An anti-alzheimer's disease marker gene, and a method for screening anti-alzheimer's disease drugs based on the gene and the drugs

Abstract

The application discloses an anti-Alzheimer's disease marker gene and a method and a drug for screening an anti-Alzheimer's disease drug based on the gene, namely, application of a screened drug, soybean glycoside II, in the anti-Alzheimer's disease aspect, and belongs to the technical field of drug screening. Firstly, an Alzheimer's disease model of zebra fish fry is constructed, the zebra fish fry is preliminarily screened through behavior, then uplink and downlink primers of an anti-Alzheimer's disease marker gene pla2g12a are designed, RT-qPCR verification is carried out, and according to the expression trend of the anti-Alzheimer's disease marker gene pla2g12a, it is determined whether the screened drug has an anti-Alzheimer's disease effect. Compared with a previous method for screening only by means of behavior and biochemical indexes, the anti-Alzheimer's disease drug screening method greatly saves the time for drug screening, improves the screening efficiency, and provides a new thought for accurately and efficiently screening an anti-Alzheimer's disease drug.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of drug screening, in particular to an anti-Alzheimer's disease marker gene and a method for screening anti-Alzheimer's disease drugs based on the gene and the drugs, i.e. the application of drug daidzein II in the aspect of anti-Alzheimer's disease. BACKGROUND

[0002] Alzheimer's disease (AD) is a neurodegenerative disease, and drugs that play a role in neuroprotection can improve Alzheimer's disease. People have been researching ways to quickly and efficiently screen anti-Alzheimer's disease drugs. Among them, animal model drug screening is a commonly used method. This method requires the establishment of pig models, mouse models or primate models, and the construction of animal disease models requires systematic theory and complex technical means to obtain effective support, and has very strict requirements for the growth environment of animals. Zebrafish has high homology with human genes, short development cycle, small size and other advantages, which provides the possibility for it to be used as an animal model for screening active drugs. At present, the method for screening anti-Alzheimer's disease drugs using zebrafish models mainly relies on a large amount of behavioral data and biochemical indicators, such as swimming distance, swimming speed, reaction ability, brain apoptosis cell number, and the number of pathological plaques formed by Aβ protein aggregation.

[0003] For example, application number 202110295180.0, a method for screening anti-Alzheimer's disease drugs based on behavior and biochemical indicators and drugs screened by the method. The invention discloses the use of behavioral and biochemical indicators to screen anti-Alzheimer's disease drugs and determine whether the drugs have anti-Alzheimer's disease. However, the following problems were found during the operation of this method: first, the stress recovery ability of each fish in the light and dark alternating environment needs to be recorded for 60 minutes, and the amount of data to be counted is large and the cycle is long; second, the biochemical indicators of zebrafish need to be tested. Since the size of zebrafish larvae is very small, the accuracy requirements for the experiment are high when counting the number of brain apoptosis cells and the number of pathological plaques, otherwise the accuracy of the experiment will be affected.

[0004] How to simplify the analysis of behavioral data of zebrafish models and accurately describe the effect of anti-Alzheimer's disease drugs on behavior, and research more efficient and accurate anti-Alzheimer's disease drug screening methods, is a problem that needs to be solved at present. SUMMARY

[0005] To solve the above problems, the purpose of the present application is to provide an anti-Alzheimer's disease marker gene and a method for screening anti-Alzheimer's disease drugs based on the gene and the drugs, i.e. the application of drug daidzein II in the aspect of anti-Alzheimer's disease.

[0006] The application is achieved by the following technical solutions to realize the above-mentioned purpose.

[0007] The application of the anti-Alzheimer's disease marker gene in screening of anti-Alzheimer's disease drugs, wherein the anti-Alzheimer's disease marker gene is pla2g12a.

[0008] Preferably, first, a zebrafish juvenile Alzheimer's disease model is constructed, the zebrafish juveniles are preliminarily screened through behavior, then upstream and downstream primers of the anti-Alzheimer's disease marker gene pla2g12a are designed, RT-qPCR verification is performed, and according to the expression trend of the anti-Alzheimer's disease marker gene pla2g12a, it is determined whether the drug to be screened has an anti-Alzheimer's disease effect.

[0009] The application also includes a screening method of anti-Alzheimer's disease drugs based on the above-mentioned anti-Alzheimer's disease marker gene, including the following steps:

[0010] (1) Constructing a zebrafish juvenile Alzheimer's disease model

[0011] 3-day-old zebrafish juveniles are used as model animals, and a zebrafish juvenile Alzheimer's disease model is established by continuously inducing 3 days with 80 μM concentration of AlCl3 solution;

[0012] (2) Determining the maximum safe concentration LC1 of the drug to be screened and the positive drug galantamine to 3-day-old zebrafish juveniles in continuous treatment for 3 days at the age of 3-6 days;

[0013] (3) Treating the zebrafish juveniles

[0014] The 3-day-old zebrafish juveniles are randomly divided into a blank control group, an AlCl3 model group, a positive drug group and a drug screening group, the number of fish in each group is the same, and the zebrafish juveniles are placed in 24-well cell culture plates, 10-15 fish per well, wherein only fresh fish water is added to each well of the blank control group cell culture plate, 80 μM AlCl3 solution is added to each well of the AlCl3 model group cell culture plate, and 80 μM AlCl3 solution and the maximum safe concentration LC1 or less of the positive drug / drug to be screened are added to each well of the positive drug group and the drug screening group cell culture plate, the water and drug solution are replaced once a day during the experiment, the drug immersion is performed for 3 days, and no feeding is required during the period.

