A recombinant type I collagen Pro.C1 and its preparation method and application

Abstract

The present invention discloses a recombinant type I collagen protein Pro.C1, whose amino acid sequence is shown in SEQ ID NO.5. Also disclosed are its encoding gene, expression vector, host bacteria, preparation method and application. The recombinant type I collagen protein Pro.C1 of the present invention can be expressed by prokaryotic fermentation, has no cytotoxicity, has high biological activity, has the effects of promoting cell proliferation, promoting collagen regeneration, and firming support, has good water solubility, stable quality, and can be widely used in skin care products, skin repair dressings, medical cosmetology and other fields.

Description

Technical Field

[0001] The invention relates to a recombinant type I collagen Pro.C1 and a preparation method and application thereof, belonging to the technical field of protein expression. Background Art

[0002] Collagen is a high-grade protein whose molecules are composed of a variety of amino acids, including proline, glycine, etc. Its unique biological activity is built on the three-dimensional structure of triple superhelix. As the most abundant and widely distributed protein in the human body, collagen builds a tough support structure in the skin, bones and connective tissues, and is closely related to key processes such as maintaining the youthful state of the skin, wound healing and cell regeneration. Adult skin is mainly rich in type I collagen, while infant skin is mainly rich in type III collagen, which gives the skin delicateness and elasticity. However, with age, the body's ability to synthesize type III collagen decreases, and the loss of collagen accelerates, causing signs of skin aging.

[0003] Aging is a physiological process that occurs naturally and cannot be avoided in organisms. Aging is usually accompanied by a chronic, low-grade, systemic inflammation, which involves the activation of inflammatory networks and the release of related cytokines, including key pro-inflammatory mediators such as TNF-α, IL-6, and IL-1β. This process is an important driving force for inducing aging and aging-related diseases. As a complex physiological mechanism, there are currently free radical theory, damage theory, genetic theory, immune theory, telomere theory, etc. The free radical theory of aging proposed by Denham Harman in 1956 believes that the degenerative changes in the aging process are caused by the harmful effects of free radicals produced during normal cell metabolism. The free radicals mentioned here are mainly oxygen free radicals, such as superoxide anion free radicals, lipid oxygen free radicals, hydroxyl free radicals, nitrogen dioxide and nitric oxide free radicals. Maintaining an appropriate level of antioxidants and free radical scavengers in the body can prolong life and delay aging.

[0004] More and more studies have shown that collagen may have anti-aging, anti-inflammatory and collagen regeneration effects. However, this requires in-depth analysis of the collagen sequence to obtain the appropriate sequence to effectively exert the corresponding effects, resulting in no suitable collagen being widely used. Summary of the invention

[0005] The purpose of the present invention is to provide a recombinant type I collagen Pro.C1.

[0006] The technical solution adopted by the present invention is:

[0007] A recombinant type I collagen Pro.C1, whose amino acid sequence is shown in SEQ ID NO.5.

[0008] The gene encoding the aforementioned recombinant type Ⅰ collagen Pro.C1.

[0009] Preferably, its nucleotide sequence is shown as SEQ ID NO.6.

[0010] The expression vector of the aforementioned recombinant type Ⅰ collagen Pro.C1.

[0011] The host bacteria of the aforementioned recombinant type Ⅰ collagen Pro.C1.

[0012] The aforementioned method for preparing the recombinant type I collagen Pro.C1 comprises the following steps:

[0013] (1) constructing the aforementioned expression vector and transforming it into an expression host bacterium;

[0014] (2) Cultivating the expression host bacteria and inducing the expression of the recombinant protein;

[0015] (3) Purify the expression product to obtain the aforementioned recombinant type I collagen Pro.C1.

[0016] The aforementioned recombinant type I collagen Pro.C1 is used to promote cell proliferation in vitro.

[0017] The aforementioned recombinant type I collagen Pro.C1 is used to promote cell adhesion in vitro.

