A kind of black fungus strain L7061 and cultivation method thereof

Abstract

The present invention relates to a black fungus strain L7061 and a cultivation method thereof, and belongs to the field of microbial technology. The black fungus strain L7061 has been deposited in the Guangdong Provincial Microbiological Culture Collection Center of China on February 28, 2024, with a deposit number of GDMCC No: 64381. The black fungus strain of the present invention has strong resistance to impurities, good uniformity of mushroom production, stable cultivation characteristics, dark brown fruiting bodies, sheet-shaped ear pieces, dense ear piece growth, high biological conversion rate and yield, short production and cultivation cycles, high nutritional value, crisp and glutinous taste, and delicious taste. The strain is suitable for greenhouse hanging bag cultivation in Yunnan, has a wide range of adaptability, and can be widely promoted and applied as an excellent new variety.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a black fungus strain L7061 and a cultivation method thereof. Background Art

[0002] Black Fungus Auricularia auricμLa (L.ex Hook.) Underw] Also known as black vegetable, fungus, cloud ear, is a fungus from the phylum Eumycota, subphylum Basidiomycotina, class Heterobasidiomycetes, order Auriculariales, family Auriculariaceae, genus Auriculariaceae Auricularia ). Black fungus grows on broad-leaved trees such as oak, elm, poplar, banyan, acacia, or on rotten wood and coniferous fir. It grows in dense clumps and can cause wood decay. Fungus grown on different trees has different names and different effects. Black fungus is a kind of edible fungus with important nutritional and medicinal value. It is one of the four famous edible fungi in the world and is known as "the meat among vegetarians", "the king of vegetarians" and "the treasure among fungi".

[0003] At present, the cultivation of black fungus in Yunnan has evolved from sporadic individual cultivation to large-scale cooperative and corporate cultivation. The scale is getting bigger and bigger, and the cultivation area is getting wider and wider, but there are also more and more problems, such as the selection of varieties suitable for local three-dimensional climate cultivation and backward cultivation technology. The biological characteristics of 32 black fungus strains cultivated in China were systematically analyzed. The results showed that their genetic diversity was relatively rich. The test strains were clustered into three main regional groups, namely strains in the northeast region, strains in the central and southeast regions, and strains in North China, South China and some central regions. The biological characteristics were correlated with the regional origin, and the cultivated strains from the same region were more similar. The study shows that the current cultivated varieties of black fungus mainly come from three regions, and the relevant varieties are selected according to local market demand and climate. It also shows that Yunnan has rich wild fungus resources, but does not have its own characteristic and advantageous varieties, especially varieties suitable for cultivation in different three-dimensional climate regions. Therefore, in the development of the industry, the blind selection of plateau cultivation varieties and the immaturity of supporting technologies have seriously affected the healthy development of the industry.

[0004] Therefore, how to overcome the shortcomings of the existing technology is an urgent problem to be solved in the field of microbial technology. Summary of the invention

[0005] The purpose of the invention is to solve the deficiencies of the prior art and to provide a black fungus strain L7061 and a cultivation method thereof.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] The first aspect of the present invention provides a black fungus strain L7061, wherein the black fungus strain L7061 ( Auricularia heimuer ) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64381.

[0008] The second aspect of the present invention provides a cultivation method of black fungus strain L7061, comprising the following steps:

[0009] Step (1), mother culture propagation: Take the black fungus strain L7061 under sterile conditions and inoculate it into the mother culture PDA culture medium, and place it in a 24°C incubator for constant temperature culture for 7-10 days;

[0010] The mother seed PDA culture medium comprises the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of glucose, 19-21 parts of agar powder, and 990-1010 parts of water;

[0011] Step (2), taking the mother seed cultured in step (1) and inoculating it into the stock culture bottle, placing it in a constant temperature culture room at 24°C for 25-30 days to obtain the stock;

[0012] The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 76-79 parts of sawdust, 19-21 parts of bran, 0.9-1.1 parts of sugar, 0.9-1.1 parts of gypsum powder, and 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%;

[0013] Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a culture room at 24°C and culturing it at a constant temperature for 30-35 days to obtain cultivated seeds;

[0014] The cultivation substrate in the cultivation bag includes the following raw materials in parts by weight: 74-76 parts of sawdust, 20-22 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, and 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%;

[0015] Step (4), post-ripening opening: After the mycelium in step (3) has grown all over the cultivation bag, the temperature of the culture room is adjusted to 19.5-20.5°C for post-ripening cultivation for 6.5-7.5 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 3-5 days to restore the mycelium;

[0016] Step (5), mushroom stick cultivation and ear management: adopt the greenhouse hanging bag cultivation method, suspend the wood ear mushroom sticks in the greenhouse for three-dimensional ear cultivation, hang 7-8 bags in a string on the rack in the greenhouse, the horizontal spacing between adjacent hanging bags is 30-40 cm, the spacing between upper and lower bags is 4.5-5.5 cm, and the bottom mushroom bag should be 29-31 cm from the ground;

[0017] Start watering three days after hanging the bags, adopt alternating dry and wet management, and maintain the relative humidity of the air at 80%-90% and the temperature at 15℃-24℃.

[0018] Furthermore, in step (4), 160-200 holes are pierced on each stick.

[0019] Furthermore, in step (4), avoid direct sunlight during the culture, avoid temperatures exceeding 28°C, and maintain ventilation.

[0020] Furthermore, in step (5), in the dry-wet alternating management, when watering is needed, water four times a day, each time for 20-30 minutes.

[0021] Furthermore, in step (5), the ears are picked when the ear pieces no longer grow larger; when picking, the larger ones are picked and the smaller ones are left, and watering is stopped for 3 days after each picking.

[0022] The third aspect of the present invention provides another method for cultivating black fungus strain L7061, comprising the following steps:

[0023] Step A, mother culture propagation: under sterile conditions, take the black fungus strain L7061 and inoculate it on the mother culture PDA medium, place it in a constant temperature culture at 24°C for 7-10 days to obtain mycelium blocks;

[0024] The mother seed PDA culture medium comprises the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of glucose, 19-21 parts of agar powder, and 990-1010 parts of water;

[0025] Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 27.5-28.5°C for 7-10 days to obtain seed liquid;

[0026] The shake flask seed culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of maltose, 1.9-2.1 parts of yeast powder, 0.19-0.21 parts of calcium carbonate, 990-1010 parts of water, and a pH of 9.8-10.2;

[0027] Step C, liquid fermentation tank fermentation culture: inoculate the seed liquid obtained in step B into the fermentation liquid culture medium, and culture at 23.5-24.5° C. for 8-11 days to obtain liquid strains;

[0028] The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2350-2450 parts of maltose, 190-210 parts of peptone, 115-125 parts of potassium dihydrogen phosphate, 59-61 parts of calcium carbonate, 99000-101000 parts of water, and the pH is 9.8-10.2;

[0029] Step D, preparation of cultivar: inoculate the liquid cultivar cultured in step C into a cultivation bag, and place it in a culture room at 24°C for 30-35 days;

[0030] The cultivation substrate in the cultivation bag includes the following raw materials in parts by weight: 74-76 parts of sawdust, 20-22 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, and 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%;

[0031] Step E, post-ripening opening: After the mycelium in step D has grown all over the cultivation bag, the temperature of the culture room is adjusted to 19.5-20.5°C for post-ripening cultivation for 6.5-7.5 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 3-5 days to restore the mycelium;

[0032] Step F, mushroom stick cultivation and ear management: adopt the greenhouse hanging bag cultivation method, suspend the wood ear mushroom sticks in the greenhouse for three-dimensional ear cultivation, hang 7-8 bags in a string on the rack in the greenhouse, the horizontal spacing between adjacent hanging bags is 30-40cm, the spacing between upper and lower bags is 4.5-5.5cm, and the bottom mushroom bag should be 29-31cm from the ground;

[0033] Start watering three days after hanging the bags, adopt alternating dry and wet management, and maintain the relative humidity of the air at 80%-90% and the temperature at 15℃-24℃.

[0034] Further, in step B, the shaking speed is 170-190 r / min -1 .

[0035] Furthermore, in step E, 160-200 holes are pierced on each stick; when cultivating bacteria, avoid direct sunlight, avoid temperatures exceeding 28° C., and maintain ventilation.

[0036] Further, in step F, in the dry-wet alternating management, when watering is needed, water four times a day, each time for 20-30 minutes;

[0037] Pick the flowers when the ear pieces no longer grow larger after they grow out of the ears. When picking, pick the large ones and leave the small ones. Stop watering for 3 days after each picking.

[0038] The present invention adopts a greenhouse hanging bag cultivation method to cultivate mushroom sticks. The hanging bag cultivation should be ventilated all day and properly irradiated with scattered light.

[0039] In the present invention, the specific method of dry-wet alternating management can be adopted from the existing technology, and the present invention does not limit this. When watering, the present invention adopts conventional sprinkler irrigation, and the sprinkler irrigation flow rate can be 1.33m 3 / h, the present invention does not impose any limitation on this.

[0040] In step (5) of the present invention, the relative humidity of the air is 80%-90%, the surface of the primordium is kept moist but not dry, and the temperature is 15°C-24°C.

[0041] Compared with the prior art, the present invention has the following beneficial effects:

[0042] (1) The mycelium of the black fungus strain L7061 produced and cultivated using the technology of the present invention grows fast and densely, and has strong resistance to weeds; the fruiting body is dark brown, the ear pieces are in the shape of sheets, the ear pieces grow densely, the ears come out neatly, the ear pieces have good consistency, and the yield and biological efficiency are high;

[0043] (2) The black fungus strain L7061 is black in color, has a good ear shape, and has good commercial quality; it also has a crispy and sticky texture and a delicious taste.

