections were incubated with DAPI to stain cell nuclei. Images were captured using a Zeiss upright microscope.
[0098] The results are as follows Figure 10As shown, with increasing age, TH showed significant loss and p-α-syn showed significant accumulation in 6M Thy1-SNCA;Clu- / - mice.
[0099] The above results indicate that the Thy1-SNCA;Clu- / - model mouse can effectively replace the Thy1-SNCA mouse, and compared to the Thy1-SNCA mouse, the onset of PD-like symptoms is earlier, at 6 months of age, which greatly shortens the experimental period.
[0100] Example 4
[0101] Motor function is often impaired in patients with Parkinson's disease (PD), commonly manifesting as resting tremor, changes in balance and gait. Therefore, this study examined the behavior of Thy1-SNCA mice, Thy1-SNCA;Clu- / + mice, and Thy1-SNCA;Clu- / - mice at different ages.
[0102] Open field test: In the open field test, mice are placed in a 40×40 square grid and allowed to move freely for 10 minutes. Their movement trajectory, the number of times they enter the central area, and the time are recorded.
[0103] Rotating bar test: In the rotating bar test, mice were trained on a rotating bar device (MED-Associates) at a speed of 20 rpm for 5 minutes. After the initial training, the mice were tested twice, with the speed increasing from 10 rpm to 20 rpm. The training lasted for 3 days. On the second day, the speed was increased from 20 rpm to 30 rpm, and on the third day, the speed was increased from 30 rpm to 40 rpm. The dropout time was recorded on the fourth day.
[0104] Gait test: In the gait test, mice were placed in a gait simulator from the left and allowed to freely cross the passage to the dark box on the right. Mice were trained for three consecutive days, with three tests conducted each time. On the fourth day, the trajectory of the mice crossing the gait simulator was recorded, including gait base, stride length, and number of steps.
[0105] Test results as follows Figure 11-13As shown: In the open field test, there were no statistically significant differences among the three groups of animals at 1 month and 3 months of age, but there was a difference in the number of times Thy1-SNCA;Clu- / - crossed the central platform at 3 months of age, and the difference was more significant at 6 months of age; In the rotatable bar test, there was no difference in the grasping ability of Thy1-SNCA;Clu- / - mice at 1 month and 3 months of age, but there was a significant impairment at 6 months of age; Compared with 6M Thy1-SNCA mice, Thy1-SNCA;Clu- / - mice had significantly smaller gait base and stride length, and a significantly increased number of steps, which is due to the "shuffling" gait (shorter stride length, increased number of steps) signs (increased step length, increased number of steps) exhibited by PD patients with motor disorders.
[0106] The data above shows that there was no difference among the three groups of mice in the earlier age period (1-5 months); however, SNCA-Clu-KO mice showed significantly different motor impairments at 6 months of age, which was almost 8 months earlier than the onset of motor impairment in Thy1-SNCA mice.
[0107] In summary, the Thy1-SNCA;Clu- / - mice constructed in this invention exhibit significant PD pathology at 6 months of age compared to traditional PD models, providing more mouse models for PD research.
[0108] It should be noted that the above embodiments are only some embodiments of the present invention and not all embodiments, and are only used to illustrate the technical solutions of the present invention and not to limit it; based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
Claims
1. Application of a Thy1-SNCA; Clu knockout mouse model in preparing a Parkinson's disease model, wherein the construction method of the Thy1-SNCA; Clu knockout mouse model comprises the following steps: obtaining a Clu-KO mouse by knocking out a sequence as shown in SEQ ID NO. 1 in a Clu gene of a wild-type mouse using a CRISPR / Cas9 system, wherein a gRNA target sequence in the CRISPR / Cas9 system is as shown in SEQ ID NO. 2 and SEQ ID NO. 3; the knocking out method comprises: microinjecting the CRISPR / Cas9 system and a homologous recombination vector into a fertilized egg of a female C57BL / 6N background mouse, then transplanting the fertilized egg into a pseudopregnant female mouse, waiting for the female mouse to become pregnant and give birth to a baby, and the recipient mouse gives birth to F0 generation mice, and then extracting genomic DNA for identification to obtain the Clu-KO mouse; crossing a Thy1-SNCA mouse with the Clu-KO mouse to obtain F1 generation, and identifying a Thy1-SNCA; Clu- / + mouse; backcrossing the Thy1-SNCA; Clu- / + mouse with the Clu-KO mouse to obtain F2 generation, and identifying a mouse of a target genotype, i.e., a Thy1-SNCA; Clu- / - mouse.
2. Use according to claim 1, characterized in that, The sequence of a primer for identifying the Clu-KO mouse is as shown in SEQ ID NO. 4 and SEQ ID NO.
5.
3. Use according to claim 1, characterized in that, The primer for identifying the Thy1-SNCA; Clu- / + mouse comprises primers with sequences as shown in SEQ ID NO. 7-10.
4. Use according to claim 3, characterized in that, The primer for identifying the mouse of the target genotype comprises primers with sequences as shown in SEQ ID NO. 4-10.
Citation Information
Patent Citations
Development of transgenic model for interventions in neurodegenerative diseases
WO2003015507A1