[0015] (4) Behavior screening

[0016] Randomly pick each group of juvenile fish, wash with fish water, and place them in a 48-well plate, add 1ml fish water to each well, and place them in a Zebrabox zebrafish behavior analyzer dark box, and process the zebrafish juveniles with a 5-minute dark cycle and a 1-minute light cycle, record the movement trajectory of each group of juvenile fish, perform behavior testing, and intercept the movement distance and speed change data 10 seconds before and after the light-dark alternation point for analysis; each group of juvenile fish is tested three times, and the average value is calculated;

[0017] (5) Based on the Real-time PCR technology, the expression level of the anti-Alzheimer's disease marker gene pla2g12a in each group is detected, and the anti-Alzheimer's disease drug is screened out:

[0018] The primer sequence of the anti-Alzheimer's disease marker gene pla2g12a is designed:

[0019] pla2g12a-RT-F: TCATCCTCTCCTGCGTTACC,

[0020] pla2g12a-RT-R: GATCAGGTCCAGAGCCATGT,

[0021] After the behavior of the zebrafish in each group is recorded, the zebrafish is washed with fish water for two to three times, transferred to a centrifugal tube, and after high-speed centrifugation, the upper liquid is absorbed and the bottom zebrafish tissue is left; the total RNA of the zebrafish in different experimental groups is extracted using an RNA extraction kit, the RNA concentration is measured using an ultramicro spectrophotometer, the RNA is reversely transcribed into cDNA using a reverse transcription kit, and the cDNA of each group after reverse transcription is used as a template, and the primers to be detected are added in a qRT-PCR instrument for amplification, three parallel tests are set for each group, and the expression level of the anti-Alzheimer's disease marker gene pla2g12a in each group is detected;

[0022] (6) Judgment standard of the anti-Alzheimer's disease drug:

[0023] Compared with the AlCl3 model group, the total distance of the anti-Alzheimer's disease drug is larger, and the swimming speed is increased; the anti-Alzheimer's disease drug and the positive drug galantamine and donepezil have the same expression change of the anti-Alzheimer's disease marker gene pla2g12a, which is up-regulated.

[0024] Preferably, the drug to be screened is a Danshen extract, a Yuzhu extract, a Eucommia male flower extract, a Ginkgo biloba leaf extract, and a soybean glycoside II.

[0025] The application also includes an anti-Alzheimer's disease drug soybean glycoside II, which is screened out by the above method.

[0026] Compared with the prior art, the application has the following advantages:

[0027] This invention uses transcriptomics to identify the anti-Alzheimer's disease marker gene pla2g12a. This gene is independent of the nervous system and is a homologous gene shared by humans and zebrafish. First, an Alzheimer's disease model was constructed in juvenile zebrafish. Behavioral data from 10 seconds before and after light-dark cycles were used for initial screening. Then, upstream and downstream primers for the anti-Alzheimer's disease marker gene pla2g12a were designed, and RT-qPCR was performed for verification. Since the expression trend of the anti-Alzheimer's disease marker gene pla2g12a was consistent in the positive drug groups (galantamine, donepezil, and daidzein II), daidzein II was confirmed to have anti-Alzheimer's disease activity. Compared with previous methods relying solely on behavioral and biochemical indicators, the drug screening method of this invention significantly saves screening time and improves screening efficiency, providing a new approach for accurate and efficient screening of anti-Alzheimer's drugs. Attached Figure Description

[0028] Figure 1 A schematic diagram showing the total distance traveled by each group of zebrafish within 20 seconds before and after the light-dark transition;

[0029] Figure 2 A schematic diagram showing the speed of each group of zebrafish within 20 seconds before and after the alternation of light and dark;

[0030] Figure 3 for Figure 2 A schematic diagram of the velocity of the blank group and the AlCl3 model group within 20 seconds before and after the alternation of light and dark;

[0031] Figure 4 for Figure 2 A schematic diagram of the velocity of the galantamine positive control group and the soybean cerebroside II treatment group within 20 seconds before and after the light-dark cycle.

[0032] Figure 5 for Figure 2 A schematic diagram showing the speeds of the Salvia miltiorrhiza extract treatment group and the Acorus tatarinowii extract treatment group within 20 seconds before and after the light-dark cycle.