[0044] (3) The black fungus strain L7061 produced and cultivated by the technology of the present invention has high nutritional value, including high content of amino acids, proteins, crude polysaccharides and iron. Among them, the content of crude polysaccharides is more than 4 times that of the control CK Heibao No. 1, and the iron content is nearly 2 times that of the control CK Heibao No. 1.

[0045] (4) The wild strain of black fungus strain L7061 was collected from Yunnan Province and has good adaptability when cultivated in many places in Yunnan Province. The cultivated fruiting bodies have upright and stretched ear lobes with beautiful appearance. In contrast, the Heibao No. 1 variety bred outside the province has curled ear lobes and some fruiting bodies have deformed growth when cultivated in many places in the province. Therefore, the breeding of black fungus varieties suitable for local cultivation in Yunnan Province is of great value to the development of the black fungus industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 This is the multi-gene phylogenetic tree of Auricularia auriculariae strain L7061 based on ITS+nLSU sequences;

[0047] Figure 2 Antagonism diagram of Auricularia auricula strain L7061 and control CK Heibao No. 1 strain; the mycelium block marked with 61 on the left is the L7061 strain, and the mycelium block on the right is the control CK Heibao No. 1;

[0048] Figure 3It is the gel map of SSR molecular marker of Auricularia auricula strain L7061; wherein, YE1H is strain L7061, CK is control strain Heibao No. 1, and Marker is template; a is the gel map of SSR molecular marker using primer YE1H-01; b is the gel map of SSR molecular marker using primer YE1H-02; c is the gel map of SSR molecular marker using primer YE1H-03; d is the gel map of SSR molecular marker using primer YE1H-04; e is the gel map of SSR molecular marker using primer YE1H-05; f is the gel map of SSR molecular marker using primer YE1H-06;

[0049] Figure 4 The morphological diagram of Auricularia auricula strain L7061; a is the wild morphology of the fruiting body; b is the cross section of the fruiting body; c is the soft hairs on the sterile surface; df is the diagram of basidia and pseudo-basidia in the hymenium; gl is the diagram of basidiospores; scale b=6μm, c=10μm, df=30μm, gl=5μm;

[0050] Figure 5 This is a demonstration cultivation effect diagram of black fungus strain L7061; A. Overall cultivation effect in Songming County, Kunming City; B. Overall cultivation effect in Lida Town, Funing County; C. Overall cultivation effect in Yongsheng County, Lijiang City; D. Overall cultivation effect in greenhouse hanging bags; E. Front of ear piece; F. Back of ear piece;

[0051] Figure 6 This is a bar graph of mycelium growth rate in the carbon source single factor screening test;

[0052] Figure 7 This is the mycelial growth morphology diagram of the carbon source single factor screening test;

[0053] Figure 8 This is a bar chart of mycelium growth rate in the nitrogen source single factor screening test;

[0054] Fig. 9 This is the mycelial growth morphology diagram of the nitrogen source single factor screening test;

[0055] Fig.10 This is a bar graph of mycelium growth rate in the inorganic salt single factor screening test;

[0056] Fig.11 This is the mycelial growth morphology diagram of the inorganic salt single factor screening test;

[0057] Fig.12 This is the bar graph of mycelium growth rate in the temperature single factor screening test;

[0058] Fig.13 This is the mycelial growth morphology diagram of the temperature single factor screening test;

[0059] Fig.14 This is the bar graph of mycelium growth rate in the pH single factor screening test;

[0060] Fig.15 This is the mycelial growth morphology diagram of the pH single factor screening test. DETAILED DESCRIPTION

[0061] The present invention is further described in detail below in conjunction with embodiments.

[0062] Those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the art or the product specifications are used. If the manufacturer of the materials or equipment used is not specified, they are all conventional products that can be purchased.

[0063] Unless otherwise specified, all percentages in the text refer to volume percentages.

[0064] Example 1

[0065] A black fungus strain L7061, the black fungus strain L7061 ( Auricularia heimuer ) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64381.

[0066] The cultivation method of the black fungus strain L7061 in this embodiment comprises the following steps:

[0067] Step (1), mother culture propagation: Take the black fungus strain L7061 under sterile conditions and inoculate it into the mother culture PDA culture medium, and place it in a 24°C incubator for constant temperature culture for 8 days;

[0068] The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 20 parts of glucose, 20 parts of agar powder, and 1000 parts of water;

[0069] Step (2), taking the mother seed cultured in step (1) and inoculating it into the stock culture bottle, placing it in a culture room at 24°C and culturing it at a constant temperature for 28 days to obtain the stock seed;

[0070] The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 77 parts of sawdust, 20 parts of bran, 1 part of sugar, 1 part of gypsum powder, and 1 part of lime powder; pH value 7, water content 55-65%;

[0071] Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a culture room at 24°C and culturing it at a constant temperature for 32 days to obtain cultivated seeds;

[0072] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 75 parts of sawdust, 21 parts of wheat bran, 2 parts of bean cake powder, 1 part of gypsum powder, and 1 part of lime powder; pH value 7, water content 55-65%;

[0073] Step (4), post-ripening opening: After the mycelium in step (3) has grown all over the cultivation bag, the temperature of the culture room is adjusted to 20°C for post-ripening cultivation for 7 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 4 days to restore the mycelium;

[0074] Step (5), mushroom stick cultivation and ear management: adopt the greenhouse hanging bag cultivation method, suspend the wood ear mushroom sticks in the greenhouse for three-dimensional ear cultivation, hang a string of 7 bags on the rack in the greenhouse, the horizontal spacing between adjacent hanging bags is 35 cm, the spacing between the upper and lower bags is 5 cm, and the bottom mushroom bag should be 30 cm above the ground;

[0075] Start watering three days after hanging the bags, adopt alternating dry and wet management, and maintain the relative humidity of the air at 80%-90% and the temperature at 18℃-22℃.

[0076] Example 2

[0077] A black fungus strain L7061, the black fungus strain L7061 ( Auricularia heimuer ) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64381.

[0078] The cultivation method of the black fungus strain L7061 in this embodiment comprises the following steps:

[0079] Step (1), mother culture propagation: Take the black fungus strain L7061 under sterile conditions and inoculate it into the mother culture PDA culture medium, and place it in a 24°C incubator for constant temperature culture for 7 days;

[0080] The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 19 parts of glucose, 19 parts of agar powder, and 990 parts of water;

[0081] Step (2), taking the mother seed cultured in step (1) and inoculating it into the stock culture bottle, placing it in a culture room at 24°C and culturing it at a constant temperature for 25 days to obtain the stock;

[0082] The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 76 parts of sawdust, 19 parts of bran, 0.9 parts of sugar, 0.9 parts of gypsum powder, and 0.8 parts of lime powder; pH value 6, water content 55-65%;

[0083] Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a culture room at 24°C and culturing it at a constant temperature for 30 days to obtain cultivated seeds;

[0084] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 74 parts of sawdust, 20 parts of wheat bran, 1.9 parts of bean cake powder, 0.9 parts of gypsum powder, and 0.8 parts of lime powder; pH value 6, water content 55-65%;

[0085] Step (4), post-ripening opening: After the mycelium in step (3) has grown all over the cultivation bag, the temperature of the culture room is adjusted to 19.5°C for post-ripening cultivation for 6.5 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 3 days to restore the mycelium;

[0086] Step (5), mushroom stick cultivation and ear management: adopt the greenhouse hanging bag cultivation method, suspend the wood ear mushroom sticks in the greenhouse for three-dimensional ear cultivation, hang a string of 7 bags on the rack in the greenhouse, the horizontal spacing between adjacent hanging bags is 30 cm, the spacing between upper and lower bags is 4.5 cm, and the bottom mushroom bag should be 29 cm from the ground;

[0087] Start watering three days after hanging the bags, adopt alternating dry and wet management, and maintain the relative humidity of the air at 80%-90% and the temperature at 15℃-20℃.

[0088] In step (4), 160 holes are pierced on each stick.

[0089] In step (4), avoid direct sunlight when growing the bacteria, avoid temperatures exceeding 28°C, and maintain ventilation.

[0090] In step (5), in the dry-wet alternating management, when watering is needed, water four times a day, each time for 20 minutes.

[0091] In step (5), the ears are picked when the ear pieces no longer grow larger; when picking, the larger ones are picked and the smaller ones are left, and watering is stopped for 3 days after each picking.

[0092] Example 3

[0093] A black fungus strain L7061, the black fungus strain L7061 ( Auricularia heimuer ) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64381.

[0094] The cultivation method of the black fungus strain L7061 in this embodiment comprises the following steps:

[0095] Step (1), mother culture propagation: Take the black fungus strain L7061 under sterile conditions and inoculate it into the mother culture PDA culture medium, and place it in a 24°C incubator for constant temperature culture for 10 days;

[0096] The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 21 parts of glucose, 21 parts of agar powder, and 1010 parts of water;

[0097] Step (2), taking the mother seed cultured in step (1) and inoculating it into the stock culture bottle, placing it in a culture room at 24°C and culturing it at a constant temperature for 30 days to obtain the stock seed;

[0098] The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 79 parts of sawdust, 21 parts of bran, 1.1 parts of sugar, 1.1 parts of gypsum powder, and 1.2 parts of lime powder; pH value 7, water content 55-65%;

[0099] Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a culture room at 24°C and culturing it at a constant temperature for 35 days to obtain cultivated seeds;

[0100] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 76 parts of sawdust, 22 parts of wheat bran, 2.1 parts of bean cake powder, 1.1 parts of gypsum powder, and 1.2 parts of lime powder; pH value 7, water content 55-65%;

[0101] Step (4), post-ripening opening: After the mycelium in step (3) has grown all over the cultivation bag, the temperature of the culture room is adjusted to 20.5°C for post-ripening cultivation for 7.5 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 5 days to restore the mycelium;

[0102] Step (5), mushroom stick cultivation and ear management: adopt the greenhouse hanging bag cultivation method, suspend the wood ear mushroom sticks in the greenhouse for three-dimensional ear cultivation, hang 8 bags in a string on the rack in the greenhouse, the horizontal spacing between adjacent hanging bags is 40 cm, the spacing between upper and lower bags is 5.5 cm, and the bottom mushroom bag should be 31 cm above the ground;

[0103] Start watering three days after hanging the bags, adopt alternating dry and wet management, and maintain the relative humidity of the air at 80%-90% and the temperature at 20℃-24℃.

