17beta-hsdcl enzyme mutants, vectors, microorganisms and uses thereof

Abstract

The application discloses a cytochrome P450BM3 mutant, a carrier, microorganisms and application thereof, and belongs to the technical field of chemical enzyme synthesis.The application discloses a synthetic route of a key drug intermediate dehydro-nandrolone acetate synthesized by a chemical enzyme method, wherein enzyme catalysis and chemical catalysis are included.The enzyme catalysis includes a cytochrome P450 mutant and 17beta-steroid reductase, and a one-pot two-step method is used to catalyze acid to be removed to generate 7beta-hydroxynandrolone.Combined with chemical catalysis, the 7beta-hydroxynandrolone is subjected to dehydration esterification to generate the dehydro-nandrolone acetate.The synthetic route has short steps, high yield and the ability to reduce the production cost of related steroid drugs.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biocatalytic enzyme, and particularly relates to a 17beta-HSDcl enzyme mutant, a carrier, microorganisms and application thereof. BACKGROUND

[0002] Steroid hormone drugs are the second largest drugs in the world after antibiotics, and are widely used in the treatment of inflammation, cardiovascular disease, tumor, skin disease, endocrine disorder, senile disease and the like. China is rich in natural steroid resources, and the production scale and product quality have approached the world advanced level, but the research and development technology level of steroid drugs still has certain gap, and the main reason is that the synthesis steps of steroid drugs are complicated, the reaction is complex, the remote effect of group is very obvious, the yield is low, and especially the separation and purification are difficult.

[0003] Steroid hormones can be divided into three categories according to physiological activity: protein anabolic hormone, adrenocortical hormone and sex hormone. Among them, the protein anabolic hormone is commonly known as synthetic, which is a kind of artificial synthesized steroid hormone of androgen mimics, the activity of which is reduced by structural modification of androgen, the protein anabolic activity is improved, and the drug is easy to absorb after use, the concentration in blood is high, the activity in body is large, and the drug has multiple effects. Dehydrogenolone acetate is an intermediate for synthesizing important steroid drugs such as fluvestrant, tibolone and mibolerone. Fluvestrant is an anti-breast cancer drug, tibolone is a drug for treating menopausal syndrome, and mibolerone is a protein anabolic hormone, which is widely used in clinic. It can rapidly increase muscle strength and circumference and improve muscle mass.

[0004] The first route (Zhang Tongbin, Chen Hongbo, Zheng Chenggang. Synthesis of 6-Dehydrogenolone Acetate [J]. China Pharmaceutical Industry, 2006, (15): 29-30) uses acid de (19-nor-4-androstene-dione, CAS: 734-32-7) instead of expensive nandrolone as raw material, and uses triethyl orthoformate to selectively protect the 3-position carbonyl under the catalysis of p-toluenesulfonic acid to obtain an etherized product, and then reduces the intermediate by KBH4 to obtain nandrolone under the action of acetone and hydrochloric acid to remove the protecting group to obtain nandrolone, and then diesterifies nandrolone with isopropenyl acetate to obtain acetonandrolone, and then brominates acetonandrolone, and then removes HBr by strong base to obtain compound dehydrogenolone acetate, and the total yield reaches 51%. But experiments prove that the efficiency of selectively protecting the 3-position carbonyl by triethyl orthoformate is not high in the process of synthesizing the intermediate, and it is not economical to use triethyl orthoformate as an etherizing reagent, and the route has a long step.

[0005] The second article (Rao Zhiwei, Zuo Wengu, Chen Denghui, et al. Synthesis of dehydrotestosterone acetate [J]. Chinese Journal of Medicinal Chemistry, 2013, 23(05): 368-71.) synthesis route takes acid as the starting material, and is esterified at C-3 position by acetic anhydride under the catalysis of p-toluenesulfonic acid to obtain compound 3-ethoxy-3,5-estradien-17-one, and 3-ethoxy-3,5-estradien-17-one is reduced to hydroxyl at 17 position by sodium borohydride at room temperature to obtain compound (17β)-3-Ethoxyestra-3,5-dien-17-ol, and (17β)-3-Ethoxyestra-3,5-dien-17-ol is acylated by acetic anhydride under the catalysis of 4-dimethylaminopyridine (DMAP) to obtain compound acetyldihydrotestosterone, and acetyldihydrotestosterone is brominated by NBS and then dehydrogenated under strong base conditions to obtain the target compound dehydrotestosterone acetate. The total yield is 68.1%. The reagents used in the route are not environmentally friendly, the route steps are relatively long, and the yield is low. SUMMARY

