A modified immune cell or its precursor cell

Abstract

The present invention belongs to the field of biology and provides a modified immune cell or its precursor, which comprises an endogenous modification encoding GEM, wherein the modification can down-regulate the gene expression of endogenous GEM; and further comprises an exogenous T cell receptor (TCR) and / or a chimeric antigen receptor (CAR), and the exogenous T cell receptor (TCR) and / or the chimeric antigen receptor (CAR) have an affinity for an antigen on a target cell.

Description

Technical Field

[0001] The present invention belongs to the field of biology, and particularly relates to a modified immune cell or its precursor cell. Background Art

[0002] T cell exhaustion is a differentiated state acquired when T cells are exposed to persistent antigen stimulation in the context of chronic viral infection or in response to tumors. The failure to eliminate the antigen leads to a progressive loss or dysregulation of effector functions. Markers of T cell exhaustion include reduced effector function, distinct epigenetic and transcriptional gene signatures, persistent expression of multiple inhibitory receptors, defective cytokine production, increased chemokine expression, and restricted proliferative capacity. Examination of genes upregulated in exhausted CD8+ tumor-infiltrating lymphocytes (TILs) from patients and TILs from mouse models has led to the identification of genes that suppress tumor immunity, including LAYN, Tox, and Gata-3. In addition, genome-wide CRISPR-Cas9 knockout and knock-in screens in murine and human CD8+ T cells have revealed additional targets that regulate T cell function, such as Mapk14, Dhx37, ZC3H12A, Ptpn2, SOSCS1, and TGFBR2. Importantly, in in vivo models, engineered CAR T cells also acquire an exhausted phenotype upon their entry into the tumor microenvironment (TME), which has led to the hypothesis that CAR T cell exhaustion / dysfunction is a major obstacle to CAR T cell therapy.

[0003] Chimeric antigen receptor (CAR) T cell therapy has achieved remarkable success in hematological malignancies but remains largely ineffective in solid tumors. A major factor contributing to the reduced efficacy of CAR T cell therapy is T cell dysfunction, and the mechanisms mediating this dysfunction are under investigation. There is a need in the art to identify new inducers of exhaustion or dysfunction in CAR T cells, which when disrupted, will allow for the development of even more effective CAR T cell therapies designed to treat solid tumors. The present invention addresses this need. Summary of the Invention

[0004] A first aspect of the present invention discloses a modified immune cell or its precursor cell, which comprises an endogenous modification encoding GEM, wherein the modification is capable of downregulating the gene expression of endogenous GEM.

[0005] It further comprises an exogenous T cell receptor (TCR) and / or a chimeric antigen receptor (CAR), and the exogenous T cell receptor (TCR) and / or the chimeric antigen receptor (CAR) have an affinity for an antigen on a target cell.

[0006] Wherein the modification is selected from substitution, insertion or deletion. The modification is processed by at least one of RNA interference, CRISPR system-mediated, siRNA or drug induction;

[0007] Wherein the CRISPR system-mediated is CRISPR / Cas9, and the CRISPR system comprises a CRISPR nuclease and a guide RNA.

[0008] Wherein the guide RNA comprises a guide sequence that is sufficiently complementary to a target sequence in an endogenous locus encoding GEM.

[0009] Wherein the guide RNA has a nucleic acid sequence as shown in SEQ ID NO: 1-2:

[0010] sgRNA2: cagcatggacagcgactgcg (SEQ ID NO: 1);

[0011] sgRNA3: actaccgagtggtgctcata (SEQ ID NO: 2);

[0012] Wherein the exogenous TCR is selected from wild-type TCR, high-affinity TCR and chimeric TCR.

[0013] In certain embodiments, an exogenous T cell receptor (TCR) comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain.

[0014] In certain embodiments, the antigen-binding domain is selected from antibodies, scFv, and Fab.

[0015] In certain embodiments, the exogenous chimeric antigen receptor (CAR) further comprises a hinge domain. In certain embodiments, the hinge domain is selected from the Fc fragment of an antibody, the hinge region of an antibody, the CH2 region of an antibody, the CH3 region of an antibody, an artificial hinge domain, a hinge comprising the amino acid sequence of CD8, or any combination thereof.

[0016] In certain embodiments, the exogenous CAR comprises a transmembrane domain selected from the following: an artificial hydrophobic sequence and transmembrane domain of a type I transmembrane protein, the α, β, or ζ chain of a T cell receptor, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, and CD154.

[0017] In certain embodiments, the exogenous CAR comprises at least one co-stimulatory domain selected from the following: co-stimulatory domains of proteins in the TNFR superfamily, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS, NKG2C, and B7-H3. In certain embodiments, the exogenous CAR comprises an intracellular domain, and the intracellular domain comprises an intracellular domain selected from the following: the cytoplasmic signaling domain of the human CDζ chain, FcyRIII, FcsRI, the cytoplasmic tail of an Fc receptor, an immunoreceptor tyrosine-based activation motif (ITAM) carrying a cytoplasmic receptor, TCRζ, FcRγ, FcR-β, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d.

[0018] Wherein the antigen on the target cell is a tumor-associated antigen (TAA).

[0019] The modified cells can resist or slow down cell function exhaustion and / or dysfunction.

[0020] Wherein the modified cells are immune cells or their precursor cells differentiated from autologous cells or allogeneic pluripotent stem cells.

[0021] Wherein the modified cells are cells isolated from a human subject or induced pluripotent stem cells (iPSCs).

[0022] Wherein the modified cells are modified T cells.

[0023] Wherein the modified T cells are resistant to T cell exhaustion and / or T cell dysfunction. After knocking out the GEM gene, T cells are not easily exhausted or dysfunctional.

[0024] The second aspect of the present invention discloses a method for the above-mentioned modified immune cells or their precursor cells, which comprises:

[0025] Modifying the original immune cells or their precursor cells, and the modification is carried out by at least one of RNA interference, CRISPR system-mediated, siRNA, or drug induction; the modified immune cells or their precursor cells can down-regulate one or more polypeptides and / or nucleic acids of the endogenous GEM gene expression;

[0026] Introduce nucleic acids encoding exogenous T cell receptors (TCRs) and / or chimeric antigen receptors (CARs) into the immune cells or their precursor cells, wherein the exogenous TCRs and / or CARs comprise an affinity for an antigen on a target cell.

[0027] The polypeptides and / or nucleic acids introduce CRISPR-mediated modifications in the endogenous locus encoding GEM.

[0028] Wherein the modifications are selected from gene replacement, insertion or deletion.

[0029] Wherein the CRISPR system comprises a CRISPR nuclease and a guide RNA; the CRISPR nuclease and the guide RNA comprise a ribonucleoprotein (RNP) complex.

[0030] The nucleic acids encoding exogenous TCRs and / or CARs are introduced by viral transduction.