[0104] In step (4), 200 holes are pierced on each stick.

[0105] In step (4), avoid direct sunlight when growing the bacteria, avoid temperatures exceeding 28°C, and maintain ventilation.

[0106] In step (5), in the dry-wet alternating management, when watering is needed, water four times a day, each time for 30 minutes.

[0107] In step (5), the ears are picked when the ear pieces no longer grow larger; when picking, the larger ones are picked and the smaller ones are left, and watering is stopped for 3 days after each picking.

[0108] Example 4

[0109] A black fungus strain L7061, the black fungus strain L7061 ( Auricularia heimuer ) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64381.

[0110] The cultivation method of the black fungus strain L7061 in this embodiment comprises the following steps:

[0111] Step (1), mother culture propagation: Take the black fungus strain L7061 under sterile conditions and inoculate it into the mother culture PDA culture medium, and place it in a 24°C incubator for constant temperature culture for 9 days;

[0112] The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 20 parts of glucose, 20 parts of agar powder, and 1000 parts of water;

[0113] Step (2), taking the mother seed cultured in step (1) and inoculating it into the stock culture bottle, placing it in a culture room at 24°C and culturing it at a constant temperature for 28 days to obtain the stock seed;

[0114] The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 78 parts of sawdust, 20 parts of bran, 1 part of sugar, 1 part of gypsum powder, and 1 part of lime powder; pH value 6, water content 55-65%;

[0115] Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a culture room at 24°C and culturing it at a constant temperature for 32 days to obtain cultivated seeds;

[0116] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 75 parts of sawdust, 21 parts of wheat bran, 2 parts of bean cake powder, 1 part of gypsum powder, and 1 part of lime powder; pH value 6, water content 55-65%;

[0117] Step (4), post-ripening opening: After the mycelium in step (3) has grown all over the cultivation bag, the temperature of the culture room is adjusted to 20°C for post-ripening cultivation for 7 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 4 days to restore the mycelium;

[0118] Step (5), mushroom stick cultivation and ear management: adopt the greenhouse hanging bag cultivation method, suspend the wood ear mushroom sticks in the greenhouse for three-dimensional ear cultivation, hang 8 bags in a string on the rack in the greenhouse, the horizontal spacing between adjacent hanging bags is 40 cm, the spacing between upper and lower bags is 5.5 cm, and the bottom mushroom bag should be 31 cm above the ground;

[0119] Start watering three days after hanging the bags, adopt alternating dry and wet management, and maintain the relative humidity of the air at 80%-90% and the temperature at 18℃-22℃.

[0120] In step (4), 180 holes are pierced on each stick.

[0121] In step (4), avoid direct sunlight when growing the bacteria, avoid temperatures exceeding 28°C, and maintain ventilation.

[0122] In step (5), in the dry-wet alternating management, when watering is needed, water four times a day, each time for 25 minutes.

[0123] In step (5), the ears are picked when the ear pieces no longer grow larger; when picking, the larger ones are picked and the smaller ones are left, and watering is stopped for 3 days after each picking.

[0124] Example 5

[0125] A black fungus strain L7061, the black fungus strain L7061 ( Auricularia heimuer ) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64381.

[0126] The cultivation method of the black fungus strain L7061 in this embodiment comprises the following steps:

[0127] Step A, mother culture propagation: under sterile conditions, take the black fungus strain L7061 and inoculate it on the mother culture PDA medium, place it in a constant temperature culture at 24°C for 8 days to obtain mycelium blocks;

[0128] The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 20 parts of glucose, 20 parts of agar powder, and 1000 parts of water;

[0129] Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 28° C. for 8 days to obtain seed liquid;

[0130] The shake flask culture medium includes the following raw materials by weight: 200 parts of potatoes, 20 parts of maltose, 2 parts of yeast powder, 0.2 parts of calcium carbonate, 1000 parts of water, and the pH is 10;

[0131] Step C, fermentation culture in a liquid fermentation tank: inoculating the seed liquid obtained in step B into a fermentation liquid culture medium, and culturing at 24° C. for 9 days to obtain a liquid strain;

[0132] The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2400 parts of maltose, 200 parts of peptone, 120 parts of potassium dihydrogen phosphate, 59 parts of calcium carbonate, 100000 parts of water, and the pH is 10;

[0133] Step D, preparation of culture seeds: inoculate the liquid culture seeds cultured in step C into a culture bag, and place it in a culture room at 24°C for 34 days;

[0134] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 75 parts of sawdust, 20 parts of wheat bran, 2 parts of bean cake powder, 1 part of gypsum powder, and 1 part of lime powder; pH value 6, water content 55-65%;

[0135] Step E, post-ripening opening: After the mycelium in step D has grown all over the cultivation bag, the temperature of the culture room is adjusted to 20°C for post-ripening cultivation for 7 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 4 days to restore the mycelium;

[0136] Step F, mushroom stick cultivation and ear management: adopt the greenhouse hanging bag cultivation method, suspend the wood ear mushroom sticks in the greenhouse for three-dimensional ear cultivation, hang a string of 7 bags on the rack in the greenhouse, the horizontal spacing between adjacent hanging bags is 35 cm, the spacing between the upper and lower bags is 5 cm, and the bottom mushroom bag should be 30 cm from the ground;

[0137] Start watering three days after hanging the bags, adopt alternating dry and wet management, and maintain the relative air humidity at 80%-90% and the temperature at 18℃-23℃.

[0138] Example 6

[0139] A black fungus strain L7061, the black fungus strain L7061 ( Auricularia heimuer ) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64381.

[0140] The cultivation method of the black fungus strain L7061 in this embodiment comprises the following steps:

[0141] Step A, mother culture propagation: under sterile conditions, take the black fungus strain L7061 and inoculate it on the mother culture PDA medium, place it in a constant temperature culture at 24°C for 7 days to obtain mycelium blocks;

[0142] The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 19 parts of glucose, 19 parts of agar powder, and 990 parts of water;

[0143] Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 27.5° C. for 7 days to obtain seed liquid;

[0144] The shake flask seed culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 19 parts of maltose, 1.9 parts of yeast powder, 0.19 parts of calcium carbonate, 990 parts of water, and a pH of 9.8;

[0145] Step C, liquid fermentation tank fermentation culture: inoculate the seed liquid obtained in step B into the fermentation liquid culture medium, and culture at 23.5° C. for 8 days to obtain liquid strains;

[0146] The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2350 parts of maltose, 190 parts of peptone, 115 parts of potassium dihydrogen phosphate, 59 parts of calcium carbonate, and 99,000 parts of water, with a pH of 9.8;

[0147] Step D, preparation of culture seeds: inoculate the liquid culture seeds cultured in step C into a culture bag, and place it in a culture room at 24°C for 30 days;

[0148] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 74 parts of sawdust, 20 parts of wheat bran, 1.9 parts of bean cake powder, 0.9 parts of gypsum powder, and 0.8 parts of lime powder; pH value 8, water content 55-65%;

[0149] Step E, post-ripening opening: After the mycelium in step D has grown all over the cultivation bag, the temperature of the culture room is adjusted to 19.5°C for post-ripening cultivation for 6.5 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 3 days to restore the mycelium;

[0150] Step F, mushroom stick cultivation and ear management: adopt the greenhouse hanging bag cultivation method, suspend the wood ear mushroom sticks in the greenhouse for three-dimensional ear cultivation, hang a string of 7 bags on the rack in the greenhouse, the horizontal spacing between adjacent hanging bags is 30 cm, the spacing between upper and lower bags is 4.5 cm, and the bottom mushroom bag should be 29 cm from the ground;

[0151] Start watering three days after hanging the bags, adopt alternating dry and wet management, and maintain the relative humidity of the air at 80%-90% and the temperature at 15℃-18℃.

[0152] In step B, the shaking speed is 170 r / min -1 .

[0153] In step E, 160 holes are pierced on each stick; when cultivating bacteria, avoid direct sunlight, avoid temperatures exceeding 28°C, and maintain ventilation.

[0154] In step F, in the dry-wet alternating management, when watering is needed, water four times a day, each time for 20 minutes;

[0155] Pick the flowers when the ear pieces no longer grow larger after they grow out of the ears. When picking, pick the large ones and leave the small ones. Stop watering for 3 days after each picking.

[0156] Example 7

[0157] A black fungus strain L7061, the black fungus strain L7061 ( Auricularia heimuer) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64381.