[0033] Figure 6 for Figure 2 A schematic diagram of the speed of the Eucommia ulmoides male flower extract treatment group and the Ginkgo biloba leaf extract treatment group within 20 seconds before and after the light-dark cycle.

[0034] Figure 7 A schematic diagram showing the expression levels of the pla2g12a gene in each group of zebrafish.

[0035] Figure 8 A schematic diagram showing the total distance traveled by each group of zebrafish within 20 seconds before and after the light-dark transition;

[0036] Figure 9 Speed profile of each group of zebrafish in 5 cycles of light-dark alternation;

[0037] Figure 10 Speed profile of the blank group and the AlCl3 model group in 5 cycles of light-dark alternation; Figure 9

[0038] Figure 11 Speed profile of the galantamine positive drug control group and the soybean glycosides II drug treatment group in 5 cycles of light-dark alternation; Figure 9

[0039] Figure 12 Speed profile of the salvia miltiorrhiza extract drug treatment group and the alocasia extract drug treatment group in 5 cycles of light-dark alternation; Figure 9

[0040] Figure 13 Speed profile of the eucommia male flower extract drug treatment group and the ginkgo biloba leaf extract drug treatment group in 5 cycles of light-dark alternation. Figure 9

[0041] Figure 14 Aβ plaque aggregation of zebrafish, with thioflavin S staining of Aβ plaques in the brain tissue of the Ctl, AlCl3 and AlCl3+galantamine or AlCl3+soybean glycosides II groups (Aβ is marked with an arrow). Scale bar = 100 μm;

[0042] Figure 15 Gene expression of the marker gene pla2g12a in the mouse AD model group and the two positive drug groups;

[0043] Figure 16 AD-like behavior results of pla2g12a gene knockdown zebrafish;

[0044] Figure 17 Aβ plaque aggregation of pla2g12a gene knockdown zebrafish, with thioflavin S staining of Aβ plaques in the brain tissue of the Ctl, pla2g12a knockdown zebrafish, pla2g12a knockdown zebrafish+galantamine and pla2g12a knockdown zebrafish+soybean glycosides II groups (Aβ is marked with an arrow), scale bar = 100 μm.

[0045] ​​​​Legend: 1: blank group; 2: AlCl3 model group; 3: galantamine positive drug control group; 4: salvia miltiorrhiza extract drug treatment group; 5: atractylodes ovata extract drug treatment group; 6: soybean glycoside II drug treatment group; 7: eucommia ulmoides male flower extract drug treatment group; 8: ginkgo biloba extract drug treatment group; 9: donepezil positive drug control group; 10: marker gene pla2g12a knockout experiment-blank control group; 11: marker gene pla2g12a knockout experiment-AD model group; 12: marker gene pla2g12a knockout experiment-positive drug donepezil group; 13: marker gene pla2g12a knockout experiment-positive drug galantamine treatment group; 16: marker gene pla2g12a knockout experiment-soybean glycoside II drug treatment group;

[0046] *** indicates P<0.001 compared with the blank group, # indicates P<0.05 compared with the AlCl3 model group, ## indicates P<0.01 compared with the AlCl3 model group, and ### indicates P<0.001 compared with the blank group. DETAILED DESCRIPTION

[0047] The purpose of the present application is to provide an anti-Alzheimer's disease marker gene and a method for screening anti-Alzheimer's disease drugs based on the gene, and the application of the screened drug soybean glycoside II in the treatment of Alzheimer's disease. The present application will be further described below in conjunction with specific examples.

[0048] Example 1

[0049] Preparation work:

[0050] I. Collection of fish eggs

[0051] Healthy mature zebrafish of both sexes were placed in the spawning tank at around 16:00 on the same day, and the partition was removed at 8:30 the next day. After 2 hours, the fertilized eggs were collected, dead embryos were removed, the breeding water was washed repeatedly for 3 times, and then the embryos were moved into breeding water containing 2 mg / L methylene blue and placed in a 28℃ incubator for incubation and culture. After 4 hours, the embryos were observed under a microscope, and the normally developed embryos were selected for incubation and culture to 3 dpf after fertilization. Dead embryos were removed in time every day during the period.

[0052] II. Preparation of drugs to be screened

[0053] Prepare traditional Chinese medicine raw materials: salvia miltiorrhiza, atractylodes ovata, eucommia ulmoides male flower, and ginkgo biloba. Meanwhile, purchase soybean glycoside II, donepezil, and galantamine.

[0054] The above traditional Chinese medicine raw materials are extracted by water extraction method to extract the effective components in the traditional Chinese medicine raw materials:

[0055] The traditional Chinese medicine raw materials are ground into powder, added into a round-bottom flask, 3-5 times the weight of water is added to the powder, distilled and purified for at least 5 hours, centrifuged after cooling, the supernatant is collected, the lower liquid is suction filtered to obtain a filtrate, and the supernatant and the filtrate are rotary evaporated to remove water to obtain a traditional Chinese medicine extract.