[0031] The viral transduction comprises contacting the immune cells or their precursor cells with a viral vector comprising nucleic acids encoding exogenous TCRs and / or CARs.

[0032] Wherein the viral vector is selected from retroviral vectors, lentiviral vectors, adenoviral vectors or adeno-associated virus (AAV) vectors.

[0033] The third aspect of the present invention discloses the use of the above-mentioned modified immune cells or their precursor cells in the preparation of a medicament for treating a disease or disorder.

[0034] The disease or disorder includes cancer, and the cancer is a solid tumor and a hematological tumor.

[0035] Wherein the disease or disorder includes chronic infection.

[0036] Wherein the chronic infection is selected from HIV, EBV, CMV, LCMV.

[0037] The modified immune cells or their precursor cells include T cells, and the T cells include CARs and engineered TCRs. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 CD8+ T cell subsets identified by scATAC-seq data.

[0039] Figure 2 A volcano plot drawn according to scATAC-seq data shows peaks with different chromatin accessibility in PDCD1+ CD8+ T cells (labeled with the genes involved).

[0040] Figure 3Show the expression patterns of representative genes in CD8+ T cell subsets (arranged by log2FC in scRNA-seq data).

[0041] Figure 4 Show the chromatin accessibility of GEM loci in different CD8+ T cell subsets.

[0042] Figures 5 - 6 Show the in vitro anti-tumor effects of two anti-EGFR CAR-T cells (unpaired two-tailed t-test). Anti-EGFR CAR-T cells (CAR1, Figure 5 ; CAR2, Figure 6 ) were incubated with ESCC cell lines (KYSE30L, KYSE150L) at E / T ratios of 0.008 and 0.0016 for 4 days, and cytotoxicity was analyzed using a luciferase-based cell lysis assay. (E / T, effector / target).

[0043] Figure 7 Show representative images of the killing effects of co-culturing KYSE150L cells with anti-EGFR CAR-T-Ctrl and CAR-T-GEM KO cells. (Scale bar: 100 μm).

[0044] Figure 8 Show the changes in tumor volume after intravenous injection of anti-EGFR CAR1-T cell GEMKO or Ctrl into mice bearing KYSE150L cell xenografts (unpaired two-tailed t-test at each time point). (TGI, tumor growth inhibition rate. KO: gene knockout).

[0045] Figure 9 Show representative line graphs of PD1 + and CD39 + expression in CAR1-T-ctrl and CAR1-T-GEM KO cells after incubation with KYSE-150L cells as determined by flow cytometry.

[0046] Figures 10 - 11 Show ELISA analysis of TNF-α and IFN-γ secretion by anti-EGFR CAR-T cells (CAR1, Figure 10 ; CAR2, Figure 11 ) (unpaired two-tailed t-test). (Co-culture EGFR CAR-T cells with GEM KO or Ctrl with KYSE-30L cells).

[0047] Figure 12Show the proportion of eGFP-positive CAR-T cells in the CAR-T-Ctrl and CAR-T-GEM KO cell populations after co-culture with KYSE-150L cells (unpaired two-sided t-test at each time point). CAR1 is on the left of the figure; CAR2 is on the right of the figure.

[0048] Figure 13 Show the functional status of GEM KO or Ctrl CAR-T cells after in vitro co-culture with KYSE-150L cells (unpaired two-sided t-test). Tn, naive T cells, CD45RO- CCR7+; Tcm, central memory T cells, CD45RO+ CCD7+; Tem, effector memory T cells, CD45RO+ CCR7-; Teff, effector T cells, CD45RO- CCR7-. (CAR1 is on the left of the figure and CAR2 is on the right of the figure).

[0049] Figure 14 Show the gene ontology enriched in GEM KO CD8+ CAR-T cells (CAR2). Gene ontology analysis was performed on the RNA-seq data of GEM KO CD8+ CAR-T cells and their corresponding cells. NES: normalized enrichment score.

[0050] Figure 15 The scatter box plot in the middle shows the migration speed of GEM OE CAR-T cells and their corresponding control cells (unpaired two-sided t-test).

[0051] Figure 16 Line graph showing the dynamic migration speed of GEM OE CAR-T cells and their corresponding control cells within 16.5 hours.

[0052] Figure 17 Line graph showing the number of GEM OE CAR-T cells and their corresponding control cells after co-culture with KYSE150 cells.

[0053] Figure 18 The line graph shows the number of KYSE150 cells after co-culture with GEM OE CAR-T cells and their corresponding control cells respectively. *, p<0.05; **, p<0.01; ***, p<0.001; ns, not significant.

[0054] Figure 19 Show the correlation between GEM expression and PDCD1 expression in PDCD1+ CD8+ T cells in the scRNA-seq dataset (Pearson correlation test). Cells with GEM expression >0 and PDCD1 expression >0 were used in the calculation.

[0055] Figure 20 Show the correlation between GEM and PDCD1 expression and CD8A expression normalization in ESCC patients in the TCGA dataset and internal bulk RNA-seq data.

[0056] Figure 21 Show the correlation of GEM and PDCD1 expression in CD8+ in spatial transcriptional spots with CD8A expression > 0, GEM expression > 0, and PDCD1 expression > 0 (Pearson correlation test).

[0057] Figure 22 Show a dot plot of the representative gene expression patterns of CD8+ T cell subsets in the ESCC scRNA-seq integrated dataset.

[0058] Figure 23 Show the expression level of GEM in the T cell scRNA-seq dataset in the pan-cancer public database (cohort 7).

[0059] Figure 24 Show the efficiency of detecting GEM OE by flow cytometry (left) and qPCR (right). OE, overexpression.

[0060] Figure 25 Show the expression levels of PD1 and CD39 upon re-stimulation of GEM OE and Ctrl T cells.

[0061] Figure 26 Show that anti-EGFR CAR1-T cells transfected with GEM OE or Ctrl secrete TNF-α and IFN-γ. Anti-EGFR CAR1-T cells transfected with GEM OE or Ctrl were co-cultured with KYSE30L, KYSE150L, and KYSE450L cells, and the concentrations of IFN-γ and TNF-α in the culture supernatant were analyzed by ELISA.

[0062] Figure 27 Show the cell proliferation of ESCC cells (upper panel, KYSE450; lower panel, KYSE150) co-cultured only with medium (blank), T cells, CAR1-T ctrl cells, or CAR1-T GEM OE cells (E / T = 0.2).

[0063] Figure 28 Show the GEM gene knockout efficiency determined by TIDE. TIDE, Tracking of Indels by Decomposition, a web tool for determining allele frequencies.

[0064] Figure 29 Show the proliferation of Ctrl CAR-T cells and GEM KO CAR-T cells after culturing with KYSE150L cells (unpaired two-tailed t-test at each time point). Top, CAR1; bottom, CAR2.

[0065] Figure 30 Show the protein levels of CCR7 and CD45RO in GEM KO or Ctrl CAR-T cells after co-culture with KYSE150L cells as evaluated by flow cytometry.