[0158] The cultivation method of the black fungus strain L7061 in this embodiment comprises the following steps:

[0159] Step A, mother culture propagation: under sterile conditions, take the black fungus strain L7061 and inoculate it on the mother culture PDA medium, place it in a constant temperature culture at 24°C for 10 days to obtain mycelium blocks;

[0160] The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 21 parts of glucose, 21 parts of agar powder, and 1010 parts of water;

[0161] Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 28.5° C. for 10 days to obtain seed liquid;

[0162] The shake flask seed culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 21 parts of maltose, 2.1 parts of yeast powder, 0.21 parts of calcium carbonate, 1010 parts of water, and the pH is 10.2;

[0163] Step C, liquid fermentation tank fermentation culture: inoculate the seed liquid obtained in step B into the fermentation liquid culture medium, and culture at 24.5° C. for 11 days to obtain liquid strains;

[0164] The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2450 parts of maltose, 210 parts of peptone, 125 parts of potassium dihydrogen phosphate, 61 parts of calcium carbonate, and 101,000 parts of water, with a pH of 10.2;

[0165] Step D, preparation of cultivar: inoculate the liquid cultivar cultured in step C into a cultivation bag, and place it in a culture room at 24°C for 35 days;

[0166] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 76 parts of sawdust, 22 parts of wheat bran, 2.1 parts of bean cake powder, 1.1 parts of gypsum powder, and 1.2 parts of lime powder; pH value 8, water content 55-65%;

[0167] Step E, post-ripening opening: After the mycelium in step D has grown all over the cultivation bag, the temperature of the culture room is adjusted to 20.5°C for post-ripening cultivation for 7.5 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 5 days to restore the mycelium;

[0168] Step F, mushroom stick cultivation and ear management: adopt the greenhouse hanging bag cultivation method, suspend the wood ear mushroom sticks in the greenhouse for three-dimensional ear cultivation, hang 8 bags in a string on the rack in the greenhouse, the horizontal spacing between adjacent hanging bags is 40 cm, the spacing between the upper and lower bags is 5.5 cm, and the bottom mushroom bag should be 31 cm from the ground;

[0169] Start watering three days after hanging the bags, adopt alternating dry and wet management, and maintain the relative humidity of the air at 80%-90% and the temperature at 15℃-24℃.

[0170] In step B, the shaking speed is 190 r / min -1 .

[0171] In step E, 200 holes are pierced on each stick; when cultivating bacteria, avoid direct sunlight, avoid temperatures exceeding 28°C, and maintain ventilation.

[0172] In step F, in the dry-wet alternating management, when watering is needed, water four times a day, each time for 30 minutes;

[0173] Pick the flowers when the ear pieces no longer grow larger after they grow out of the ears. When picking, pick the large ones and leave the small ones. Stop watering for 3 days after each picking.

[0174] Example 8

[0175] A black fungus strain L7061, the black fungus strain L7061 ( Auricularia heimuer ) was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64381.

[0176] The cultivation method of the black fungus strain L7061 in this embodiment comprises the following steps:

[0177] Step A, mother culture propagation: under sterile conditions, take the black fungus strain L7061 and inoculate it on the mother culture PDA medium, place it in a constant temperature culture at 24°C for 8 days to obtain mycelium blocks;

[0178] The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 20 parts of glucose, 20 parts of agar powder, and 1000 parts of water;

[0179] Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 28° C. for 8 days to obtain seed liquid;

[0180] The shake flask culture medium includes the following raw materials by weight: 200 parts of potatoes, 20 parts of maltose, 2 parts of yeast powder, 0.2 parts of calcium carbonate, 1000 parts of water, and the pH is 10;

[0181] Step C, fermentation culture in a liquid fermentation tank: inoculating the seed liquid obtained in step B into a fermentation liquid culture medium, and culturing at 24° C. for 9 days to obtain a liquid strain;

[0182] The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2400 parts of maltose, 200 parts of peptone, 120 parts of potassium dihydrogen phosphate, 60 parts of calcium carbonate, 100000 parts of water, and the pH is 10;

[0183] Step D, preparation of culture seeds: inoculate the liquid culture seeds cultured in step C into a culture bag, and place it in a culture room at 24°C for 34 days;

[0184] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 75 parts of sawdust, 21 parts of wheat bran, 2 parts of bean cake powder, 1 part of gypsum powder, and 1 part of lime powder; pH value 7, water content 55-65%;

[0185] Step E, post-ripening opening: After the mycelium in step D has grown all over the cultivation bag, the temperature of the culture room is adjusted to 20°C for post-ripening cultivation for 7 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 4 days to restore the mycelium;

[0186] Step F, mushroom stick cultivation and ear management: adopt the greenhouse hanging bag cultivation method, suspend the wood ear mushroom sticks in the greenhouse for three-dimensional ear cultivation, hang 8 bags in a string on the rack in the greenhouse, the horizontal spacing between adjacent hanging bags is 35 cm, the spacing between the upper and lower bags is 5 cm, and the bottom mushroom bag should be 30 cm from the ground;

[0187] Start watering three days after hanging the bags, adopt alternating dry and wet management, and maintain the relative humidity of the air at 80%-90% and the temperature at 17℃-22℃.

[0188] In step B, the shaking speed is 180 r / min -1 .

[0189] In step E, 180 holes are pierced on each stick; when cultivating bacteria, avoid direct sunlight, avoid temperatures exceeding 28°C, and maintain ventilation.

[0190] In step F, in the dry-wet alternating management, when watering is needed, water four times a day, each time for 25 minutes;

[0191] Pick the flowers when the ear pieces no longer grow larger after they grow out of the ears. When picking, pick the large ones and leave the small ones. Stop watering for 3 days after each picking.

[0192] Application Examples

[0193] 1. Isolation, purification and identification of Auricularia auricula strain L7061

[0194] On June 10, 2021, the inventor of the present invention collected wild black fungus from the fallen trunk of an oak tree in Ayong Township, Funing County, Wenshan Prefecture, Yunnan Province, and obtained a pure strain, black fungus strain L7061, through tissue separation and purification.

[0195] 1.1 Isolation and purification (tissue separation)

[0196] Small pieces of internal tissue of wild black fungus were cut and collected near an alcohol lamp and placed on a PDA culture medium for germination. After purification, a pure strain was obtained. Under the same culture conditions, the growth rate, thickness, density and other aspects of the mycelium growth were compared. The strains with weak mycelium were eliminated, and the effective strains with the best mycelium growth and the ability to grow fruiting bodies were screened out to obtain the black fungus strain L7061, which was named "Yun'er No. 1".

[0197] 1.2 Molecular identification

[0198] Scrape an appropriate amount of pure culture mycelium, grind it with liquid nitrogen (or grinder), and use the steps of the Plant Genomic DNA Extraction Kit (Shanghai Shenggong Biotechnology Co., Ltd.) to extract total DNA. Use RNA polymerase chain reaction (PCR) technology to select four gene fragments: ITS and LSU for amplification. The base composition of the specific primers is shown in Table 1. The PCR amplification system uses a 30μL reaction system, including 15μL MIX amplification buffer, 0.5μL of forward and reverse primers (both at a concentration of 0.03mmoL / μL), 1-2μL of DNA template (the amount varies depending on the DNA concentration), and ddH 2 O to 30 μL and then perform PCR amplification.

[0199] Table 1 Primers and base compositions used in PCR amplification

[0200]

[0201] The thermal cycle parameters of the ITS reaction program are as follows: pre-denaturation at 95°C for 3 min, followed by 34 consecutive cycles (denaturation at 94°C for 40 s, annealing at 54°C for 45 s, and extension at 72°C for 1 min). After the cycle is completed, extension is performed at 72°C for 10 min and the reaction is stored at 4°C.

[0202] Thermal cycle parameters of the nLSU reaction program: 94°C pre-denaturation for 1 min, 34 consecutive cycles (94°C denaturation for 30 s, 50°C annealing for 1 min, 72°C extension for 1.5 min). After the cycle is completed, extend at 72°C for 10 min and store at 4°C.

[0203] Use an electronic balance to accurately weigh 1g of agarose and dissolve it in 100mL TBE buffer (Tris-borate-EDTA). Heat it in a microwave oven on medium heat for 2.0min to make it clear and transparent. When the temperature reaches 65℃, add 2μL of nucleic acid dye and shake it thoroughly. Pour it into a silica gel plate, cool it for use, put it into the electrophoresis pool and use a pipette to spot the sample. The spotting volume is 5μL. The voltage during electrophoresis is 160V, the current is 90A, and the time is 15min. After electrophoresis in 1.0×TBE buffer, observe, take pictures and record the results on a UV gel imager, detect the concentration of the extracted DNA, and send the positive product to Shanghai Shenggong for sequencing. Use primers (ITS4 / ITS5, LR0R / LR5) to send the successful PCR product to Shenggong Biotechnology Co., Ltd. for sequencing. When the sequence has a heterozygous INDEL or an unclear site, the sample is sequenced bidirectionally to splice the amplified region or verify the unclear site. The ITS and LSU fragments were compared in the NCBI database, and the sequences with higher similarity were downloaded for comparison, and it was determined that "Yun'er No. 1" was black fungus ( Auricularia heimuer ).

[0204] ITS is: tagttgtccacaagggacggctgtaagcagcgccgctgaagaggcccagggcagtcggcgcagataattatcacaccgttcgcccagcac tctaaaagcgccagctaatgcatttcaagacgagccgattaccggcacggtccaagtccaccgcaggcgactgttacatcgcaggggtgagggttt acgtgacactcaaacaggcatgctccatggaataccaaggagcgcaaggtgcgttcaaagattcgatgattcactgaattctgcaattcacattac ttatcgcatttcgctgcgttcttcatcgatgcgagagccaagagatccgttgttgaaagttgttactttatagttctcgtcacattctagac (seq ID NO.5)

[0205]

[0206] 1.3 Multi-gene sequence alignment

[0207] The two gene sequences of the mycelium of Auricularia auricula strain L7061 were spliced ​​forward and reversely, and compared in the NCBI database. The results showed that the ITS sequence of Auricularia auricula strain L7061 was similar to that of Auricularia auricula strain L7061. Auricularia heimuer (GXMRI YE1) sequence similarity rate reached 100%; nLSU sequence and Auricularia auricula Auricularia heimuer (Cui 8644) sequence similarity reached 99.92%. Auricularia heimuer The sequence similarity rate of Cui 7101 was 100%. The sequence comparison results showed that the black fungus strain L7061 and the control CK Heibao No. 1 were both similar to black fungus Auricularia heimuer There is a high similarity rate. According to the large fungal gene similarity rate of more than 97%, it is generally considered to be the same species. Therefore, it is preliminarily determined that the black fungus strain L7061 and the control CK Heibao No. 1 are both black fungus. Auricularia heimuer , but there are some differences in molecular sequences and evolutionary branches, so they are different strains of the same species.