[0018] The aforementioned recombinant type I collagen Pro.C1 is used to promote cell secretion of Elastin in vitro.

[0019] The application of the aforementioned recombinant type I collagen Pro.C1 in promoting the in vitro synthesis of type I collagen.

[0020] Beneficial effects of the present invention:

[0021] The recombinant type I collagen Pro.C1 of the present invention can be expressed by prokaryotic fermentation, has no cytotoxicity, high biological activity, and has the effects of promoting cell proliferation, promoting collagen regeneration, and firming support. It has good water solubility and stable quality, and can be widely used in skin care products, skin repair dressings, medical cosmetology and other fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The plasmid map of the expression vector pET30a-Pro.C1 of the present invention.

[0023] Figure 2The SDS-PAGE gel image of the induced expression of the recombinant type I collagen Pro.C1 of the present invention: lane 1 is the supernatant after the DE3-pET30a-Pro.C1 engineering bacteria are crushed, and lane 2 is the precipitate after the DE3-pET30a-Pro.C1 engineering bacteria are crushed.

[0024] Figure 3 The cytotoxicity test results of the recombinant type I collagen Pro.C1 of the present invention.

[0025] Figure 4 The cell adhesion activity test results of the recombinant type I collagen Pro.C1 of the present invention.

[0026] Figure 5 Elastin ELISA test results of the recombinant type I collagen Pro.C1 of the present invention.

[0027] Figure 6 The test results of promoting collagen regeneration by the recombinant type I collagen Pro.C1 of the present invention. DETAILED DESCRIPTION

[0028] The present invention is further illustrated by examples below, but is not intended to be limiting of the present invention. The specific materials used in the embodiments of the present invention and their sources are provided below. However, it should be understood that these are merely exemplary and are not intended to limit the present invention, and materials identical or similar to the types, models, qualities, properties or functions of the following reagents and instruments can be used to implement the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0029] Example 1: Preparation of recombinant type I collagen Pro.C1 expression vector

[0030] (1) Gene design and synthesis

[0031] In the present invention, an expression vector of recombinant type I collagen Pro.C1 is constructed, and its amino acid sequence is shown in SEQ ID No.5, wherein SEQ ID No.5 is formed by connecting and splicing SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, and SEQ ID No.4, and its nucleotide sequence is shown in SEQ ID No.6. The nucleotide sequence SEQ ID No.6 is entrusted to Beijing Liuhe BGI Genomics Technology Co., Ltd. for synthesis.

[0032] Primer design:

[0033] Primer name Primer sequences Vector-F CACCATCACCATCACCACTGAGATC(SEQ ID No.7) Vector-R CATATGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGG(SEQ ID No.8) Target fragment-F GAAGGAGATATACATATGGGACCCCCCGGAGAA(SEQ ID No.9) Target fragment-R GTGATGGTGATGGTGGCTAGCACCGGACGGAC(SEQ ID No.10)

[0034] (2) Construction of recombinant expression vector

[0035] The above-synthesized gene fragment was used as a template for PCR amplification, and the target gene fragment and the pET30a expression vector backbone were connected by Gibson-plasmid connection to obtain the corresponding plasmid, which was named pET30a-Pro.C1.

[0036] PCR amplification system:

[0037] System components Ingredient volume Primer F 2.5μL Primer R 2.5μL 2xSuperNova PCR Mix(Dye) 25μL pET30a plasmid 1μL <![CDATA[ddH 2 The]]> To 50μL

[0038] After the PCR system was prepared, it was mixed and centrifuged. The PCR amplification conditions were as follows: the first stage was pre-denaturation at 98°C for 30s; the second stage was denaturation at 98°C for 10s, annealing at 50-72°C for 30s, extension at 72°C for 30s / kb, and 33 cycles; the third stage was final extension at 72°C for 2min. The PCR product was recovered using a universal DNA purification kit (Tiangen Biochemical Technology Co., Ltd.) and the operation steps in the product manual were followed.