[0066] Figure 31 Show the expression of GEM in CAR-T cells (CAR2) after different rounds (Round_0 to Round_2) of co-culture with ESCC cell KYSE150 as detected by qPCR. Round_0, before co-culture with KYSE150L. Round_1 and 2, co-culture with KYSE150L. Left panel, detection of GEM expression by qPCR. Right panel is the corresponding cell lysis efficiency of GEM KO CAR-T cells in Round 2.

[0067] Figure 32 Show the mRNA levels (PFKM) of ZFP36 and ZNF683 in GEM KO CD8+ CAR-T cells (CAR2) and their corresponding cells as studied by RNA-seq.

[0068] Figure 33 Show the efficiency of GEM OE as detected by qPCR. OE, overexpression.

[0069] Figure 34 Show the migration tracks (white lines) of GEM overexpressing CAR-T cells (CAR2) and their corresponding cells (red) co-cultured with KYSE150 cells (purple).

[0070] *, p < 0.05; **, p < 0.01; ***, p < 0.001; ns, not significant. Detailed implementation manners

[0071] Modified immune cells

[0072] The present invention provides modified immune cells or their precursors (e.g., T cells) that include endogenous modification of GEM. In certain embodiments, the cells include nucleic acids capable of downregulating the gene expression of endogenous GEM. In certain embodiments, the cells further include exogenous TCR and / or CAR.

[0073] In one aspect, the present invention provides a modified immune cell or its precursor (e.g., a T cell) and an exogenous CAR, wherein the modified immune cell or its precursor (e.g., a T cell) comprises a CRISPR-mediated modification at an endogenous locus encoding GEM, which modification is capable of downregulating the gene expression of endogenous GEM. In another aspect, the present disclosure provides a modified immune cell or its precursor (e.g., a T cell) and an exogenous TCR, wherein the modified immune cell or its precursor (e.g., a T cell) comprises a CRISPR-mediated modification at an endogenous locus encoding GEM, which modification is capable of downregulating the gene expression of endogenous GEM.

[0074] The TCR and / or CAR comprises an affinity for an antigen on a target cell. Thus, such modified cells have specificity directed by the TCR and / or CAR expressed therein.

[0075] The present invention provides gene-edited modified cells. In some embodiments, the modified cells of the present disclosure (e.g., modified cells comprising an exogenous TCR and / or CAR) are gene-edited to disrupt the expression of an endogenous locus encoding GEM. In some embodiments, the gene-edited immune cells (e.g., T cells) have a downregulation, reduction, deletion, elimination, knockout, or disruption of endogenous GEM expression.

[0076] Immunotherapies using chimeric antigen receptor (CAR) T cells and TCRs to redirect T cells have shown variable efficacy in treating cancer patients. One of the major problems limiting their action is T cell exhaustion after continuous stimulation by tumor cells. Exhausted T cells have reduced effector functions, such as cytokine production and cytotoxicity against tumor cells, and they express higher levels of checkpoint inhibitory molecules, such as PD-1 and CTLA-4. Antibodies against PD-1 and CTLA-4 have been clinically used to treat various types of cancer.

[0077] The modified cells of the present invention are gene-edited to disrupt the expression of additional endogenous genes. For example, the cells can be further edited to disrupt the endogenous PDCD1 gene product (e.g., programmed death 1 receptor; PD-1).

[0078] The present invention is further illustrated by the following examples, which do not limit the present invention to the scope of the described examples. The experimental methods without specific conditions noted in the following examples are carried out according to conventional methods and conditions, or according to the product specifications. The raw materials and equipment used in the examples are well-known to those skilled in the art and are all commercially available or easily obtainable or preparable.

[0079] In the experimental methods of the following examples, unless otherwise specified, they are all conventional methods, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0080] Example 1: In vitro transcription of sgRNA

[0081] (1)Obtaining the in vitro transcription template

[0082] The in vitro transcription template of sgRNA was obtained by PCR, and a T7 promoter was added at the front during PCR.

[0083] 1) The PCR reaction system is as follows:

[0084] Component Name Dosage (μL) <![CDATA[ddH2O]]> 32.5 5× Buffer 10.0 dNTP (2.5 mM) 4.0 Primer - F (10 μM) 1.0 Primer - R (10 μM) 1.0 Template (px330) (~50 ng / μL) 1.0 Q5 DNA polymerase 0.5 Total 50.0

[0085] Gently mix and place on the PCR instrument for reaction;

[0086] 2) The PCR reaction program is as follows:

[0087] Procedure Temperature (°C) Time Pre - denaturation 98 30 s Denaturation 98 10 s Annealing 60 10 s Extension 72 15 s Extension 72 3 min Completion 4 ∞

[0088] Among them, steps 2 - 4 are carried out for 30 cycles.

[0089] 3) Nucleic acid gel electrophoresis

[0090] Prepare a 2% agarose gel: Weigh 2 g of agarose powder and pour it into a conical flask. Measure 100 mL of 1×TAE and pour it into the conical flask. Heat it in the microwave until the agarose powder is completely dissolved. Wait until it cools to about 60°C, mix well, pour it onto the plate, and insert the well comb. Wait until it completely cools and hardens before use. (Configure the concentration of the corresponding agarose gel according to the size of the PCR product band. Generally, the larger the product length, the smaller the gel concentration, and the smaller the length, the larger the gel concentration)

[0091] Add 1 μL of DNA 10×loading buffer to 3 μL of the PCR product, mix well and add it to the 2% agarose gel well. Add a DNA marker to the well next to the sample group (generally select a suitable DNA marker according to the size of the target band). Under the condition of 140 V, run for 25 min. After finishing running, quickly put it into 1×TAE containing EB for staining for 20 min. Put the gel block into the gel imager for detection. If the band size is correct, proceed to the next step of recovery.

[0092] 4) Recovery of PCR products (DNA Clean&Concentrator Kits)

[0093] ① Add 5 volumes of DNA Binding Buffer (1 mL) to 200 μL of PCR product and gently mix well.

[0094] ② Insert the Zymo-Spin Column into the Collection Tube, then add the mixture from the previous step to the Column and centrifuge at 6000 rpm for 30 s. Discard the waste liquid.

[0095] ③ Add 500 μL of Washing Buffer to the adsorption column and centrifuge at 12000 rpm for 30 s. Discard the waste liquid. Repeat once. Then centrifuge empty at 12000 rpm for 1 min to remove the residual Washing Buffer.

[0096] ④ Transfer the Column to a new 1.5 mL EP tube, air dry for 2 min to further remove the alcohol in the Washing Buffer, then add 15 μL of ddH2O (56 °C) to the center of the Column and incubate at room temperature for 1 min.

[0097] ⑤ Centrifuge at 12000 g for 1 min to elute the target DNA fragment and detect the concentration.