[0208] 1.4 Phylogenetic analysis

[0209] The relevant reference sequences were downloaded from GenBank, and the gene sequences of 25 species of Auricularia were selected and used as Elmerina dimidiata and Exidia candida As an outgroup, multigene phylogenetic analysis was performed based on ITS+nLSU sequences. For maximum likelihood (ML) phylogenetic analysis, the combined dataset analysis by RAxML generated a best-scoring tree, with bootstrap values ​​of ML greater than 70% displayed at the nodes.

[0210] like Figure 1 As shown in the figure, phylogenetic analysis showed that the black fungus strain L7061 and the control CK Heibao No. 1 were different from the reported black fungus strains in the phylogenetic tree of the genus Auricularia. A. heimuer Form a separate branch and get 100% support rate. Combined with the morphology, it is determined that "Yun Er No. 1" is black fungus A. heimuer , and the control strain are of the same species, but have certain differences in genetic distance.

[0211] 1.5 Antagonism test

[0212] The antagonistic test was conducted between the isolated black fungus strain L7061 and the control CK Heibao No. 1 (a northern cultivar). The results showed that the black fungus strain L7061 and the control CK Heibao No. 1 had a strong antagonistic reaction and no affinity, forming a "concave line" antagonistic line, such as Figure 2 shown.

[0213] 1.6 SSR molecular markers

[0214] (1) DNA extraction

[0215] The tested strains were transferred to potato dextrose agar solid culture medium (200 g potato, 20 g glucose, 18 g agar powder, 1000 mL water), and the mycelium was collected after culturing at 25°C for 15 days. The genomic DNA of the mycelium was extracted using the Jinsha Biotech DE711-50 kit, and the purity and concentration of the DNA were detected by agarose gel electrophoresis and biospectrophotometer.

[0216] (2) Genome sequencing

[0217] After DNA extraction, purification and library construction, the samples were sequenced using sequencing technology based on a sequencing platform to search for SSR sites in the genome sequence of the black fungus strain L7061.

[0218] (3) Development of SSR primers based on genome sequencing results

[0219] Based on the Auricularia auricularia genome data, six pairs of SSR primers YE1H-01, YE1H-02, YE1H-03, YE1H-04, YE1H-05, and YE1H-06 were developed and screened to clearly distinguish the Auricularia auricularia strain L7061 from the control CK Heibao No. 1. The detailed information of the marker primers is shown in Table 2.

[0220] Table 2 SSR marker primer information

[0221]

[0222] (4) PCR amplification

[0223] Use SSR molecular markers to perform PCR amplification of SSR markers on the extracted DNA:

[0224] The PCR amplification system is: total volume 25μL, including: 17μL of Sangon 2XSan Taq PCR Mix (with BμLe Dye); 1uL of SSR marker forward primer and reverse primer (both at a concentration of 0.025mmoL / μL), 2uL of template DNA. PCR reaction conditions: 95℃ 3min; 94℃ 40s, 60℃ 30s, 72℃ 30s, 34 cycles; 72℃ 10min. To ensure the accuracy of identification, the experiment was repeated three times. The control CK Heibao No. 1 was repeated three times using the above conditions.

[0225] (5) Electrophoresis:

[0226] Use polyacrylamide gel electrophoresis, and then silver stain to show the bands:

[0227] Mix the following reagents: 48 mL of 1× TBE solution; 12 mL of Acr-Bis (19:1); 1 mL of 10% APS solution; 100 μL of 10% TEMED;

[0228] After mixing, pour the gel immediately and expel the bubbles. After the gel solidifies, perform electrophoresis; the sample volume is 2μL per well, and the electrophoresis condition is 270V constant voltage for 1h. After the electrophoresis is completed, wash the gel twice with distilled water; add 400mL of 10% silver nitrate solution and shake on a shaker for 8min; after silver staining, wash it twice with water; add sodium hydroxide and formaldehyde for color development (NaOH 6g, distilled water 400mL, formaldehyde solution 2mL).

[0229] Table 3 Comparison of the amplified fragment sizes of primers in Auricularia auricula strain L7061 and control CK Heibao No. 1

[0230]

[0231] Depend on Figure 3 As shown in the results of Table 3, SSR primers YE1H-01, YE1H-02, YE1H-03, YE1H-04, YE1H-05, and YE1H-06 can distinguish the black fungus strain L7061 from the control CK Heibao No. 1. The sizes of the specific fragments amplified by the black fungus strain L7061 are 155, 152, 163, 156, 155, and 158 bp, respectively, and the sizes of the fragments of the control CK Heibao No. 1 are 160, 159, 165, 164, 156, and 144 bp, respectively. This shows that the two have genetic differences.

[0232] 2. Fruiting body morphological characteristics

[0233] 2.1 Morphological observation results

[0234] Morphological observations Figure 4As shown, the fruiting body is annual, colloid when fresh, light brown or reddish brown, solitary or clustered, sessile or stalked; ear-shaped or petal-shaped, with entire margins, the widest diameter of the ear pieces can reach 12cm, 0.8mm~1.5mm thick, 0.04mm~0.24mm thick, gray-brown to grape brown when dry; the upper surface has soft hairs, sometimes with wrinkles; the lower surface is smooth, sometimes with shallow wrinkles; dark brown or black after drying. Internal characteristics: medulla can be seen in the center of the cross section; no crystals; the base of the soft hairs is slightly swollen, transparent, thick-walled, with a narrow lumen, gradually pointed or obtuse at the top, single or clustered, 50-150×4-6.5μm; hyphae are locked, with a diameter of 0.5μm~3μm in KOH; basidia are rod-shaped, with 3 transverse septa, tubular, 40-67×3-6.5μm; the cyst is absent. The basidiospores are allantoic, transparent, thin-walled, smooth, and usually have one or two large tubules. They do not change color in Melzer's reagent (IKI-) and do not show a blue-loving reaction in cotton blue reagent (CB-). Basidiospores are 11~13(-13.1)×4~5(-5.1)μm. The average length (L) of the spores is 12μm, the average width (W) is 4.71μm, and the ratio of the average length to the average width (Q) is 2.43~2.74 (n=120 / 4).

[0235] Habitat: Fruiting bodies usually occur in summer and autumn. The host is Quercus. It mainly grows on moist fallen trees and rotten wood and is widely distributed in Asia.

[0236] Black fungus A. heimuer and A. villosμLa Malysheva, the latter has larger basidiospores (13-15.5 × 5-6.1 μm) and basidiospores are uncommon in wild fruiting bodies. A. heimuer Considered to be similar to Europe A. auricμLa-judae They are the same species, because their morphologies are very similar after planting; later studies found that the two species are two different branches on the phylogenetic tree, and each branch has a high support rate, so black fungus A. heimuer established as an independent species.

[0237] 3. Summary of multi-year multi-site trials of black fungus strain L7061

[0238] 3.1 Test strains

[0239] One test strain was provided by the Institute of Biotechnology and Germplasm Resources, Yunnan Academy of Agricultural Sciences. The Northern Heibao No. 1 strain was used as the control CK.

[0240] 3.2 Medium formulation

[0241] (1) The formula of the mother culture medium is PDA medium. The formula is: 200g potato, 20g glucose, 20g agar, 1000mL water.

[0242] Preparation method of mother culture medium:

[0243] A. Cooking: Peel, wash and slice potatoes, weigh 200g, add 1000mL of water, heat and boil until the potato slices are crisp but not mushy, and filter through six layers of gauze;

[0244] B. Proportion: Add 20g glucose and 20g agar to the filtrate, add 1000mL water, and stir to dissolve;

[0245] C. Packaging and sterilization: After dissolving, pack into test tubes while hot, usually 1 / 5-1 / 4 of the length of the test tube. After packing, plug with cotton plugs, 5 in a bunch, wrap one end of the test tube with kraft paper and tie it tightly. After the test tube is wrapped, put it into the autoclave and sterilize at 121℃ for 30 minutes;

[0246] D. Slanted placement: After sterilization, take out the test tube while it is still hot and place it on the workbench to form a slope. Usually the length of the slope is 1 / 2 of the test tube. After it solidifies, place it in a clean and dry place for use.

[0247] (2) Formula of culture medium for original species and cultivated species: 78% sawdust, 18% bran, 2% sugar, 1% gypsum powder, 0.5%~0.8% lime powder, and 55%~60% water content.

[0248] (2) Original seed culture matrix

[0249] The original seed culture matrix includes the following raw materials by weight: 76-79 parts of sawdust, 19-21 parts of bran, 0.9-1.1 parts of sugar, 0.9-1.1 parts of gypsum powder, 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%;

[0250] Preparation method of stock culture medium:

[0251] ① Ingredients and pretreatment: weigh the ingredients according to the formula, among which the sawdust and bran need to be pre-wetted with water in advance and then mixed with other auxiliary materials;

[0252] ② Mixing materials and bottling (bagging): Mix the processed main ingredients with other ingredients. Use breathable cover tissue culture bottles for original species and fungus bags for cultivated species. Fill the bottles (bags) and compact them. A hole can be punched in the center for easy inoculation.