[0006] Based on the above research, we propose a new idea for preparing 6(7)-dehydrotestosterone acetate, and propose a P450 mutant enzyme for 7β-hydroxylation of acid (19-nor-4-androstadien-3-one, CAS: 734-32-7). Starting from the cheap and easily available acid, a one-pot two-step method is used to catalyze the acid to generate 7β-hydroxynorlone using P450 mutant enzyme and 17β-hydroxysteroid dehydrogenase (17β-HSD enzyme) mutant, and isopropanol dehydrogenase is used for regeneration and circulation of coenzyme NADPH, and further combined with chemical catalytic reaction to generate dehydrotestosterone acetate. Therefore, the purpose of the present application is to realize the above idea and provide a new synthesis route. The present application provides a cytochrome P450BM3 mutant, a vector, a microorganism and an application thereof, which solves the technical problems of how to generate 7-hydroxynorlone by deacidification or how to generate dehydrotestosterone acetate in the prior art.

[0007] In order to achieve the above technical purposes, the technical scheme of the present application is a 17β-HSDcl enzyme mutant, and the mutant of the 17β-HSD enzyme is selected from: mutant 17β-HSDcl / V161G, 17β-HSDcl / H164G, 17β-HSDcl / H164W and 17β-HSDcl / Y212A. The amino acid sequences of the mutant 17β-HSDcl / V161G, 17β-HSDcl / H164G, 17β-HSDcl / H164W and 17β-HSDcl / Y212A are shown in SEQ ID NO: 5-8, respectively.

[0008] The present application also provides a vector comprising a dehydrogenase gene, wherein the dehydrogenase is one or both of isopropanol dehydrogenase and glucose dehydrogenase; and a reductase, wherein the reductase is 17β-HSDcl enzyme and mutant of 17β-HSDcl enzyme; or the reductase is mutant of 17β-HSDcl enzyme. In the embodiments of the present application, the 17β-HSD enzyme is exemplified by 17β-HSDcl.

[0009] In addition, the present application also provides a microorganism for expressing the above-mentioned vector, wherein the microorganism is selected from the group consisting of Escherichia coli, Bacillus subtilis, Pichia pastoris, Saccharomyces cerevisiae, preferably Escherichia coli, and more preferably Escherichia coli BL21(DE3).

[0010] In addition, the present application also provides a microorganism for expressing the above-mentioned vector, wherein the microorganism is selected from the group consisting of Escherichia coli, Bacillus subtilis, Pichia pastoris, Saccharomyces cerevisiae, preferably Escherichia coli, and more preferably Escherichia coli BL21(DE3).

[0011] In addition, the present application also provides the use of the microorganism in catalyzing 7β-hydroxylation of a steroid compound, wherein the steroid compound is acid de or nandrolone; and the acid de or nandrolone is converted into 7β-hydroxy acid de or 7β-hydroxy nandrolone under the action of mutant LG-23, the microorganism for expressing the vector and the dehydrogenase.

[0012] Further, the present application provides a plasmid comprising the above-mentioned coding gene. The plasmid can be pET vector such as pET22b, pET24a, pET28a, or pSH plasmid, pRSFDuet plasmid or other vectors.

[0013] Further, the present application provides a microorganism for expressing the above-mentioned cytochrome P450BM3 mutant, preferably the microorganism is a transformant transformed with the above-mentioned plasmid.

[0014] The microorganism can be selected from the group consisting of Escherichia coli, Bacillus subtilis, Pichia pastoris, Saccharomyces cerevisiae, preferably Escherichia coli, and more preferably Escherichia coli BL21(DE3).

[0015] As an optional embodiment, the microorganism can be in the form of a bacterial cell or a cell disruption product thereof.

[0016] In addition, the present application also provides the use of the microorganism in preparing 7β-hydroxy nandrolone.

[0017] Further, the acid de is converted into 7β-hydroxy nandrolone under the action of mutant LG-23, the dehydrogenase and the reductase.