[0098] (2) In vitro transcription of sgRNA

[0099] In vitro transcription reaction system:

[0100] Component Name Dosage Nuclease - free water To 30 μL NTP Buffer Mix 10 μL Template DNA 1.2 μg T7 RNA Polymerase Mix 2 μL Total 30 μL

[0101] Add the above reagents to a 200 μL EP tube, gently mix, then place the EP tube in a PCR instrument and react at 37 °C for 16 h; after the reaction is completed, take out the EP tube, add 2 μL of DNase to it, gently mix, and place it in the PCR instrument and react at 37 °C for 15 min.

[0102] (3) Recovery of sgRNA product (MEGAclear Kit)

[0103] ① After the in vitro transcription reaction is completed, add 70 μL of Elution Buffer to the system, gently mix, take out 1 μL for running agarose gel, and judge whether the in vitro transcription is successful according to the size and intensity of the band. If successful, the in vitro transcription product can be recovered.

[0104] ② Elution Buffer preheated at 95 °C;

[0105] ③ Transfer the 100 μL product from the previous step to a 1.5 mL Eppendorf tube. Add 350 μL of Binding Buffer to the 1.5 mL Eppendorf tube, mix gently, then add 250 μL of absolute ethanol and mix gently.

[0106] ④ Transfer the product from the previous step to a recovery column, incubate at room temperature for 1 min, and centrifuge at 6000 g for 30 s.

[0107] ⑤ Discard the filtrate. Add 500 μL of Washing Buffer to the recovery column, centrifuge at 12000 g for 30 s, repeat once, and then centrifuge without sample for 1 min.

[0108] ⑥ Transfer the recovery column to a new RNase-free Eppendorf tube. Add 50 μL of Elution Buffer preheated to 95 °C to the center of the recovery column, cover the lid of the Eppendorf tube, incubate at room temperature for 2 min, centrifuge at 13000 g for 2 min, and measure the concentration of the product.

[0109] (4)IVT-sgRNA Dephosphorylation

[0110] Reagent Name Reagent Dosage IVT - sgRNA 40 μg 10× Cutsmart 10 μL Calf Intestinal Alkaline Phosphatase (CIAP) 40 U RNase - free water To 100 μL

[0111] Mix gently and place on a PCR instrument, incubate at 37 °C for 1 h. Then recover sgRNA using the MEGAclear Kit.

[0112] Example 2. Detection of the Editing Efficiency of the CRISPR / Cas9 System

[0113] (1)Extraction of Edited Cellular Genomic DNA

[0114] 1) Count the cells to be detected, collect the cells according to the required amount, and centrifuge at 400 g for 5 min at room temperature.

[0115] 2) Wash the cell pellet once with DPBS and centrifuge at 400 g for 5 min at room temperature.

[0116] 3) Discard the supernatant. According to the cell amount, add cell lysis solution to the cell pellet (1 μL for 1000 cells), mix well, and transfer to a 200 μL Eppendorf tube (PCR tube).

[0117] 4) Place the above 200 μL Eppendorf tube on a PCR instrument for lysis. The lysis program is (50 °C, 60 min; 95 °C, 15 min; 4 °C, +∞).

[0118] Note: At the same time, a group of negative CTRL (cells without gene editing) is required, and this CTRL is needed for the subsequent two detections.

[0119] (2) PCR amplify the DNA sequence of the target site;

[0120] Note: PCR primers F and R are each designed about 400 - 800 bp above and below the sgRNAs of the target site.

[0121] 1) The PCR reaction system is as follows:

[0122] Component Name Dosage (μL) <![CDATA[ddH2O]]> 40.8 10× AccuPrime Buffer II 5.0 Primer - F (10 μM) 1.0 Primer - R (10 μM) 1.0 Template 2.0 AccuPrime taq DNA polymerase 0.2 Total 50.0

[0123] Gently mix and place on the PCR instrument for reaction;

[0124] 2) The PCR reaction program is as follows:

[0125] Procedure Temperature (°C) Time Pre - denaturation 95 3 min Denaturation 95 30 s Annealing X 30 s Extension 68 X Extension 68 2 min Completion 4 ∞

[0126] Among them, steps 2 - 4 are carried out for 35 cycles.

[0127] Note: The annealing temperature is set according to the PCR primers, GEM, 60°C;

[0128] The in - cycle annealing is set according to the length of the PCR product. The characteristics of AccuPrime taq DNA polymerase enable 1 min / 1 kb.

[0129] 3) Detect the PCR products by agarose gel electrophoresis and judge according to the size of the product bands;

[0130] (3) TIDE analysis

[0131] 1) Perform sanger sequencing on the PCR products of the Surveyor assay;

[0132] 2) Analyze the peak map of the above - mentioned sequencing results through the webpage http: / / tide.nki.nl. The results are as Figure 22 shown.

[0133] Example 3: Isolate primary T cells from PBMCs

[0134] (1) Prepare the sorting solution: 98% DPBS + 2% FBS (inactivated) + 1 mM EDTA;

[0135] (2) Adjust the density of PBMCs to 5e 7 cells / mL with the sorting solution, and then transfer to a 5 mL flow tube;

[0136] (3) Add 50 μL / mL of EasySep human T cell Enrichment cocktail to PBMCs, gently pipette and mix well, and incubate at room temperature for 10 min;

[0137] (4)Vortex the EasySep D Magnetic Particles on the oscillator for 30 s to mix them thoroughly. Add the EasySep D Magnetic Particles to the PBMCs at a concentration of 50 μL / mL, gently pipette to mix, and incubate at room temperature for 5 min.

[0138] (5)Supplement the PBMCs with DPBS to 2.5 mL, gently mix, remove the cap from the flow tube, insert it into the magnet, and incubate at room temperature for 5 min.

[0139] (6)Pick up the magnet and quickly pour the cell suspension into a new centrifuge tube (let it stand for 3 s without shaking). The desired CD3+ T cells are in the poured-out liquid.

[0140] (7)Add 10 mL of DPBS to the poured-out cell suspension, mix well, take 20 μL of the cell suspension for counting, and centrifuge: 300 g, 10 min, at room temperature, with no brake (brake-off) for both acceleration and deceleration; according to the cell count, resuspend the cells using T400 and adjust the density of CD3+ T cells to 2e 6 cells / mL and transfer them to a culture dish or flask for culture.

[0141] (8)Take 2e 5 cells and perform flow cytometry to detect the purity of CD3+ cells (>95%).

[0142] (9)Activate the CD3+ T cells as needed (4e 7 cells require 1 ml of Dynabeads Human T Activator CD3 / CD28).

[0143] (10)Culture in an environment of 37°C and 5% CO2.

[0144] Example 4. Preparation of CAR-T Cells

[0145] (1)Packaging of Lenti-EGFR-CAR Virus

[0146] 1) Passage the resuscitated 293T cells twice. When they are confluent, passage them at a ratio of 1:2 into a 10 cm dish and incubate overnight in the incubator.