[0056] The effective substances after water extraction of the Danshen, the Shichangpu, the Duzhongxionghua and the Yinxingye are Danshen extract, Shichangpu extract, Duzhongxionghua extract and Yinxingye extract respectively.

[0057] The transcriptomics determines the marker genes against Alzheimer's disease, including the following steps:

[0058] (1) Constructing a zebrafish larvae Alzheimer's disease model (AD modeling)

[0059] Take 3-day-old zebrafish larvae as a model animal, randomly transfer the 3dpf zebrafish larvae into a six-hole plate, about 40 larvae per hole, continuously induce for 3 days from 3dpf to 6dpf by 80μM concentration of AlCl3 solution, and establish a zebrafish larvae Alzheimer's disease model;

[0060] (2) Determine the maximum safe concentration LC1 of the drug to be screened and the positive drug galantamine for 3-day-old zebrafish larvae treated continuously for 3 days from 3-6 days old;

[0061] Randomly divide the 3-day-old zebrafish larvae into a blank group and a plurality of experimental groups (Danshen extract, Shichangpu extract, Duzhongxionghua extract, Yinxingye extract, and soybean glycoside II), and the number of fish in each group is the same. Place the zebrafish larvae in a 24-well cell culture plate, 8-12 fish per well, preferably 10 fish. Soak the 24-well cell culture plate with different gradient concentrations of the drug to be screened for 3 days, and each concentration is tested 3 times. Record the mortality of zebrafish, and determine the maximum safe concentration of the experimental drug and the control drug by SPSS software calculation.

[0062] The maximum safe concentrations of Danshen extract, Shichangpu extract, Duzhongxionghua extract, Yinxingye extract, and soybean glycoside II are shown in Table 1.

[0063] Table 1 Maximum safe concentration table of drugs

[0064] Drug Name Table of Maximum Safe Concentration Salvia miltiorrhiza extract 554 μg / mL Acorus gramineus extract 354 μg / mL Eucommia ulmoides male flower extract 206 μg / mL Ginkgo biloba extract 135 μg / mL Soybean glycoside II 18 μg / mL

[0065] The maximum safe concentration of galantamine is 0.5 mM according to the literature "The development of advanced structural framework as multi-target-directed ligands for the treatment of Alzheimer's disease, Z. Sang, Eur J Med Chem 192 (2020) 112180", and the experimental concentration selected by the application is 0.2 mM;

[0066] The maximum safe concentration of donepezil is 8.0 μM according to the literature "Zebrafish is a predictive model for identifying compounds that protect against brain toxicity in severe acute organophosphorus intoxication, M. Faria, Arch Toxicol 91 (4) (2017) 1891-1901", and the experimental concentration selected by the application is 6.0 μM.

[0067] III. Transcriptionomics identifies marker genes against Alzheimer's disease

[0068] The 3 dpf zebrafish larvae are transferred to a 6-well plate, 3 wells per group, 30-40 fish per well, and the blank group, AlCl3 model group, drug group (galantamine group and donepezil group) are set up, 5 ml of fresh fish water is added to the blank group, and the corresponding optimal concentration of drug solution and 80 μM AlCl3 solution are added to the galantamine group and donepezil group for co-treatment. After treatment to 6 dpf, the zebrafish are washed with fish water and pure water for 2-3 times, and then transferred to a 1.5 ml centrifuge tube, and the total RNA of the four groups of zebrafish is extracted;

[0069] The total RNA of the four groups of zebrafish after extraction is subjected to transcriptionomics research, and the gene expression differences of the four groups of zebrafish are subjected to significance analysis. Statistical methods are used for information analysis to compare the gene expression differences of the four groups of zebrafish. The specific genes found by the application meet the following requirements: ① The target gene expression of the AlCl3 model group and the drug group is opposite, for example, the target gene expression is down-regulated in the AlCl3 model group, and the target gene expression in the two positive drug groups (donepezil group and galantamine group) should be up-regulated; ② The target gene is not related to the nervous system; ③ The target gene is a homologous gene common to humans and zebrafish. After analyzing the transcriptionome sequencing results, pla2g12a is a marker gene meeting the above requirements.

[0070] IV. Drug screening on the above AlCl3 model zebrafish

[0071] (1) Zebrafish larvae were treated

[0072] 3-day-old zebrafish larvae were randomly divided into blank control group, AlCl3 model group, positive drug group and drug screening group, and the number of fish in each group was the same. The zebrafish larvae were placed in 24-well cell culture plates, 3 wells for each group, 10-15 fish per well. Fresh fish water was added to each well of the blank control group cell culture plate. 80 μM AlCl3 solution was added to each well of the AlCl3 model group cell culture plate. 80 μM AlCl3 solution and LC1 concentration of positive drug / medicine to be screened (as shown in Table 2) were added to each well of the positive drug group and drug screening group cell culture plate. The water and drug solution were changed once a day during the experiment. The zebrafish larvae were soaked in the drug for 3 days without feeding during the period.