[0018] Further, the Escherichia coli cell expressing mutant LG-23 and dehydrogenase is resuspended with a buffer, and the acid de, the cofactor NADP+ , isopropanol or glucose, and the reaction is completed under the condition of 20-30 DEG C; after the acid is completely converted into 7beta-hydroxy acid, Escherichia coli cells expressing 17beta-HSD enzyme or a mutant thereof are added, and after 7beta-hydroxy acid is completely converted into 7beta-hydroxynolone, ethyl acetate is added to extract the reaction solution to obtain an ethyl acetate extract; the ethyl acetate extract is dehydrated by anhydrous sodium sulfate, is filtered, and is concentrated under reduced pressure to obtain 7beta-hydroxynolone.

[0019] Further, after 7beta-hydroxynolone is generated, a two-step or one-step chemical reaction is further included to prepare 6(7)-dehydro-nolone acetate.

[0020] The two-step method for preparing 6(7)-dehydro-nolone acetate is as follows: 7beta-hydroxynolone is dissolved in chloroform, and then p-toluenesulfonic acid monohydrate is added; after the reaction is completed, saturated sodium carbonate aqueous solution is added to terminate the reaction; the reaction solution is extracted with chloroform to obtain a chloroform extract; the chloroform extract is dehydrated by anhydrous sodium sulfate, is filtered, and is concentrated under reduced pressure; column chromatography is used for separation, purification, concentration and drying to obtain 6(7)-dehydro-nolone; then 6(7)-dehydro-nolone is dissolved in dichloromethane, dimethylaminopyridine and acetic anhydride are added, the reaction is completed, saturated Na2CO3 solution is used to terminate the reaction, the layers are separated, and the organic layer is collected; anhydrous Na2SO4 is added for drying, then the organic phase is dried by rotary evaporation, isopropanol is added for slurry, and cooling crystallization is performed; the slurry is filtered and is dried to obtain the solid product of dehydro-nolone acetate.

[0021] The one-step method for preparing 6(7)-dehydro-nolone acetate is as follows: 7beta-hydroxynolone is dissolved in dichloromethane, dimethylaminopyridine and acetic anhydride are added until the substrate is completely converted; after the reaction is completed, the reaction solution is washed with saturated sodium carbonate solution; dichloromethane is used to extract the washing solution, the organic phase is collected, and then extraction is performed; the organic phases are combined, anhydrous Na2SO4 is added for drying, then the organic phase is dried by rotary evaporation, isopropanol is added for slurry, and cooling crystallization is performed; the slurry is filtered and is dried to obtain the solid product of 6(7)-dehydro-nolone acetate.

[0022] The present application further provides a cytochrome P450BM3 mutant, which is mutant LG-23, and the amino acid sequence of the mutant LG-23 is shown in SEQ ID NO: 3.

[0023] Compared with the prior art, the beneficial effects of the present application include: the present application finds that mutant LG-23 has the effect of catalyzing 7beta hydroxylation of acid removal, which can be applied to the synthesis of dehydrotestosterone acetate. From the starting material of cheap and readily available acid removal, the combination of cytochrome P450BM3 mutant and dehydrogenase mutant can generate 7beta hydroxy acid removal through acid removal, and then catalyze the acid removal to generate 7beta-hydroxy nandrolone by one-pot two-step method combined with reductase. The dehydrogenase is used for regenerating the cofactor NADPH, and further combined with the chemical catalytic reaction to generate dehydrotestosterone acetate. That is, the present application provides a method for synthesizing dehydrotestosterone acetate by combining biological enzyme catalysis and chemical catalysis. The method not only simplifies the synthesis steps of the drug, significantly improves the catalytic selectivity, reduces the by-products and improves the yield, and the reaction conditions are mild, the cost is low, the method is green, environmental protection and efficient, and has important application value for promoting the development process of steroid drugs. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 Figure is the HPLC analysis result graph of mutant LG-23 catalyzed acid removal or 7beta hydroxylation of nandrolone in the embodiment 1 of the present application;

[0025] Figure 2 Figure is the optimization result graph of hydroxylation and reduction reaction conditions in the one-pot two-step method of the present application;

[0026] Figure 3 Figure is the reaction process and detection result graph of the whole cell of E. coli co-expressing P450BM3-LG-23 and 17beta-HSDcl or its mutant catalyzing acid removal to convert into 7-hydroxynandrolone in the embodiment 2 of the present application;

[0027] Figure 4 Figure is the reaction flow chart of the present application for generating dehydrotestosterone acetate by combining biological enzyme catalysis and chemical catalysis in the embodiment 3 of the present application. DETAILED DESCRIPTION

[0028] The present detailed description provides a primer pair, the nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID NO: 2.