[0147] 2) The next day, when the confluence of 293T cells is about 90%, replace the cell medium with 7 mL of fresh medium pre-warmed to 37°C.

[0148] 3) Prepare two 15 mL centrifuge tubes A and B.

[0149] 4) Add the Opti-MEM restored to room temperature to the A and B tubes, 1.5 mL to each tube.

[0150] 5) Add P3000 to tube A: 48 μL, package plasmid pMD2.G, pasPAX2 6 μg each, and target plasmid fuw-EF1a-019-28Z-P2A-eGFP 12 μg, mix gently.

[0151] 6) Add Lipofectamine 3000 to tube B: 42 μL.

[0152] 7) Incubate tubes A and B at room temperature for 5 min.

[0153] 8) Add tube A to tube B, mix gently, and incubate at room temperature for 15 min to form the liposome-DNA complex.

[0154] 9) Add the liposome-DNA complex formed after incubation of A + B to the cells that have been changed with fresh medium in step 2 (slowly and gently add from the side wall of the culture dish to avoid dislodging the cells), then return to the 37°C, 5% CO2 incubator for continued culture.

[0155] 10) Harvest the virus (culture supernatant) 48 h after transfection, and replenish with fresh pre-warmed complete DMEM medium. Return the cells to the 37°C, 5% CO2 incubator for continued culture. Store the harvested cell supernatant at 4°C.

[0156] 11) Harvest the virus again 72 h after transfection, and mix the supernatants collected twice. Filter through a 0.45 μm filter membrane (to remove detached cells and cell debris in the supernatant).

[0157] 12) Concentrate the virus. Add the supernatant filtered in the previous step to the virus concentration tube (less than 15 mL), centrifuge: 3200 g, 50 min, 4°C.

[0158] 13) After centrifugation, a dark red virus concentrate of approximately 200 μL can be seen in the middle of the virus concentration tube. It can be used immediately or transferred to a 1.5 mL EP tube, sealed with a sealing film, and stored at -80°C.

[0159] (2) Lentivirus infection of T cells

[0160] 1) Count the activated cells 24 h after T cell activation.

[0161] 2) Take cells according to the required cell amount, and then adjust the cell density to 2e 6 / ml;

[0162] 3) Add the corresponding amount of concentrated lentivirus according to the cell quantity. 50 μL of virus concentrate can infect 1e 6 cells, and at the same time add the transfection reagent Polybrene with a final concentration of 10 μg / mL. Gently mix and place it in a 6-well plate with a volume of 1 mL per well, and then put it in an incubator for culture;

[0163] 4) After culturing for 4 - 6 h, replenish the medium of the infected cells, add 1 mL to each well, and continue to culture in the incubator;

[0164] 5) After 48 h of infection, the infection efficiency can be detected by detecting the proportion of eGFP through flow cytometry.

[0165] (3) Preparation of GEM gene knockout CAR-T cells

[0166] 1) Preparation of experimental reagents

[0167] Electroporation kit (P3 Primary Cell 4D-Nucleofector X Kit); SpCas9 protein (placed on ice); sgRNA (placed on ice); T cell medium; DPBS; Loza electroporator; RNase-free EP tubes; RNase-free pipette tips (10 μL / 200 μL / 1 mL), etc.;

[0168] 2) Two days after the CAR-T cells are infected, that is, three days after the T cells are activated, remove CD3 + / CD28 + beads;

[0169] 3) Add sgRNA (6 μg / well) to an RNase-free EP tube, and then slowly add SpCas9 protein (6 μg / well). Gently mix and incubate at room temperature for 20 min to form an RNP complex;

[0170] 4) Prepare the electroporation buffer: 20 μL system: 16.4 μL nucleofector solution + 3.6 μL Supplement. Gently mix and let it stand at room temperature for later use (usually prepared and used immediately);

[0171] 5) During the incubation of sgRNA and cas9 protein, prepare the cells

[0172] ① Count the cells, take the cells according to the cell quantity required for electroporation, 1e 6 cells per electroporation well (usually take 0.5 more samples), centrifuge: 300 g, 10 min, room temperature, with no brake for both acceleration and deceleration (brake-off);

[0173] ② Discard the supernatant, add 5 mL of DPBS, resuspend by pipetting, and centrifuge at 300 g for 10 min at room temperature with no brake during acceleration and deceleration (brake-off) (the purpose is to wash away the FBS in the culture medium).

[0174] 6) After the cell centrifugation is completed, discard the supernatant (try to remove the supernatant as completely as possible without sucking away the cells), resuspend the cell pellet with the prepared electroporation buffer, gently mix, aliquot into the RNP incubated in (4), gently mix, transfer to the electroporation strip wells (do not generate bubbles), gently tap the bottom to make the cell suspension at the bottom of the electroporation wells.

[0175] 7) Place the electroporation strip into the electroporator and perform electroporation. The electroporation program: EO-115 program.

[0176] 8) After the electroporation is completed, take out the electroporation strip. In the laminar flow hood, add 80 μL of pre-warmed T cell culture medium to each electroporation well, cover the electroporation strip lid, and place it in the incubator for 20 min.

[0177] 9) Transfer the cells in the electroporation strip to a 12-well plate, add 1 mL of T cell culture medium for culturing, and place it in a 37°C, 5% CO2 incubator for culturing.

[0178] Example 5. In vitro killing experiment of CAR-T cells

[0179] 1) Adjust the cell density of the target cells KYSE150-luc to 1×10 5 cells / mL with 1640 complete medium. After mixing, seed the cell suspension into a 96-well plate, 100 μL per well, with 3 replicates for each effector-to-target ratio of each effector cell.

[0180] 2) According to the effector-to-target ratio of killing, add the effector cells CAR-T / T cells to the target cells at a certain ratio, with a final volume of 200 μL.

[0181] 3) Incubate in the incubator and detect the killing efficiency at the corresponding time points.

[0182] 4) Add 10 μL of Steady-Glo luciferin substrate to each well, react for 5 min, and detect the fluorescence value after the reaction of luciferase and the substrate by a microplate reader.

[0183] 5) Calculate the killing efficiency of the effector cells on the target cells based on the fluorescence value of each well: specific lysis (%) = (1 - RUL effector cells plus target cells / RUL target cells) * 100 (RUL: relative light unit). The results are as Figures 5 - 6 shown.