[0039] Gibson Connection:

[0040] System components Ingredient volume Gibson Assembly Master Mix(2X) 5μL Connect fragments 0.2–1pmols*XμL <![CDATA[dd H 2 The]]> (5-X)μL Overall system 10μL

[0041] After mixing the above components on ice, place in a 37°C heat bath for 60 min. The obtained ligation product is stored on ice or at -20°C for subsequent competent cell transformation.

[0042] The ligation product was transformed into the host bacteria E. coli-DH5α by heat shock method, coated on LB culture resistance plate, incubated at 37℃ overnight, randomly picked positive clones, cultured in LB liquid medium, 37℃, 220rpm overnight, and the plasmid was extracted using a plasmid rapid extraction kit to successfully construct the plasmid pET30a-Pro.C1, the map of which can be found in Figure 1 .

[0043] pET30a is the most commonly used plasmid vector. It is expected that other commonly used plasmid vectors, such as pET28a and pET32a, can also be used to construct and express the amino acids shown in SEQ ID No.5.

[0044] (3) Construction of engineered bacteria

[0045] The recombinant expression plasmid obtained above was transferred into the competent E. coli cells BL21 (DE3) by heat shock, and positive E. coli genetically engineered bacteria were screened. The specific process was as follows: ① 5 μL of the recombinant expression plasmid was added to 100 μL of the competent E. coli cells BL21 (DE3), and the mixture was placed on ice for 30 min; ② the mixture was heat shocked in a 42°C water bath for 90 s, and then quickly placed on ice for 2 min; ③ 500 μL of non-resistant LB liquid medium (10 g / L peptone, 5 g / L PBS) was added to the mixture. / L yeast extract, 10g / L sodium chloride), 37°C, 220rpm conditions for 0.5h; ④ Take 200μL of the bacterial solution and evenly spread it on an LB solid culture medium plate containing kanamycin resistance (10g / L peptone, 5g / L yeast extract, 10g / L sodium chloride, 15g / L agar, 50μg / mL kanamycin); ⑤ Invert the plate and culture it in a 37°C constant temperature box for about 16h, until clearly visible colonies grow, and obtain the corresponding DE3-pET30a-Pro.C1 engineered bacteria.

[0046] Example 2: Induced expression of engineered bacteria

[0047] The single colony on the plate was placed in LB liquid medium containing kanamycin antibiotics, and cultured at 37°C, 220rpm for 10 hours. This was the primary seed solution, which was inoculated into a new LB medium at a 1% inoculum and cultured at 37°C overnight. This was the secondary seed solution, which was then inoculated into a new LB medium at a 5% inoculum and cultured at 37°C for 2 hours. IPTG was added at a final concentration of 0.5 mM and 18°C ​​for induction expression, and cultured for 20 hours. The bacteria were collected by centrifugation at 4000g and 4°C for 20 minutes.

[0048] The cells were resuspended in lysis buffer (20 mM Tris-HCl, 1 mM EDTA, 500 mM NaCl, pH 8.5), 100X protease inhibitor PMSF was added, and then the cells were disrupted by ultrasonication at 360W for 30 min (ultrasonication for 3 s and 6 s intervals). 1 mL of the disrupted liquid was centrifuged at 4°C and 10000 g for 10 min, 80 μL of the supernatant was taken, and the precipitate was resuspended in 1000 μL of lysis buffer. 80 μL of the resuspended liquid was taken, and 20 μL of 5X protein loading buffer was added to the supernatant and the precipitate. After mixing, the mixture was heated in a boiling water bath for 10 min for SDS-PAGE running. The results are shown in FIG. Figure 2 As shown, under induction, the constructed DE3-pET30a-Pro.C1 engineering bacteria expressed protein.