[0029] The cytochrome P450BM3 mutant is obtained by amplifying the primer pair, the cytochrome P450BM3 mutant is mutant LG-23, and the amino acid sequence of the mutant LG-23 is shown in SEQ ID NO: 3.

[0030] The present embodiment also provides a vector comprising a cytochrome P450 mutant gene and a dehydrogenase gene; the cytochrome P450 mutant includes but is not limited to P450BM3 mutant LG-23; and the mutant LG-23 is used as an example in the embodiments of the present application. In some embodiments, the dehydrogenase gene comprises one or both of isopropanol dehydrogenase and glucose dehydrogenase; and in some embodiments, the vector further comprises a reductase, which is a 17β-HSD enzyme and / or a mutant of the 17β-HSD enzyme. Further, the mutant of the 17β-HSD enzyme is selected from the group consisting of mutant 17β-HSDcl / H164W, 17β-HSDcl / H164G, 17β-HSDcl / T212A, 17β-HSDcl / V161G, and 17β-HSDcl / V161G / H164W. 17β-HSDcl / V161G means that the amino acid of 17β-HSDcl is mutated from V to G, 17β-HSDcl / H164W means that the amino acid of 17β-HSDcl is mutated from H to W, and so on. It is to be noted that 17β-HSDcl / V161G / H164W means that the amino acid of 17β-HSDcl is simultaneously mutated from V to G and from H to W.

[0031] In addition, the present embodiment also provides a microorganism for expressing the vector comprising the cytochrome P450 mutant gene and the dehydrogenase gene, and the microorganism is selected from the group consisting of Escherichia coli, Bacillus subtilis, Pichia pastoris, and Saccharomyces cerevisiae, preferably Escherichia coli, and more preferably Escherichia coli BL21(DE3).

[0032] In addition, the present embodiment also provides a microorganism for expressing the vector further comprising the reductase, and the microorganism is selected from the group consisting of Escherichia coli, Bacillus subtilis, Pichia pastoris, and Saccharomyces cerevisiae, preferably Escherichia coli, and more preferably Escherichia coli BL21(DE3).

[0033] In addition, the present embodiment also provides the use of the microorganism in catalyzing the 7β-hydroxylation of a steroid compound; and the steroid compound is oxandrolone or nandrolone. Under the action of the mutant LG-23 and the dehydrogenase, the oxandrolone or nandrolone is converted into 7β-hydroxy oxandrolone or 7β-hydroxy nandrolone.

[0034] Further, the present embodiment provides a plasmid comprising the above-mentioned coding gene. The plasmid can be a pET vector such as pET22b, pET24a, pET28a, or a pSH plasmid, a pRSFDuet plasmid, or other vectors.

[0035] Further, the present embodiment provides a microorganism for expressing the above-mentioned cytochrome P450BM3 mutant, and preferably the microorganism is a transformant transformed with the above-mentioned plasmid.

[0036] The microorganism can be selected from the group consisting of Escherichia coli, Bacillus subtilis, Pichia pastoris, Saccharomyces cerevisiae, preferably Escherichia coli, and more preferably Escherichia coli BL21 (DE3).

[0037] As an alternative embodiment, the microorganism can be in the form of a bacterial cell or a cell disruption product thereof.

[0038] In addition, the present embodiment also proposes the use of the microorganism in the preparation of 7β-hydroxy nandrolone.

[0039] Further, the acid desorption is subjected to the action of the mutant LG-23, dehydrogenase and reductase to generate 7β-hydroxy nandrolone.

[0040] Further, the Escherichia coli cells expressing the mutant LG-23 and dehydrogenase are resuspended with a buffer, acid desorption, cofactor NADP + isopropanol or glucose, and the reaction is completed at 20-30°C. After the acid desorption is completely converted into 7β-hydroxy acid desorption, the Escherichia coli cells expressing 17β-HSD enzyme or its mutant are added, and after the 7β-hydroxy acid desorption is completely converted into 7β-hydroxy nandrolone, ethyl acetate is added to extract the reaction solution to obtain an ethyl acetate extract. The ethyl acetate extract is dehydrated with anhydrous sodium sulfate, suction filtered, and concentrated under reduced pressure to obtain 7β-hydroxy nandrolone.