[0184] Example 6. Detection of cytokine release by enzyme-linked immunosorbent assay (ELISA)

[0185] Collection of supernatant

[0186] 1) Effector cells and target cells were co-incubated in a 96-well plate at a ratio of 0.04:1 (1×10⁶ cells of each type) in a 200 μL system for 2 days. The medium used during incubation was RPMI 1640 complete medium; 4 After incubation for 2 days, the supernatant was collected for the detection of IFN-γ, TNF-α and granzyme B released during the reaction of effector cells and target cells. It can be used immediately or stored at -80 °C;

[0187] 3) The detection results of cytokines are shown as follows

[0188] 3) The detection results of cytokines are as Figures 10 - 11 shown

[0189] Example 7. Multi-round killing experiment

[0190] 1) 3×10⁶ CAR-T cells were incubated with tumor cells at a ratio of 1:1 5 2) After two days, all the tumor cells were lysed. The CAR-T cells were collected and counted, and then incubated with tumor cells again at a ratio of 1:1. And so on, every 2 days, new tumor cells were added until the lysis ability of CAR-T cells decreased significantly.

[0191] 3) At the end of each round, CAR-T cells were collected and relevant parameters were measured by flow cytometry. The results are as

[0192] 3) At the end of each round, CAR-T cells were collected and relevant parameters were measured by flow cytometry. The results are as Figure 9 shown

[0193] Example 8

[0194] CAR-T cells were cultured with KYSE150 tumor cells. CD8+GFP+ effector cells were isolated by fluorescence-activated cell sorting after co-incubation in Round_3. Samples were sent to GENE DENOVO Ltd. (Guangzhou, China) for RNA extraction, library preparation and sequencing.

[0195] Plasmid construction

[0196] Fuw-EF1α-CARs-P2A-eGFP (CAR1 and CAR2 against EGFR) was constructed in this example, and other plasmids were modified based on this. Fuw-EF1α-CARs was obtained by removing [P2A-eGFP] from Fuw-EF1α-CARs-P2A-eGFP, while Fuw-EF1α-P2A-mcherry and Fuw-EF1α-GEM-P2A-mCherry plasmids were obtained from Fuw-EF1α-CAR2-P2A-eGFP by replacing the [CAR2-P2A-eGFP] gene with [P2A-mcherry or GEM-P2A-mcherry].

[0197] Production of lentivirus

[0198] HeK293T cells were seeded at a density of 7×10 6 cells per 10 square centimeters, and the cell transfection experiment was performed when the cell confluence reached approximately 90% 15 to 18 hours later. The transfection process was carried out according to the instructions of Lipo3000 (Thermo Fisher Scientific, L3000015). At 48 hours and 72 hours after transfection, the virus supernatant was harvested and filtered through a 0.45 mm filter. Then, the lentivirus particles were concentrated by centrifugation at -4°C and 4000 rcf (Merck Millipore Ultracel-100 K, UFC910096) for 1 hour; finally, the concentrated virus was stored at -80°C.

[0199] Isolation, activation, and expansion of CD3+ T cells

[0200] Peripheral blood mononuclear cells (PBMCs) were purchased from Milestone Biotechnologies. T cells were isolated using the EasySep Human T Cell Enrichment Kit (Stemcell Technologies) and activated and expanded with anti-CD3 / anti-CD28 Dynabeads magnetic beads (Thermo Fisher Scientific) at a ratio of 1:1 according to the manufacturer's instructions. T cells were cultured in X-VIVO15 medium (Lonza) supplemented with 5% (v / v) heat-inactivated FBS (GIBCO) and 400 IU / mL recombinant human IL-2 (Sino Biological, Inc.)

[0201] Construction of anti-epidermal growth factor receptor CAR

[0202] The scFv is derived from the epidermal growth factor receptor antibody mAB806 and can recognize residues 287 - 302 of the epidermal growth factor receptor. The anti-EGFR CAR contains the extracellular domain of the human CD8a signal peptide (nucleotides 1032 - 1094; GenBank NM 001145873.1), the CD8a hinge (nucleotides 1443 - 1577; GenBank NM001145873.1), and the CD28 transmembrane domain (nucleotides 515 - 595; GenBank NM 006139.4). The CD28 ("28"; nucleotides 596 - 718, GenBank NM 006139.4) costimulatory domain and the CD3z ("Z"; nucleotides 363 - 698, GenBank XM 011510145.2) costimulatory polypeptide constitute the intracellular domain of the anti-EGFR CAR. To facilitate the detection of the efficiency of CAR in lentivirus-infected T cells with anti-CAR, the "self-cleaving" polypeptide P2A and eGFP were ligated behind CD3Z. All anti-CAR sequences were chemically synthesized and constructed into lentiviral vectors.

[0203] Generation of anti-EGFR CAR-T cells

[0204] Freshly purified primary CD3+ T cells were activated with Dynabeads Human T-Activator CD3 / CD28 (LifeTechnologies) at a ratio of 1:1 of magnetic beads to cells for 24 hours and then infected with lentivirus carrying anti-EGFR CAR. The density of T cells was maintained at 2×10 6 cells / ml.

[0205] In vitro transcription

[0206] Method for preparing in vitro transcribed (IVT) single guide RNA (sgRNA): The plasmid PX330 (42230) containing the sgRNA backbone was used as a PCR template, and the obtained PCR amplification fragment containing the T7 promoter, 20-bp target sequence, and sgRNA backbone was used as the IVT template. IVT was performed using the MEGAshortscript T7 Kit (Thermo Fisher Scientific). During treatment, 2 U of calf intestinal phosphatase (NEB) was added to each microgram of in vitro transcribed sgRNA, and then incubated at 37°C for 1 hour. Then, the sgRNA was purified using a MEGAclear column (Thermo Fisher Scientific) and eluted with the elution buffer.

[0207] Example 9 Gene Editing and Overexpression Efficiency Analysis

[0208] Collect CAR-T cells 72 hours after electroporation for Sanger sequencing (GENE DENOVO Ltd., Guangzhou, China). Determine the genomic knockout level of GEM in CAR-T cells by TIDE (Tracking Indels by Decomposition) analysis. Detect the expression level of GEM by qPCR. Extract total RNA using the RNAmini Kit (Qiagen) according to the production instructions. Reverse transcribe to synthesize cDNA using the HiScriptII 1st Strand cDNA Synthesis Kit (Vazyme). Quantify the mRNA of GEM using the CFX96 real-time detection system (Bio-Rad) and ChamQ SYBR qPCR Master Mix (Vazyme). The genotyping PCR primers for amplifying the target site are as follows: Human GEM forward: gtgtccagttgaaagcctgtc, reverse: cctttctggcccaggatcaac. The qPCR primers for detecting the expression of GEM and GAPDH are as follows: Human GEM forward: aagctggtcctctgactcca, reverse: cactttccccatcaaccatc. Human GAPDH forward: atgacatcaagaaggtggtg, reverse: cataccaggaaatgagcttg.