[0073] The LC1 concentration of the positive drug / medicine to be screened was determined according to the reference "Anti-Inflammation Associated Protective Mechanism of Berberine and its Derivatives on Attenuating Pentylenetetrazole-Induced Seizures in Zebrafish, Baoyue Zhang, Journal of Neuroimmune Pharmacology (2020) 15:309-325".

[0074] The drugs of the positive drug group were galantamine and donepezil. The drugs of the drug screening group were Danshen extract, Beimu extract, Duzhong Yinhua extract, Ginkgo leaf extract and soybean glycoside II.

[0075] Table 2: Selected concentration of drugs

[0076] Drug Name Concentration Salvia miltiorrhiza extract 90 μg / mL Acorus gramineus extract 50 μg / mL Eucommia ulmoides male flower extract 50 μg / mL Ginkgo biloba extract 30 μg / mL Soybean glycoside II 1 μg / mL Galantamine 0.2 mM Donepezil 6.0 μM

[0077] (2) Behavioral screening (donepezil drug is not screened)

[0078] 24 zebrafish larvae were randomly selected from each group, washed 3 times with fish water, and placed in a 48-well plate, 1 ml of fish water and 1 zebrafish larvae per well. After 10 minutes of standing in the Zebrabox zebrafish behavior analyzer dark box, the zebrafish larvae were treated with a 5-minute dark and 1-minute light cycle. The movement trajectory of each group of zebrafish larvae was recorded, and the behavior test was performed. The movement distance and speed change data of each 10-second period before and after a light-dark alternation point were intercepted and analyzed.

[0079] The total distance traveled by each group of zebrafish during the alternating light and dark periods over 20 seconds (10 seconds before and after) is as follows: Figure 1 As shown, compared with the control group, the total activity distance of zebrafish in the AlCl3 model group was significantly reduced (P < 0.001), indicating that the Alzheimer's disease model induced by aluminum chloride was successful. Within the experimental concentration range, the galantamine positive drug group and the daidzein II group increased the total activity distance of zebrafish induced by aluminum chloride, and the difference was significant compared with the AlCl3 model group.

[0080] The speed changes of each group of zebrafish at the alternating light and dark points over 20 seconds (10 seconds before and after) are as follows: Figures 2-6 As shown, the zebrafish speed decreased in the AlCl3 model group at 15s and 20s compared to the control group (P < 0.001). This invention suggests that these two time periods can serve as key reference points for screening anti-AD drugs. Both the positive control drug galantamine and daidzein II improved zebrafish speed within the aforementioned time periods, showing significant differences compared to the AlCl3 model group (P < 0.01). Therefore, both the positive control drug galantamine and the screening drug daidzein II can improve zebrafish speed.

[0081] (3) Based on Real-time PCR technology, the expression level of the anti-Alzheimer's disease marker gene pla2g12a in each group was detected, and anti-Alzheimer's disease drugs were screened:

[0082] Collect 30-40 zebrafish from different treatment groups, wash them two to three times with fish tank water, transfer them to centrifuge tubes, centrifuge at high speed, and aspirate the supernatant, leaving the zebrafish tissue at the bottom. Use an RNA extraction kit to extract total RNA from the zebrafish from different experimental groups. Measure the RNA concentration using a micro spectrophotometer. Use a reverse transcription kit to convert the RNA into cDNA. Following the instructions for real-time quantitative PCR, use the converted cDNA as a template, add the appropriate primers, and amplify in a qRT-PCR instrument. Set up three parallel experiments for each group to detect the expression level of the anti-Alzheimer's disease marker gene pla2g12a in each group. Specifically:

[0083] After the behavioral experiment, the zebrafish larvae in the blank control group, the AlCl3 model group, the soybean glycoside II group, and the two positive drug groups were washed three times with fish water and pure water, respectively, and then collected in 1.5 mL EP tubes, 30 fish per tube, and stored in a -80°C refrigerator. When extracting RNA, 350 μL of lysis buffer was added to each EP tube, and mechanical homogenization was performed in a tissue grinder for 2 min. The high-speed centrifuge was pre-cooled, and low-temperature centrifugation was performed at 4°C for 3 min at 11000 rpm. The supernatant was added to the removal column, centrifuged at 11000 rpm for 2 min, and the inner tube was removed. An equal volume of 70% ethanol solution was added to the outer tube, mixed quickly, and then transferred to the adsorption column. Centrifugation was performed at 11000 rpm for 1 min, and the supernatant was discarded. 700 μL of deproteinization solution was added, and the mixture was incubated at room temperature for 1 min. After centrifugation at 11000 rpm for 1 min, the supernatant was discarded, and 500 μL of rinse solution was added for rinsing twice. Finally, the adsorption column was placed in an empty centrifuge tube and 40 μL of pure water was added. After incubation at room temperature for 5 min, high-speed centrifugation was performed for 1 min. The concentration of the extracted RNA in different groups was determined using a ultramicro spectrophotometer, and the RNA was stored in a -80°C refrigerator.