[0253] ③Sterilization: Before sterilization, cold air must be completely removed to ensure that the bacteria in the sterilization package are completely killed. The original seed bottle is placed in an autoclave at 121°C and 0.103MPa for 2 hours;

[0254] (3) Cultivation bag substrate

[0255] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 74-76 parts of sawdust, 20-22 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%;

[0256] Preparation method:

[0257] ① Ingredients and pretreatment: Weigh the ingredients according to the formula. The miscellaneous sawdust needs to be pre-wetted with water 2 hours in advance. The required gypsum powder and lime powder are dissolved in water. The bran and bean cake powder are added to the sawdust in turn. Stir while adding water until it is uniform.

[0258] ②Bagging: Use 17cm×35cm×0.05cm polyethylene bags. When filling, ensure that the height of the bags is basically the same, and the tightness should be appropriate. Compact the culture medium while adding. Fill tightly. The bag height after bagging is 20-21cm. Put on the ring and lid. The dry weight of each bag of culture medium is 0.5kg, and the wet weight is 1.0-1.2kg.

[0259] ③Sterilization: Use normal pressure steam for sterilization. Expel cold air in advance during the heating process. When the temperature reaches 121°C, start timing and maintain the temperature for 2 hours. Then stop heating and allow the temperature to drop naturally. When the temperature inside the sterilizer drops below 80°C, the bags can be transferred to the cooling room for natural cooling.

[0260] ④ Inoculation and culture of original seed. Sterilize the original seed bottle in the inoculation room and sterilize it with an ultraviolet disinfection lamp for half an hour before inoculation. During operation, the aseptic operation procedures should be strictly followed. Cut the mother seed into small pieces, inoculate it into the central hole of the culture material, and connect the small pieces of fruiting body to the surface. After the inoculation, move all the original seed bottles into the culture room and control the temperature at 22℃-25℃. When the mycelium in the culture bottle fills 1 / 3 of the bag, lower the temperature of the culture room to 20℃-23℃. Check whether the original seed bottle is contaminated by bacteria at least once a week. If so, the contaminated culture bottle should be removed from the culture room in time, and the growth of mycelium of the fungus variety should be recorded.

[0261] 3.3 Test methods

[0262] 3.3.1 Demonstration Experiment Design

[0263] The black fungus strain L7061 was cultivated in a greenhouse with a sling type as a substitute material. According to the requirements of GB / T21125-2007 Technical Specifications for the Selection and Breeding of Edible Fungi, the number of cultivation bags in each group of the demonstration cultivation test design was 10,000 bags (three replicates per point, and the number of repeated cultivations was about 3,600 bags). Each bag of dry material was 550g, and liquid inoculation was used. The inoculation volume of each bag was 18mL, so the inoculation volume of each group was 180L, and each group of bagged dry material was 5,500kg. The market isolated strain Heibao No. 1 was used as the control CK. Each point used the same batch of strains and cultivation bags to ensure the same strain volume and consistent demonstration cultivation management technology.

[0264] 3.3.2 Demonstration site selection

[0265] Songming County, Kunming City, Yunnan Province (1,800 meters above sea level), Lida Town, Funing County, Wenshan Prefecture, Yunnan Province (1,200 meters above sea level), Yongsheng County, Lijiang City, Yunnan Province (2,100 meters above sea level).

[0266] 3.3.3 Cultivation methods

[0267] (1) Cultivation process

[0268] Preparation of materials → mixing of materials → bagging → sterilization → cooling and inoculation → spawning and cultivation → building of shade sheds and ridges → transfer to a new location and post-ripening → puncture and cultivation of fungi → hanging bags → ear management → harvesting of fruiting bodies → data recording

[0269] (2) Cultivation and management techniques

[0270] Season selection: According to natural conditions and the growth characteristics of black fungus, the production of seeds (bags) for winter fungus in the south starts from mid-July to early October, and the cultivation season for black fungus is from mid-October to mid-January of the following year; the production of seeds (bags) for spring fungus starts from mid-November to early February, and the fungus-growing season is from early February to mid-April. Black fungus can be cultivated at natural (environmental) temperature.

[0271] Site selection: The cultivation site is mostly a solar greenhouse, choose a sunny, leeward, dry, sanitary site close to a water source. The black fungus cultivation site should be convenient for transportation, pollution-free, with a gentle slope and high humidity.

[0272] Ear management:

[0273] (1) Germination: The temperature should not be higher than 24℃, and the relative humidity should be 60%~90%. Ventilation should be continued for 7~10 days to form black primordium. Avoid high temperature and high humidity.

[0274] (2) Humidity management: When the ear buds are formed and the pieces open, spray water into the swing stick space from time to time to keep the relative humidity of the space at 70%~90%. The fruiting bodies are basically fully opened to prevent the humidity in the bag from being higher than the external environment and causing suffocation of the buds. During the ear piece growth stage, the relative humidity of the air can be maintained above 60%. Water the mushroom sticks indirectly to allow the ear pieces to grow in dry and wet conditions.

[0275] (3) Temperature management: The optimum temperature for primordium differentiation and fruiting body development is 18℃~24℃. During the mycelial growth stage, the temperature is controlled at 23℃ to promote the formation of buds. When the fruiting body grows towards maturity, the suitable temperature is 15℃~24℃.

[0276] Harvesting: In order to ensure the quality of black fungus, appropriate harvesting standards should be mastered and appropriate harvesting time and methods should be determined. If harvested too early, the ear pieces are small and light in weight, and cannot meet the sales standards. If harvested too late, the quality of black fungus deteriorates and the color becomes lighter. Generally, the ear pieces grow to 3cm-5cm, the edges are rolled inward and elastic, the ear color changes from black to dark brown, the ear pieces stretch and soften, the flesh is thick, and the ear roots shrink and become thinner, then they can be harvested. Stop spraying water 1d-2d before harvesting. Avoid knocking off the small ear buds when harvesting to prevent affecting the yield and prolonging the harvest period.

[0277] 3.3.4 Observation and measurement items

[0278] Each demonstration site at different locations will be surveyed and data will be collected separately. The main characteristics of the tested strains will be observed and the yield will be collected. The yield will be collected after harvesting. At the same time, a qualified testing company will be commissioned to measure the content of main nutrients, heavy metals, pesticide residues, etc.

[0279] 3.4 Results and Analysis

[0280] The black fungus strain L7061 is used to make the fungus, and its mycelium is thick, the fungus grows quickly, there is less pollution, and the ability to resist weeds is strong; the fruiting body is dark brown, the ear pieces are gelatinous and elastic, and the properties are stable; the ear shape is flaky, the content of protein and crude polysaccharides is high, and the nutrients are rich. Compared with the control, it has a higher yield and active ingredients, has a higher application value, and has a good market prospect.

[0281] Table 4 Culture cycle and germination rate of Auricularia auricula strain L7061 at the demonstration site

[0282]

[0283] Table 5 Main agronomic traits and yield performance of the demonstration cultivation of Auricularia auricula strain L7061

[0284]

[0285] Note: "M±SD" stands for mean ± standard deviation. 20 bags were randomly selected from each group, and the average weight of the fruiting bodies in a single bag was measured for yield. For fruiting body traits, 50 fruiting bodies were randomly selected to calculate the average value.

[0286] Table 6 The culture period and germination rate of the control CK Heibao No. 1 demonstration site

[0287]

[0288] Table 7 Main agronomic traits and yield performance of the demonstration cultivation of CK Heibao No. 1

[0289]

[0290] Note: "M±SD" stands for mean ± standard deviation. 20 bags were randomly selected from each group, and the average weight of the fruiting bodies in a single bag was measured for yield. For fruiting body traits, 50 fruiting bodies were randomly selected to calculate the average value.

[0291] Demonstration cultivation effect diagram Figure 5 As shown. The demonstration results of three places in two years from 2022 to 2023 showed that the black fungus strain L7061 had good fruiting conditions, good uniformity, stable cultivation traits, dark brown fruiting bodies, sheet-shaped ear pieces, dense ear piece growth, no ear veins, brown cilia on the back, weak ear piece transmittance, and ear pieces with or without stalks. Compared with the control CK Heibao No. 1, it has the characteristics of thicker fruiting bodies, higher biological conversion rate and yield, short production and cultivation cycles, and an average bacterial culture cycle of 30 days. The average diameter of the ear pieces of the black fungus strain L7061 is 6.36cm, and the average thickness of the ear pieces is 0.18cm; the average fresh weight of a single mushroom is 724g / bag, the average dry weight of a single bag of entities is 66.7g, and the biological conversion rate is 131.57%. The average diameter of the ear pieces of the bag-grown fruiting bodies of the control CK Heibao No. 1 was 7.28 cm, and the average thickness of the ear pieces was 0.165 cm; the average fresh weight of a single mushroom was 654 g / bag, the average dry weight of a single bag of entities was 59.4 g, and the biological conversion rate was 118.91%. Therefore, compared with the control CK Heibao No. 1, the overall fruiting effect of the black fungus strain L7061 was better, the ear pieces were denser, the cycle was shorter, the yield and biological conversion rate were higher, and it can be used as a new variety of black fungus, suitable for cultivation in the southwestern plateau area, and can achieve high-quality facility cultivation of black fungus, with high application value and good market prospects.

[0292] Specificity: The black fungus strain L7061 has good fruiting conditions, high germination rate, high uniformity of fruiting, stable cultivation traits, dark brown fruiting bodies, flaky shape, dense growth of flaky pieces, colloid, no flaky veins, brown cilia on the back, weak light transmittance of flaky pieces, stalks or no stalks. The average culture period is 30 days. The average diameter of the flaky pieces of the black fungus strain L7061 is 6.36cm, and the average thickness of the flaky pieces is 0.18cm; the average fresh weight of a single mushroom is 724g / bag, the average dry weight of a single bag is 66.7g, and the biological conversion rate is 131.57%. The control CK Heibao No. 1 fruiting body is dark brown, the flaky shape is ear-shaped, the flaky pieces grow densely, have flaky veins, have gray-white cilia on the back, weak light transmittance of flaky pieces, and stalks. The average diameter of the ear pieces of bag-grown fruiting bodies is 7.28cm, and the average thickness of the ear pieces is 0.165cm; the average fresh weight of a single mushroom is 654g / bag, the average dry weight of a single bag of bodies is 59.4g, and the biological conversion rate is 118.91%.