[0209] Example 10 Electroporated CAR-T Cells

[0210] CRISPR / Cas9 gene editing was performed by electroporating the Cas9 / gRNA (RNP) complex using a 4D-Nucleofector (Lonza) and the PrimaryCell 4D-NucleofectorTM X Kit S (V4XP-3032, Lonza). The RNPs contained 10 μg of Cas9 protein and 10 μg of sgRNA (human GEM sgRNA1: cagcatggacagcgactgcg; sgRNA2: actaccgagtggtgctcata) and were pre-complexed at room temperature for 15 minutes to form ribonucleoprotein complexes. 48 hours after lentiviral infection, 1×10 6The CAR-T cells were centrifuged at 300 rcf for 6 minutes and then resuspended in 20 μL of transfection buffer. The RNP was also resuspended in 20 μL of the above transfection buffer. Subsequently, the mixture was transferred to the electroporation cuvette of a 16-well microplate strip using the EO-115 program. The CAR-T cells were resuscitated in 1 mL of pre-warmed T cell medium and amplified as described above. The gene knockout efficiency was detected using the Tracking of Indels by DEcomposition (TIDE) technique, and the results are as Figure 28 shown.

[0211] Example 11 Multi-round antigen stimulation assay

[0212] The CAR-T cells (3×10 5 ) were co-incubated with KYSE150 tumor cells at an effector-to-target cell (E / T) ratio of 1:1. Two days later, all the tumor cells were lysed, and then new tumor cells were added to the culture system. Similarly, new tumor cells were added every two days until the lysis ability of the CAR-T cells was significantly reduced. The CAR-T cells were collected at the end of each round of culture, and the relevant parameters were measured by flow cytometry.

[0213] Example 12 Flow cytometry

[0214] Fluorescence expression analysis was performed using a CytoFLEX LX (Beckman Coulter) and a BD LSRFortessa. The harvesting and preparation of the cells were carried out according to the manufacturer's protocols.

[0215] Example 13 Luciferase-based cell lysis assay

[0216] The cytotoxicity assessment of KYSE450-luciferase, KYSE150-luciferase cells, and KYSE30-luciferase cells was performed as described above. The luciferase cells were seeded at 4×10 4Cells were suspended in RPMI 1640 medium at a density of cells / mL, and 100 μL of the cell suspension was inoculated into a 96-well white opaque plate and cultured at 37°C under 5% CO2. After 8 hours, 100 μL of the CAR-T cell suspension was inoculated into the tumor cells at the specified ratio and cultured for 2 or 4 days at 37°C and 5% CO2. 10 μL of Steady-Glo luciferase substrate (Promega) was added, and the luminescence was recorded with a Synergy H1 imager (Bio Tek) after 5 minutes. The results were reported as the percentage of killing based on the comparison of the luciferase activity in the wells with the luciferase activity in the wells containing only tumor cells. Percentage of killing = 100 - [(RLU of the co-culture well containing effector cells and target cells) / (RLU of the well containing target cells) × 100].

[0217] Example 14 Cytokine ELISA

[0218] The effector cell supernatants co-incubated with target tumor cells (KYSE150, KYSE450, KYSE30) for 48 hours were harvested at a ratio of 0.4:1 (4×10 3 tumor cells each). The cytokines produced by the effector cells (including IFN-γ, TNF-α, and Granzyme B) were evaluated using an ELISA kit according to the manufacturer's protocol.

[0219] Example 15 Animal Model and In Vivo CAR-T Cell Function Detection

[0220] Six-week-old female NOD-Prkdcscid Il2rgem1 / Cyagen (C-NKG) mice (Cyagen) were subcutaneously injected with 2×10 6 KYSE150-luci tumor cells. The mice were randomly divided into two groups, CAR1-Ctrl and CAR1-GEM KO (n = 4 in each group); when the tumor volume was approximately 60 mm 3 , the mice were injected once with 5×10 5 CAR-T cells via the intrathecal injection route. Body weight and tumor size were monitored every 4 days. The formula for calculating tumor volume was V = 0.52×L×W 2 (V, volume; L, tumor length; W, tumor width). The formula for calculating tumor growth inhibition rate was TGI = (1 - ΔT / ΔC) × 100%, where ΔT = the change in tumor volume in the drug treatment group on the last day of the study, and ΔC = the change in tumor volume in the control group on the last day of the study.

[0221] Example 16 Live-cell time-lapse imaging

[0222] The KYSE150 cell line expressing tagBFP-H2B and halo-TM (the 147-bp transmembrane sequence of PDGFRB) was incubated with the Janelia Fluor® HaloTag® ligand (1:1000, Sigma-Aldrich, GA1120) at 37 °C for 15 minutes. After incubation, the cells were resuspended in complete RPMI 1640 medium at a concentration of 1.5 × 10^5 cells / mL, and then seeded into a 96-well glass-bottom culture plate (Cellvis, P96-1.5H-N) at 100 μL per well and cultured in an incubator at 37 °C with 5% CO2. After 6 hours, effector CAR-T cells expressing mCherry and overexpressing GEM and their corresponding cells were added to each well at different effector-to-tumor cell (E / T) ratios (1:1.5), with 100 μL of cell suspension added to each well.

[0223] To study the migration speed and deformation of CAR-T cells when targeting tumor cells, the co-culture was placed in a tabletop mini-incubator equipped with a humidifier for time-lapse imaging under the same conditions. The fluorescence time-lapse experiment was performed using a SpinSR (Olympus) microscope and a 40× air objective (NA0.95). The imaging process included layer scanning (a total of 9.4 μm, at intervals of 1 μm), and an optimized filter set was used: B447 / 60nm (405nm) for mTagBFP, B617 / 73nm(561nm) for mCherry, and B685 / 40nm (640nm) for halo-tag. Image analysis, including three-dimensional reconstruction, single-cell tracking, and quantification of the behavior of CAR-T cells and tumor cells - such as the number of interactions and the distance from the tumor - was performed using the point and surface modules in Imaris10.1.0 (Imaris). These modules also helped to further analyze the speed of contacting cells.

[0224] To analyze the dynamic interactions between CAR-T cells and tumor cells during contact and killing of tumor cells, an Opera Phenix Plus (PerkinElmer) microscope equipped with a 20× water objective lens (NA 1.0) was used. The solid-state filters (435 / 550 nm, 570 / 630 nm, and 650 / 760 nm) of the microscope were used to detect the designated fluorescence channels. The imaging process involved layer scanning arranged in a 1×5 pattern (a total of 9 μm, spaced 1 μm apart). The obtained images were projected using the maximum intensity projection method, and single-cell level analysis was performed using the integrated software of the microscope. Data visualization was performed using Prism 10 (GraphPad) and Origin (OriginLab Corporation) software. Representative videos and images were made using Imaris software. The results are as Figures 33 - 34 shown.