[0049] Example 3: Purification of expression products

[0050] The crushed liquid obtained in Example 2 was centrifuged at 10000g and 4°C for 30min, the supernatant was collected, the Ni affinity column material was washed with clean water, the column material was equilibrated with buffer 1 (25mMTris, 200mM NaCl, pH8.0), the sample was loaded, the impurities were rinsed with a washing buffer containing 20mM imidazole (20mM imidazole, 25mM Tris, 200mM NaCl, pH8.0), and the target protein was eluted with a solution containing 250mM imidazole (250mM imidazole, 25mM Tris, 200mM NaCl, pH8.0); the column material was washed with a solution containing 1M imidazole, then washed with water, and finally filled with 20% ethanol.

[0051] Example 4: Biological Activity Detection

[0052] Cytotoxicity and cell adhesion experiments were performed on the recombinant type I collagen Pro.C1 obtained in Example 3.

[0053] (1) Preliminary experiment (cytotoxicity experiment)

[0054] Cytotoxicity test. Ultrapure water was used to dissolve the samples. The results of the cytotoxicity test were as follows: Figure 3 As shown, it can be seen that the prepared recombinant type I collagen Pro.C1 has no cytotoxicity and can promote cell proliferation.

[0055] (2) Formal Experiment

[0056] The method for detecting the activity of collagen is based on Juming Yao, Satoshi Yanagisawa, Tetsuo Asakura, Design, Expression and Characterization of Collagen-Like Proteins Based on the Cell Adhesive and Crosslinking Sequences Derived from Native Collagens, J Biochem. 136, 643-649 (2004). The specific implementation method includes the following steps:

[0057] 1) The concentration of the protein sample to be tested was detected by ultraviolet absorption method, with commercial human collagen (Sigma, C7774) as the positive control and the recombinant type I humanized collagen Pro.C1 provided by the present invention as the sample. Specifically, the ultraviolet absorption of the sample at 215nm and 225nm was measured respectively, and the protein concentration was calculated using the empirical formula C (μg / mL) = 144×(A215-A225). Note that the test should be performed when A215 < 1.5. After the protein concentration was detected, the concentration of all proteins to be tested was adjusted to 0.5 mg / mL with PBS.

[0058] 2) Add 100 μL of each protein solution and a blank PBS solution as a control to a 96-well plate and let stand at room temperature for 60 min.

[0059] 3) Add 10 5 3T3 cells in good culture state were incubated at 37℃ for 60min.

[0060] 4) Wash each well 4 times with PBS.

[0061] 5) Detect the absorbance OD at 492 nm using LDH detection kit (Roche, 04744926001) 492nm According to the value of the blank control, the cell adhesion rate can be calculated. The calculation formula is as follows: cell adhesion rate = (test well - blank well) × 100% / (positive well - blank well).

[0062] The results are as follows Figure 4 As shown, compared with the control group, the recombinant type I humanized collagen Pro.C1 experimental group in the sample group has a larger absorbance value at 492nm, which means that the cell adhesion rate in this well is greater. It proves that the recombinant type I humanized collagen Pro.C1 of the present invention has high biological activity and can provide cells with a high-quality external environment in a shorter time to help cells adhere to the wall.

[0063] (3) Compactness experiment

[0064] The effect of recombinant humanized type I collagen on the Elastin content in fibroblasts was detected and analyzed using the Elastin ELISA Kit (Human Elastin ELISA Kit, Abcam) operating instructions, and the Elastin content results were expressed as Mean±SD. The specific detection steps can be routinely adjusted according to the kit instructions.

[0065] Take a sterile ELISA plate, design blank wells, standard wells, and sample wells to be tested respectively, add 50 μL of standards of different concentrations to each standard well, add 10 μL of sample to be tested to the sample well, and then add 40 μL of sample diluent (i.e., the sample is diluted 5 times), and nothing is added to the blank well; except for the blank well, add 100 μL of HRP-labeled detection antibody to each standard well and sample well, seal the reaction well with a sealing film, incubate at 37°C in the dark for 60 minutes, discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let it stand for 1 minute, discard the washing solution, pat dry on absorbent paper, repeat the washing 5 times, add 50 μL of substrate A and B to each well, incubate at 37°C in the dark for 15 minutes, add 50 μL of stop solution to each well, measure the OD value of each well at a wavelength of 450 nm within 15 minutes, add samples for three parallel experiments, which are treatment groups 1-3, and the steps of control groups 1-3 are the same as those of the treatment groups, except that no sample protein is added.