[0293] Consistency: Through observations of two years of cultivation demonstrations in three locations, the black fungus strain L7061 has consistency.

[0294] Stability: Auricularia auricula strain L7061 is consistent and stable in principle.

[0295] 4. Distinctive identification

[0296] 4.1. Solid culture characteristics

[0297] After the PDA medium is prepared and mixed, it is sterilized at 121°C and 0.103 MPa for 30 min and poured into a 90 mm culture dish to make a plate. The preserved L7061 strain is activated and transferred to the culture dish, and the culture dish is used after the mycelium has grown full.

[0298] Basic culture medium: including the following raw materials in parts by weight: 200 parts of potatoes, 0 parts of glucose, 2 parts of peptone, 0.2 parts of potassium dihydrogen phosphate, and 1000 parts of water; used for screening and optimization of carbon source, nitrogen source, inorganic salt, pH and temperature. After the ingredients are prepared, put them into a high-pressure steam cooker for high-temperature sterilization at 120°C-125°C for 30 minutes, take them out and cool them for use.

[0299] 4.1.1 Carbon source single factor screening test

[0300] With the basal culture medium as the control, the following carbon sources were set as treatment groups: fructose, lactose, soluble starch, maltose, and sucrose to replace glucose, and no carbon source was added as the control CK.

[0301] A 6mm diameter puncher was used to punch holes, and the bacterial block was inoculated into the center of the solid culture medium and placed in a 24°C constant temperature incubator in the dark. Six replicates were set for each group of experiments. The colony diameter was measured once every 24 hours using the cross-line method; the mycelial morphology and growth were observed and recorded. The data results were compared with the Duncan method of SPSS 26.0 software for significant differences (P<0.05), and Excel 2019 was used to make a mycelial growth rate bar chart. The mycelial growth rate (V) formula is:

[0302] V=(L-6) / D (1)

[0303] Where: L represents the diameter of the colony; D represents the number of culture days; 6 represents the diameter of the inoculated bacterial block is 6 mm.

[0304] 4.1.2 Nitrogen source single factor screening test

[0305] With the basal culture medium as the control, the following nitrogen sources were set up as the treatment groups: yeast powder, urea, diammonium phosphate, soybean cake powder, and potassium nitrate to replace peptone, and the control group without adding nitrogen source was CK.

[0306] The methods of inoculation, cultivation, setting up replicates and data processing are the same as those in 4.1.1.

[0307] 4.1.3 Inorganic salt single factor screening test

[0308] With the basal culture medium as the control, the following inorganic salts were set up to replace potassium dihydrogen phosphate: dipotassium hydrogen phosphate, ferrous sulfate, magnesium sulfate, calcium chloride, and calcium carbonate as the treatment group, and the control CK was set up without adding inorganic salts.

[0309] The methods of inoculation, cultivation, setting up replicates and data processing are the same as those in 4.1.1.

[0310] 4.1.4 Temperature single factor screening test

[0311] The bacterial blocks were inoculated into the basal culture medium and cultured in constant temperature incubators at 20℃, 22℃, 24℃, 26℃, 28℃ and 30℃ respectively in the dark.

[0312] The methods of inoculation, cultivation, setting up replicates and data processing are the same as those in 4.1.1.

[0313] 4.1.5 pH single factor screening test

[0314] Use HCl (1 mol·L -1 ) and NaOH (1 mol·L -1 ) The pH of the basal culture medium was adjusted to 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 respectively as the test culture medium;

[0315] The methods of inoculation, cultivation, setting up replicates and data processing are the same as those in 4.1.1.

[0316] 4.2 Results Analysis

[0317] 4.2.1 Effect of carbon source on mycelial growth rate

[0318] The results of the effects of different carbon sources on mycelial growth rate and morphology are shown in Figure 6 and Figure 7 .

[0319] Depend on Figure 6 and Figure 7 It can be seen that when maltose was used as the carbon source, the mycelium was the whitest and densest, and the growth rate was the fastest at (5.35±0.16) mm·d -1 When glucose was used as the carbon source, the mycelial growth rate was the slowest, at (1.22±0.17) mm·d -1 The mycelium growth was not whiter and denser than that under other carbon source conditions.

[0320] 4.2.2 Effect of nitrogen source on mycelial growth rate

[0321] The results of the effects of different nitrogen sources on mycelial growth rate and morphology are shown in Figure 8 and Fig. 9 .

[0322] Depend on Figure 8 and Fig. 9 It can be seen that when yeast powder is used as a nitrogen source, the mycelium is the whitest and densest, and the growth rate is the fastest at (3.39±0.21) mm·d -1 When urea was used as the nitrogen source, the mycelial growth rate was the slowest, which was (0.22±0) mm·d -1 There was no significant difference when using diammonium hydrogen phosphate as nitrogen source.

[0323] 4.2.3 Effect of inorganic salts on mycelium growth rate

[0324] The results of the effects of different inorganic salts on the growth rate and morphology of mycelium are shown in Fig.10 and Fig.11 .

[0325] Depend on Fig.10 and Fig.11 It can be seen that the mycelium grew faster when calcium carbonate was used as an inorganic salt, but the density was slightly lower than that under the other conditions, and the growth rate was (6.08±0.35) mm·d -1 , which is significantly different from other inorganic salts. When ferrous sulfate is used as inorganic salt, mycelium does not grow, which is significantly different from other inorganic salts. When magnesium sulfate is used as inorganic salt, mycelium is the densest, but the growth rate is slow.

[0326] 4.2.4 Effect of temperature on mycelium growth rate

[0327] The results of the effects of different temperatures on mycelial growth rate and morphology are shown in Fig.12 and Fig.13 .

[0328] Depend on Fig.12 and Fig.13 It can be seen that the mycelium is the whitest and densest when the temperature is 28℃, and the growth rate is the fastest at (7.51±0.73) mm·d -1 There was no significant difference in growth rate when the temperature was 26℃. The mycelium growth rate was the slowest when the temperature was 20℃, which was (4.50±0.06) mm·d -1 There was no significant difference in growth rate when the temperature was 22℃.

[0329] 4.2.5 Effect of pH on mycelial growth rate

[0330] The results of the effects of different pH conditions on mycelial growth rate and morphology are shown in Fig.14 and Fig.15 .

[0331] Depend on Fig.14 and Fig.15 It can be seen that the mycelium growth rate was the fastest when the pH was 10.0, which was (5.82±0.33) mm·d -1 There was no significant difference in growth rate when pH was 9.0. The mycelial growth rate was the slowest at pH 8.0, which was (4.26±0.16) mm·d -1 There was no significant difference in growth rate when pH was 5.0, 6.0, and 7.0.

[0332] 5. Variety resistance identification

[0333] Determination of high and low temperature growth rate of mycelium: The black fungus strain L7061 and the control CK Heibao No. 1 grown on PDA (potato 200g, glucose 20g, agar powder 20g, water 1000mL) plates were punched with a 0.5cm hole puncher and placed on a new PDA (potato 200g, glucose 20g, agar powder 20g, water 1000mL) plate for temperature gradient growth experiment. 11 culture temperatures were set, namely 5℃, 10℃, 15℃, 20℃, 22℃, 24℃, 26℃, 28℃, 30℃, 32℃, 35℃, 3 replicates for each temperature, and the growth rate was measured after a certain period of culture. Trichoderma resistance detection method: First, the black fungus strain L7061, the control CK Heibao No. 1, Penicillium, and Trichoderma grown on PDA plates were punched with a 0.5cm diameter hole puncher. Then place it on a new PDA (potato 200g, glucose 20g, agar powder 20g, water 1000mL) plate, with the Auricularia auricula strain on one side and Trichoderma on the other side. Each resistance experiment was repeated 3 times, and the growth was observed after a certain period of culture.

[0334] Table 8 Mycelial growth rate of black fungus strain L7061 and control CK Heibao No. 1 (unit: mm / d)

[0335]

[0336] Results of low temperature resistance test: From Table 8, it can be seen that the mycelium growth rate of L7061 is slightly faster than that of the control CK after culturing for 7 days at 5℃, 10℃, 15℃, 20℃, 22℃ and 24℃, and the mycelium is dense as a whole; after culturing for 7 days at low temperature conditions of 5℃ and 10℃, it can be seen that at 5℃, the mycelium of CK and L7061 did not germinate. The results show that the growth rules of L7061 and CK are inconsistent under low temperature conditions, and the growth rate is quite different. L7061 is easier to germinate at low temperatures, and the strain is adapted to planting and growing in high altitude areas.

[0337] Table 9 Mycelial growth rate of Auricularia auricula strains L7061 and CK (unit: mm / d)

[0338]

[0339] Results of high temperature resistance test: As can be seen from Table 9, when cultured for 7 days at 26℃, 28℃, 30℃, 32℃ and 35℃, the mycelium growth rate of L7061 was generally faster than that of the control CK block. As the temperature increased, the mycelium had an obvious high temperature inhibition zone and sparseness. Under the temperature condition of 30℃, the mycelium of L7061 grew faster than that of CK. As the temperature increased, the growth rates of both slowed down significantly, and the growth trend was consistent. Under the temperature condition of 30℃, the mycelium of L7061 began to become sparse around the inoculation point and grew slowly. When the temperature reached 35℃, the mycelium of L7061 had an obvious high temperature inhibition zone.