[0084] The RNA was quickly reversed to cDNA using a C1000 Touch gradient PCR instrument. The operation was performed according to the instructions of the reverse transcription kit. The concentration of cDNA in different groups was determined using a ultramicro spectrophotometer, and the cDNA was stored in a -20°C refrigerator.

[0085] The cDNA after reverse transcription in each group was used as a template, and a 100 μL volume of 8-tube EP tube was used for sample addition experiment. The internal reference gene was rpl13a (the gene is predicted to be a structural component of ribosomes, and its expression tends to be stable in zebrafish. In this project, the gene was used as a control gene, and the expression data was normalized for data processing, so as to reflect the expression change of the gene pla2g12a). The sample addition system is shown in Table 3. Three replicates were set for each experimental treatment group. The whole experiment was performed on an ice box to ensure that the cDNA and primers would not be degraded. After adding the primers to be tested, the real-time quantitative fluorescence detection of the gene expression change in each group was performed on a Roche real-time fluorescence quantitative PCR instrument. The amplification program is shown in Table 4.

[0086] Table 3 Real-time PCR reaction system

[0087]

[0088] Table 4 Real-time PCR program

[0089]

[0090] The primer sequence of the anti-Alzheimer's disease marker gene pla2g12a is as follows:

[0091] pla2g12a-RT-F: TCATCCTCTCCTGCGTTACC,

[0092] pla2g12a-RT-R: GATCAGGTCCAGAGCCATGT,

[0093] Primer sequences of the internal reference gene rpl13a:

[0094] rpl13a-RT-F: TCTGGAGGACTGTAAGAGGTATGC,

[0095] rpl13a-RT-R: AGACGCACAATCTTGAGAGCAG,

[0096] Statistical analysis

[0097] Statistical analysis was performed using GraphPad Prism 8.0. Data were presented as mean ± standard error. One-way ANOVA was used for significant difference analysis, and P < 0.05 was considered statistically significant.

[0098] The expression changes of the anti-Alzheimer's disease marker gene pla2g12a in each group are shown in Figure 7 It can be seen that, within the experimental period, the modeling drug aluminum chloride can significantly down-regulate the expression of pla2g12a gene in zebrafish body. Within the corresponding concentration range of the drug, compared with the AlCl3 model group, the positive drugs galantamine, donepezil and soyasapogenin II can up-regulate the expression of pla2g12a gene, and the data are statistically significant; the difference between the Danshen extract treatment group and the AlCl3 model group is small, the YUANHUANG extracts treatment group and the Duzhong YANGHUA extract treatment group all down-regulate the expression of pla2g12a gene, and the GINKGO LEAF extract treatment group up-regulates the expression of pla2g12a gene, but it is not statistically significant.

[0099] In summary, compared with the AlCl3 model group, the total distance of soyasapogenin II drug swimming increases, and the swimming speed increases; the expression changes of the anti-Alzheimer's disease marker gene pla2g12a are the same as those of the positive drugs galantamine and donepezil, which are up-regulated, so soyasapogenin II can be used as an anti-Alzheimer's disease drug.

[0100] During the behavioral screening process of step four, the zebrafish larvae were treated with 5 minutes of darkness and 1 minute of light as a cycle, the motion trail of each group of larvae was recorded, the behavior test was performed, and the motion distance and speed change data of 5 light-dark cycles were intercepted, and each 10 seconds before and after a light-dark alternation point was analyzed; the total motion distance of each group of zebrafish in 5 light-dark cycles is shown in Figure 8The total distance of the zebrafish activity was significantly reduced in the AlCl3 model group compared with the blank group (P<0.001), indicating that the Alzheimer's disease model induced by aluminum chloride was successful. In the experimental concentration range, galantamine and soybean glycosides II could increase the total distance of the zebrafish activity induced by aluminum chloride, and there was a significant difference compared with the AlCl3 model group. The data of each group were basically the same as the trend of Figure 2

[0101] The speed change of the zebrafish in each group in 5 cycles of light and dark alternation is shown in Figures 9-13 It can be seen that the speed of the zebrafish presents a cyclic change with the light and dark alternation cycle, and the speed change is obvious at the light and dark alternation point. The speed of the zebrafish in the AlCl3 model group is reduced compared with the blank group. The positive drugs galantamine and soybean glycosides II can improve the speed of the zebrafish in the above time period. Compared with the AlCl3 model group, there is a significant difference (P<0.01). Therefore, the positive drugs galantamine and the drug to be screened soybean glycosides II can improve the speed of the zebrafish. The rest of the drug groups cannot improve the speed of the zebrafish. The total distance of the movement at the light and dark alternation point for 20 seconds (10 seconds before and after) and the speed change are selected for the behavior screening of the zebrafish in the present application, which can directly and accurately describe the effect of the drug on the behavior of the zebrafish. The behavior results obtained by selecting 5 light and dark alternation times are the same, and therefore, the behavior of the present application directly selects the data within 20 seconds at the light and dark alternation point for processing, which greatly shortens the recording time, reduces the total workload of the screening, and improves the efficiency of the drug screening.