[0066] like Figure 5 As shown, recombinant humanized type I collagen Pro.C1 has a unique advantage in the production of Elastin, and the Elastin content of fibroblasts in treatment groups 1-3 can reach up to 1750±47pg / mL. This further shows that recombinant humanized type I collagen Pro.C1 can increase skin tightness, tighten the skin, and give it elasticity and smoothness by producing a large amount of Elastin.

[0067] (4) Collagen regeneration experiment

[0068] Experimental steps: The experimental concentration settings are shown in the following table. The culture medium in the table is FbGrowth culture medium; the ELISA kit is human type I collagen (COL1) ELISA kit.

[0069] Experimental design for promoting collagen synthesis in fibroblasts

[0070] Experimental Grouping sample concentration Blank control Culture medium / Positive Control TGFβ1 0.00001％ Experimental Group Pro.C1 1.0％

[0071] 1) Cell inoculation: Collect cells in the logarithmic growth phase and set the cell density at 1×10 4 Inoculate 1000 cells / well into a 96-well plate and incubate at 37°C with 5% CO 2 Culture in an incubator for 24 h.

[0072] 2) Sampling: Sampling is performed when the cell plating rate in the 96-well plate reaches 40% to 60%. The blank control group is inoculated with cells in the culture medium, the positive control group is inoculated with cells in the culture medium with TGFβ1 added, and the experimental group is inoculated with cells in the culture medium with each concentration of diluted samples. After sampling, place the 96-well plate in an incubator (37°C, 5% CO 2 ) for 24 h.

[0073] 3) ELISA detection: After the culture is completed, the cell culture fluid is collected in a 1.5 mL centrifuge tube and then operated according to the instructions of the ELISA kit.

[0074] Positive control group type I collagen upregulation rate = (positive control group average - blank control group average) / blank control group average × 100%

[0075] The upregulation rate of type I collagen in the experimental group = (average value of the experimental group - average value of the blank control group) / average value of the blank control group × 100%

[0076] result Figure 6 As shown, Pro.C1 can significantly upregulate the content of type I collagen and has the ability to promote the synthesis of type I collagen.

Claims

1. A recombinant type I collagen Pro.C1, characterized in that Its amino acid sequence is shown in SEQ ID NO.

5.

2. The gene encoding the recombinant type I collagen Pro.C1 according to claim 1.

3. The coding gene according to claim 2, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

6.

4. The expression vector of the recombinant type I collagen Pro.C1 according to claim 1.

5. The host bacteria of the recombinant type I collagen Pro.C1 as claimed in claim 1.

6. The method for preparing the recombinant type I collagen Pro.C1 according to claim 1, characterized in that The steps include: (1) constructing the expression vector of claim 4 and transforming it into an expression host bacterium; (2) Cultivate the expression host bacteria and induce the expression of recombinant protein; (3) Purify the expression product to obtain the recombinant type I collagen Pro.C1 as described in claim 1.

7. Use of the recombinant type I collagen Pro.C1 according to claim 1 in promoting cell proliferation in vitro, wherein the cell is a HaCaT cell.

8. Use of the recombinant type I collagen Pro.C1 as claimed in claim 1 in promoting cell adhesion in vitro, wherein the cells are 3T3 cells.

9. Use of the recombinant type I collagen Pro.C1 according to claim 1 in promoting cell secretion of elastin in vitro, wherein the cells are fibroblasts.

10. Use of the recombinant type I collagen Pro.C1 according to claim 1 in promoting the synthesis of type I collagen by fibroblasts in vitro.

Images