[0340] Combined with the results of the low-temperature resistance test, it can be found that the optimum temperature for mycelium culture of the L7061 strain is 28°C, and the optimum temperature for mycelium culture of the control CK strain is 30°C. The results of the high-temperature resistance experiments are consistent. Therefore, L7061 is a medium-low temperature type fungus, suitable for cultivation in plateau mountainous areas.

[0341] Table 10 Antibacterial rate of black fungus strains L7061 and CK against Trichoderma

[0342]

[0343] Results: As can be seen from Table 10, in the black fungus antibacterial test against Trichoderma, the black fungus strain L7061 had a higher antibacterial rate than the control CK, indicating that the black fungus strain L7061 had a stronger ability to resist foreign bacteria. In seed production, the seed contamination rate was low, the feed was fast and not easily infected with foreign bacteria, and the ability to resist foreign bacteria was strong; and in the selection and breeding of multiple batches of cultivation tests, foreign bacteria infection and pests and diseases occurred less frequently. Therefore, it was recorded that the black fungus strain L7061 had a strong ability to resist diseases.

[0344] The mycelium of black fungus strain L7061 has strong growth potential, fast germination speed, fast growth rate, higher antibacterial rate against Trichoderma than the control CK, and strong stress resistance. Mycelium can grow normally between 15℃~30℃. Cultivated at 15℃~26℃ for 4 days, the mycelium growth rate of black fungus strain L7061 is faster than that of the control "CK", and the mycelium is denser; the fruiting temperature is 15℃~24℃; the optimal fruiting temperature is 20℃~24℃.

[0345] 5. Comparison of agronomic traits of existing fungus cultivation

[0346] At present, the main varieties of black fungus in my country are mainly from Jilin, Heilongjiang and other regions in my country. This experiment uses the common cultivated black fungus strain Heibao No. 1 (mainly from Jilin Agricultural University) as the control CK. Compared with the existing varieties, the mycelium morphology, fruiting body morphology, bioconversion rate, functional component content, etc. are significantly different from the existing black fungus varieties. For details, see Table 11.

[0347] Table 11 Comparison of agronomic traits of L7061 fungus and approved varieties

[0348]

[0349] 6. Quality analysis of black fungus strain L7061

[0350] Statistical analysis of nutritional components and functional components of black fungus strain L7061 and control CK Heibao No. 1, the results are shown in Table 12.

[0351] Table 12 Statistics of ingredients in black fungus strain L7061 and control CK Heibao No. 1

[0352]

[0353] Note: *Essential amino acids

[0354] The fruiting bodies of the black fungus strain L7061 and the control CK Heibao No. 1 in the mature stage of cultivation in 2023 were dried in the greenhouse and sent to the Guangdong Provincial Microbiological Analysis and Testing Center for testing. The content of each of the 16 amino acids in the black fungus strain L7061 was higher than that in the control, with the total amount of 16 amino acids being 14.10 g / 100 g, while the total amount of 16 amino acids in the control CK Heibao No. 1 was 9.46 g / 100 g; the protein content of the black fungus strain L7061 was 17.60 g / 100 g, while the protein content of the control CK Heibao No. 1 was 11.70 g / 100 g; the fat content of the black fungus strain L7061 was 0.30 g / 100 g, while the fat content of the control CK Heibao No. 1 was also 0.30 g / 100 g; the crude polysaccharide content of the black fungus strain L7061 was 48.0 g / 100 g, while the crude polysaccharide content of the control CK Heibao No. 1 was 10.1 g / 100 g; the iron content of the black fungus strain L7061 was 4.21×10 2 mg / kg, the control CK Heibao No. 1 iron is 2.58×10 2 mg / kg; the ash content of black fungus strain L7061 is 6.2g / 100g, and the control CK Heibao No. 1 is 5.3g / 100g. Except for fat, all the nutrients tested in black fungus strain L7061 are higher than those in the control CK Heibao No. 1, and the characteristic component iron and functional component crude polysaccharide are also higher than those in the control CK Heibao No. 1. The meat of black fungus strain L7061 is firm and has high nutritional value.

[0355] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A black fungus strain L7061, characterized in that The black fungus ( Auricularia heimuer ) strain L7061 was deposited in Guangdong Microbiological Culture Collection Center, China on February 28, 2024, with the deposit number GDMCC No: 64381.

2. The cultivation method of the black fungus strain L7061 according to claim 1, characterized in that: The steps include: Step (1), mother culture propagation: Take the black fungus strain L7061 under sterile conditions and inoculate it into the mother culture PDA culture medium, and place it in a 24°C incubator for constant temperature culture for 7-10 days; The mother seed PDA culture medium comprises the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of glucose, 19-21 parts of agar powder, and 990-1010 parts of water; Step (2), taking the mother seed cultured in step (1) and inoculating it into the stock culture bottle, placing it in a constant temperature culture room at 24°C for 25-30 days to obtain the stock; The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 76-79 parts of sawdust, 19-21 parts of bran, 0.9-1.1 parts of sugar, 0.9-1.1 parts of gypsum powder, and 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%; Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a culture room at 24°C and culturing it at a constant temperature for 30-35 days to obtain cultivated seeds; The cultivation matrix in the cultivation material bag includes the following raw materials in parts by weight: 74-76 parts of sawdust, 20-22 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, and 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%; Step (4), post-ripening opening: After the mycelium in step (3) has grown all over the cultivation bag, the temperature of the culture room is adjusted to 19.5-20.5°C for post-ripening cultivation for 6.5-7.5 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 3-5 days to restore the mycelium; Step (5), mushroom stick cultivation and ear management: adopt the greenhouse hanging bag cultivation method, suspend the wood ear mushroom sticks in the greenhouse for three-dimensional ear cultivation, hang 7-8 bags in a string on the rack in the greenhouse, the horizontal spacing between adjacent hanging bags is 30-40 cm, the spacing between upper and lower bags is 4.5-5.5 cm, and the bottom mushroom bag should be 29-31 cm from the ground; Start watering three days after hanging the bags, adopt alternating dry and wet management, and maintain the relative humidity of the air at 80%-90% and the temperature at 15℃-24℃.

3. The cultivation method of black fungus strain L7061 according to claim 2, characterized in that, In step (4), 160-200 holes are pierced on each stick.

4. The cultivation method of black fungus strain L7061 according to claim 2, characterized in that, In step (4), avoid direct sunlight when growing the bacteria, avoid temperatures exceeding 28°C, and maintain ventilation.

5. The cultivation method of black fungus strain L7061 according to claim 2, characterized in that, In step (5), in the dry-wet alternating management, when watering is needed, water four times a day, each time for 20-30 minutes.

6. The cultivation method of black fungus strain L7061 according to claim 2, characterized in that, In step (5), the ears are picked when the ear pieces no longer grow larger; when picking, the larger ones are picked and the smaller ones are left, and watering is stopped for 3 days after each picking.

7. The cultivation method of the black fungus strain L7061 according to claim 1, characterized in that: The steps include: Step A, mother culture propagation: under sterile conditions, take the black fungus strain L7061 and inoculate it on the mother culture PDA medium, place it in a constant temperature culture at 24°C for 7-10 days to obtain mycelium blocks; The mother seed PDA culture medium comprises the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of glucose, 19-21 parts of agar powder, and 990-1010 parts of water; Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 27.5-28.5°C for 7-10 days to obtain seed liquid; The shake flask seed culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of maltose, 1.9-2.1 parts of yeast powder, 0.19-0.21 parts of calcium carbonate, 990-1010 parts of water, and a pH of 9.8-10.2; Step C, fermentation culture in a liquid fermentation tank: inoculating the seed liquid obtained in step B into a fermentation liquid culture medium, culturing at 23.5-24.5° C. for 8-11 days, to obtain a liquid strain; The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2350-2450 parts of maltose, 190-210 parts of peptone, 115-125 parts of potassium dihydrogen phosphate, 59-61 parts of calcium carbonate, 99000-101000 parts of water, and the pH is 9.8-10.2; Step D, preparation of cultivar: inoculate the liquid cultivar cultured in step C into a cultivation bag, and place it in a culture room at 24°C for 30-35 days; The cultivation substrate in the cultivation bag includes the following raw materials in parts by weight: 74-76 parts of sawdust, 20-22 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, and 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%; Step E, post-ripening opening: After the mycelium in step D has grown all over the cultivation bag, the temperature of the culture room is adjusted to 19.5-20.5°C for post-ripening cultivation for 6.5-7.5 days. After the post-ripening is completed, the mushroom sticks are pierced and placed in a clean and tidy place for 3-5 days to restore the mycelium; Step F, mushroom stick cultivation and ear management: adopt the greenhouse hanging bag cultivation method, suspend the wood ear mushroom sticks in the greenhouse for three-dimensional ear cultivation, hang 7-8 bags in a string on the rack in the greenhouse, the horizontal spacing between adjacent hanging bags is 30-40cm, the spacing between upper and lower bags is 4.5-5.5cm, and the bottom mushroom bag should be 29-31cm from the ground; Start watering three days after hanging the bags, adopt alternating dry and wet management, and maintain the relative humidity of the air at 80%-90% and the temperature at 15℃-24℃.

8. The cultivation method of black fungus strain L7061 according to claim 7, characterized in that: In step B, the shaking speed is 170-190 r / min -1 .

9. The cultivation method of black fungus strain L7061 according to claim 7, characterized in that: In step E, 160-200 holes are pierced on each stick; when growing bacteria, avoid direct sunlight and avoid temperatures exceeding 28°C, and maintain ventilation.

10. The cultivation method of black fungus strain L7061 according to claim 7, characterized in that: In step F, in the dry-wet alternating management, when watering is needed, water four times a day, each time for 20-30 minutes; Pick the flowers when the ear pieces no longer grow larger after they grow out of the ears. When picking, pick the large ones and leave the small ones. Stop watering for 3 days after each picking.

Images