[0102] (4) Aβ plaque deposition detection

[0103] The zebrafish larvae were fixed in 4% paraformaldehyde solution, and then embedded in conventional agar blocks. Then, frozen at -20°C until sectioning (at intervals of 7 μm). Then, the tissue sections were subjected to thioflavin S staining. Briefly, washed several times with 0.01M phosphate buffered saline (PBS) at room temperature, each time for 5-10 minutes. Then, incubated with 0.3% thioflavin S (Sigma-Aldrich, Darmstadt, Germany) solution in the dark at room temperature overnight. Finally, washed with 0.01M PBS in the dark for 30 minutes, and analyzed with a confocal inverted microscope. The results are shown in Figure 14

[0104] As shown in Figure 14 ​​As shown, it represents the AD zebrafish brain Aβ plaque deposition, AICI3 modeling zebrafish Aβ plaque deposition increased, that is, AD-like pathological changes, after the positive drug and soybean glycosides II treatment, Aβ plaque deposition decreased, zebrafish AD-like pathological changes were improved. The experimental data proves the scientificity of AICI3 modeling Alzheimer's disease and preliminarily verifies the effectiveness of soybean glycosides II against AD.

[0105] (5) Gene knockout

[0106] Establishment of mouse model

[0107] The same batch of adult male wild C57 mice were selected for the experiment, and randomly divided into 5 groups, namely normal control group, model control group, positive drug (donepezil + galantamine) group, 10 in each group. Except for the normal control group, the rest of the groups were injected with β-amyloid protein to induce AD, and the positive drug administration group was injected with donepezil and galantamine after the modeling was successful. First, intraperitoneal injection of chloral hydrate (400 mg / kg) was used to anesthetize the rats, and routine skin preparation and disinfection were performed. Then, the skin on the top of the rat's skull was cut, and the rat was fixed with a brain stereotaxic instrument. The positioning method is as follows: taking the flat skull position, determining the right side 3.8 mm, 2.5 mm beside the midline, and reaching 3.0 mm below the skull surface as the right hippocampal dorsal part. Finally, the cerebrospinal fluid was withdrawn, and 10 μL microsyringe was used to slowly inject 1 μL Aβ25-35 within 5 min, and the needle was left for 10 min. The modeling method refers to the literature: Luolan, Wu Xiaokuan, Gao Huijing, et al. Protective effect of cistanche total glycosides on Alzheimer's disease model rats [J]. Chinese pharmacy, 2013, 24 (23): 2122-5.

[0108] Zebrafish embryos in the early development stage, the oligonucleotide is directly injected into the cytoplasm of the fertilized egg by microinjection, so that it is expressed during embryonic development. After the injection of oligonucleotide, it is necessary to detect whether the expression level of the target gene is reduced. Real-time quantitative PCR is used. Finally, the phenotype changes of zebrafish can be observed and recorded, and the influence of target gene knockdown on its development, behavior or other biological characteristics is analyzed.

[0109] The results are shown in Figures 15-17 .

[0110] As shown in Figure 15 , compared with the blank control group, the expression of the gene pla2g12a in the mouse AD model group was significantly decreased; compared with the AD model group, the expression of the gene in the two positive drug groups was significantly up-regulated. It is shown that the expression of the gene in zebrafish AD model or mouse AD model is consistent, which can reflect the clear correlation between the Alzheimer's disease marker gene pla2g12a and AD.

[0111] AsFigure 16 As shown in the figure, Figure 16 -A figure shows that the pla2g12a gene knockdown in zebrafish is successful. Figure 16 In the B figure, the pla2g12a gene knockdown reduces the swimming distance of zebrafish, while the positive drug and soybean glycoside II can increase the swimming distance of pla2g12a gene knockdown zebrafish. Figure 16 In the C-E figure, the pla2g12a gene knockdown zebrafish group has a slower swimming speed, and soybean glycoside II and galantamine can improve the speed reduction of pla2g12a gene knockdown zebrafish, showing a significant difference (P<0.001), which is consistent with the results of Figures 1-2 The above data were analyzed using GraphPad Prism 9.5. The data are presented as means ± SEM. One-way ANOVA was used for significant difference analysis, and P<0.05 was considered statistically significant.

[0112] As Figure 17 As shown in the figure, the pla2g12a gene knockdown zebrafish has increased Aβ plaque deposition in the brain, i.e., AD-like pathological changes occur. After treatment with positive drugs and soybean glycoside II, the Aβ plaque deposition is reduced, and the AD-like pathological changes in zebrafish are improved. This experimental data further proves the correlation between pla2g12a gene changes and AD symptoms, and further proves the effectiveness of using pla2g12a gene changes to screen anti-AD drugs. This experimental data further proves the correlation between pla2g12a gene changes and AD symptoms, and further proves the effectiveness of using pla2g12a gene changes to screen anti-AD drugs.