[0225] The present invention first focused on exhausted CD8+ T cells, analyzed the expression levels and chromatin accessibility of classical exhaustion activation markers, and confirmed the specific expression of CXCL13, LAYN, PDCD1, and TOX in exhausted CD8+ T cells. The inventors unexpectedly found that GEM, which encodes a small GTP-binding protein of the Ras superfamily, showed both higher expression and chromatin accessibility in a subset of exhausted CD8+ T cells ( Figures 2 - 3 ), while previously, the expression of GEM had not been reported to be related to T cell regulation. Notably, according to the scATAC-seq and scRNA-seq data of the present invention ( Figures 2 - 3 ), compared with LAYN, PDCD1, or TOX, GEM showed more specific expression in a subset of exhausted CD8+ T cells, and the accessibility of its promoter region was also increased in this subset ( Figure 16 ). In addition, GEM showed a weak positive correlation with the expression of PDCD1 in the scRNA-seq data (R = 0.15, p = 1.0×10 -12 ; see Figure 14 ), with the ESCC RNA sequencing data in the TCGA cohort (R = 0.48, p = 1.5×10 -6 ; see Figure 20 , left; R = 0.41, p = 9.5×10 -8 ; see Figure 20 , right), and spatial transcriptomics data (R = 0.25, p = 6.5×10 -8 ; see Figure 21), which was further verified using publicly available scRNA-seq data from integrated pan-cancer T cells, confirming the specific expression of GEM in exhausted CD8+ T cells (see Figure 23 ), indicating that GEM plays an important role in T cell exhaustion.

[0226] To verify that GEM is involved in T cell exhaustion, the present invention ectopically expressed GEM in primary T cells from healthy donors ( Figure 24 ). Overexpression of GEM (GEM-OE) led to increased expression of PD-1 and CD39 after restimulation ( Figure 25 ), indicating the potential role of GEM in T cell exhaustion. Further, CARs were used to determine whether GEM would affect the function of CAR-T cells. It was found that overexpression of GEM reduced the release of IFN-γ and TNF-α and impaired the cytolytic activity against ESCC cells ( Figures 26 - 27 ). Conversely, knockout of the GEM gene enhanced the cytolytic ability of CAR-T cells in vitro and in vivo ( Figures 5 - 8 ), decreased the levels of PD-1 and CD39 ( Figure 9 ), increased the secretion of IFN-γ and TNF-α ( Figures 10 - 11 ), knockout of the GEM gene also promoted the proliferation of CAR-T cells ( Figure 12 ), and changed their functional state composition by increasing the proportion of central memory T cells (see Figure 30 ). The present invention also found that the level of GEM mRNA gradually increased with continuous co-culture with tumor cells (Figure 31). The above results indicate that during tumorigenesis, GEM regulates CD8+ T cells towards a dysfunctional state, and thus it is possible to enhance the anti-tumor immunity of CAR-T cells by eliminating GEM.

[0227] To explore the potential mechanism by which the GEM gene regulates CD8+ T cell exhaustion, RNA-seq analysis was performed on CD8+ CAR-T cells with GEM gene knockout (GEM-KO) and their counterparts. The results showed that knockout of the GEM gene significantly increased the expression of ZNF683 and ZFP36 ( Figure 32 ), two genes involved in maintaining the response of CD8+ T cells. Similarly, GSEA analysis showed that the anti-tumor inflammatory response pathway was significantly enriched in the GEM-KO group (Figure 14). The immunological synapse is an embodiment of the cytolytic function of CD8+ T cells. The results also showed that processes related to synapses and actin cytoskeleton remodeling were prominent in the GEM-KO group (Figure 14), indicating that the formation of immunological synapses may be enhanced after GEM is eliminated. It has been previously documented that GEM can inhibit high-voltage-activated Ca 2+Channel activity. In the research of the present invention, a high enrichment of the calcium channel complex related to the cytotoxicity of CD8+ T cells was also observed in the GEM-KO group (Figure 14). Time-lapse imaging detection showed that overexpression of GEM significantly impaired the motility of CAR-T cells ( Figures 15 - 16 , Figures 33 - 34 ), as well as the ability to bind to and kill target cells ( Figures 17 - 18 ). The above findings indicate that GEM may weaken the cytolytic ability of T cells by inhibiting cell motility and the ability to bind to target cells.

[0228] As described above, only the preferred specific embodiments of the present invention are provided, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention, according to the technical solution and inventive concept of the present invention, makes equivalent substitutions or changes, and should be covered within the protection scope of the present invention.

Claims

1. A modified T cell comprising an endogenous modification encoding a GEM, wherein the modification is a knockout of the GEM.

2. The modified T cell according to claim 1 further comprises an exogenous T cell receptor (TCR) and / or a chimeric antigen receptor (CAR), wherein the exogenous T cell receptor (TCR) and / or the chimeric antigen receptor (CAR) have affinity for an antigen on a target cell.

3. The modified T cell according to any one of claims 1-2, wherein the modification is mediated by the CRISPR system.

4. The modified T cell of claim 3, wherein the CRISPR system is mediated by CRISPR / Cas9, and the CRISPR system comprises a CRISPR nuclease and a guide RNA.

5. The modified T cell of claim 4, wherein the guide RNA comprises a guide sequence that is sufficiently complementary to a target sequence in an endogenous locus encoding a GEM.

6. The modified T cell according to any one of claims 4-5, wherein the guide RNA has a nucleic acid sequence as shown in SEQ ID NO: 1-2.

7. The modified T cell of claim 2, wherein the exogenous TCR is selected from a wild-type TCR, a high-affinity TCR, and a chimeric TCR.

8. The modified T cell of claim 2, wherein the antigen on the target cell is a tumor-associated antigen (TAA).

9. The modified T cell according to any one of claims 1-2, wherein the modified cell can resist or alleviate cell function exhaustion and / or dysfunction.

10. The modified T cell of claim 9, wherein the modified T cell is resistant to T cell exhaustion and / or T cell dysfunction.

11. A method for producing a modified T cell according to any one of claims 1 to 10, comprising: Nucleic acid encoding an exogenous T cell receptor (TCR) and / or a chimeric antigen receptor (CAR) is introduced into the T cell, wherein the exogenous TCR and / or CAR comprises affinity for an antigen on a target cell.

12. The method of claim 11, wherein the polypeptide and / or nucleic acid is introduced into a CRISPR-mediated modification in an endogenous locus encoding a GEM.

13. According to the method of claim 12, the nucleic acid encoding exogenous TCR and / or CAR is introduced by viral transduction.

14. The method of claim 13, wherein the viral transduction comprises contacting the T cells with a viral vector comprising a nucleic acid encoding an exogenous TCR and / or CAR.

15. The method of claim 14, wherein the viral vector is selected from a retroviral vector, an adenoviral vector or an adeno-associated virus (AAV) vector.

16. Use of the modified T cell according to any one of claims 1 to 10 in the preparation of a drug for treating a disease or disorder, wherein the disease or disorder comprises cancer, and the cancer comprises solid tumors and blood tumors; wherein the disease or disorder comprises a chronic infection; The chronic infection is selected from HIV, EBV, CMV, and LCMV.

17. The use according to claim 16, wherein the modified T cells comprise CAR or engineered TCR.

Images