[0113] The above data were analyzed using GraphPad Prism 9.5. The data are presented as means ± SEM. One-way ANOVA was used for significant difference analysis, and P<0.05 was considered statistically significant.

Claims

1. The application of anti-Alzheimer's disease marker genes in screening anti-Alzheimer's disease drugs, characterized by: The anti-Alzheimer's disease marker gene is pla2g12a First, an Alzheimer's disease model of zebrafish larvae is constructed, the zebrafish larvae are preliminarily screened through behavior, and then the anti-Alzheimer's disease marker gene pla2g12a Upstream and downstream primers are designed, RT-qPCR verification is performed, and according to the expression trend of the anti-Alzheimer's disease marker gene pla2g12a , it is determined whether the drug to be screened has an anti-Alzheimer's disease effect.

2. The method for screening anti-Alzheimer's disease drug based on the anti-Alzheimer's disease marker gene according to claim 1, characterized in that: The method comprises the following steps: (1) Constructing a zebrafish juvenile Alzheimer's disease model Take 3-day-old zebrafish juveniles as model animals, and continuously induce the zebrafish juveniles by using an AlCl3 solution with a concentration of 80 μM for 3 days to construct a zebrafish juvenile Alzheimer's disease model; (2) Determining the maximum safe concentration LC1 of the to-be-screened drug and the positive drug galantamine for 3-day-old zebrafish juveniles in continuous treatment for 3 days at the age of 3-6 days; (3) Treating the zebrafish juveniles Divide the 3-day-old zebrafish juveniles into a blank control group, an AlCl3 model group, a positive drug group and a drug screening group in a random manner, and the number of fish in each group is the same. Place the zebrafish juveniles in a 24-well cell culture plate, and add 10-15 fish to each well. In the blank control group, only fresh fish water is added to each well of the cell culture plate. In the AlCl3 model group, 80 μM of the AlCl3 solution is added to each well of the cell culture plate. In the positive drug group and the drug screening group, 80 μM of the AlCl3 solution and the maximum safe concentration LC1 or less of the positive drug / to-be-screened drug are added to each well of the cell culture plate. Change the water and the drug solution once a day during the experiment, and the zebrafish juveniles are soaked in the drug solution for 3 days without feeding during the period; (4) Behavioral screening Randomly select the juveniles in each group, wash them with fish water, place them in a 48-well plate, add 1 ml of fish water to each well, and place them in a Zebrabox zebrafish behavior analyzer dark box. Treat the zebrafish juveniles with 5 minutes of darkness and 1 minute of light as a cycle, record the movement trajectory of the juveniles in each group, perform a behavior test, and analyze the movement distance and speed change data 10 seconds before and after the light-dark transition point. Perform three experiments on the juveniles in each group, and calculate the average value; (5) Based on Real-time PCR technology, detect anti-Alzheimer's disease marker genes in each group. pla2g12a The expression levels of these factors were used to screen for anti-Alzheimer's drugs. Alzheimer's disease marker genes pla2g12a Design of primer sequences: pla2g12a - RT-F: TCATCCTCTCCTGCGTTACC, pla2g12a - RT-R: GATCAGGTCCAGAGCCATGT, After collecting the behavior records of the zebrafish in different treatment groups, the fish were washed with fish water for two to three times, transferred to a centrifugal tube, and after high-speed centrifugation, the upper liquid was absorbed and the bottom zebrafish tissue was left; the total RNA of the zebrafish in different experimental groups was extracted using an RNA extraction kit, the RNA concentration was determined using an ultramicro spectrophotometer, the RNA was reversely transcribed into cDNA using a reverse transcription kit, and the expression levels of the anti-Alzheimer's disease marker genes in each group were detected by referring to the instructions of the real-time fluorescence quantitative PCR, using the cDNA after reverse transcription in each group as a template, adding the measured primers in a qRT-PCR instrument, setting three parallel tests for each group, and detecting the expression levels of the anti-Alzheimer's disease marker genes in each group pla2g12a ​ (6) Judgment standard of the anti-Alzheimer's disease drug: Compared with the AlCl3 model group, the total distance of swimming of the anti-Alzheimer's drug increased, and the swimming speed increased; the anti-Alzheimer's drug and the positive drug galantamine and the anti-Alzheimer's drug pla2g12a signaling gene expression changes were the same, all up-regulated.

3. The method for screening anti-Alzheimer's disease drug based on anti-Alzheimer's disease marker genes according to claim 2, characterized in that: The to-be-screened drug is a Danshen extract, a Yu-Shen extract, a Eucommia male flower extract, a Ginkgo biloba leaf extract and a soybean glycoside II.

4. Application of the soybean glycoside II in the preparation of an anti-Alzheimer's disease drug.

Images