[0041] Further, after the 7β-hydroxy nandrolone is generated, a two-step or one-step chemical reaction is further included to prepare 6(7)-dehydro nandrolone acetate:

[0042] The two-step method for preparing 6(7)-dehydro nandrolone acetate: 7β-hydroxy nandrolone is dissolved in chloroform, and then p-toluenesulfonic acid monohydrate is added. After the reaction is completed, saturated sodium carbonate aqueous solution is added to terminate the reaction. The reaction solution is extracted with chloroform to obtain a chloroform extract, which is dehydrated with anhydrous sodium sulfate, suction filtered, and concentrated under reduced pressure. After column chromatography separation, purification, concentration and drying, 6(7)-dehydro nandrolone is obtained. Then, 6(7)-dehydro nandrolone is dissolved in dichloromethane, dimethylaminopyridine and acetic anhydride are added, and after the reaction is completed, saturated Na2CO3 solution is added to terminate the reaction. The organic layer is collected after separation. Anhydrous Na2SO4 is added for drying, and then the organic phase is rotary evaporated to dryness. Isopropyl ether is added to pulp, cooled to crystallize, suction filtered, and dried to obtain the solid product of dehydro nandrolone acetate;

[0043] One-step preparation of 6(7)-dehydro-norlutenone acetate: 7β-hydroxynorlutenone is dissolved in dichloromethane, dimethylaminopyridine and acetic anhydride are added until the substrate is completely converted; after the reaction is completed, the reaction solution is washed with saturated sodium carbonate solution; dichloromethane is used to extract the washing solution, the organic phase is collected, then extracted, the organic phases are combined, anhydrous Na2SO4 is added for drying, then the organic phase is rotary evaporated, isopropyl ether is added to slurry, cooled to crystallize, suction filtered, and dried to obtain 6(7)-dehydro-norlutenone acetate solid product.

[0044] The embodiment further provides a cell comprising the vector.

[0045] In order to make the objects, technical solutions and advantages of the present application clearer, the present application will be further described in detail below in combination with the drawings and examples. It should be understood that the specific examples described herein are only used to explain the present application and do not limit the present application.

[0046] Example 1 Verification of the function of P450BM3 enzyme mutant LG-23

[0047] This example is based on the P450BM3 enzyme mutant LG-23 (Li A, Acevedo-Rocha C G, D'Amore L, et al. Regio- and Stereoselective Steroid Hydroxylation at the C7-Position by Cytochrome P450 Monooxygenase Mutants [J]. Angewandte Chemie International Edition, 2020) known in the prior art, which has steroid 7β hydroxylation activity, and uses the plasmid vector pRSFDuet-LG-23 expressing mutant LG-23. The above obtained plasmid pRSFDuet-LG-23 is transformed into E. coli BL21 competent cells, and after 1 h of recovery in culture medium, it is uniformly coated on a solid LB plate containing 50 μg / mL kanamycin, and an E. coli BL21 glycerol tube containing LG-23 stored at -80°C is streaked on a solid LB plate containing 50 μg / mL kanamycin, and incubated at 37°C overnight. Single colonies are selected into 2 mL of liquid LB medium containing 50 μg / mL kanamycin, and incubated at 37°C overnight with shaking. 500 μL of bacterial solution is inoculated into a 100 mL flask containing 50 mL of TB medium, and incubated at 37°C with shaking at 220 rpm. When the absorbance OD600 of the culture solution reaches 0.6-0.8, 0.5 mM IPTG is added to induce expression, and the culture is incubated at 37°C with shaking at 220 rpm for 4-6 h. The culture is centrifuged at 6000 rpm for 10 min, and the supernatant is discarded. The bacterial pellet is resuspended in 1 mL of 50 mM Tris-HCl buffer (pH 7.4) containing 10 mM MgSO4, and then sonicated for 10 min to obtain a bacterial lysate. The bacterial lysate is centrifuged at 12,000 rpm for 10 min, and the supernatant is collected. The supernatant is used as the crude enzyme solution for the following experiments. 600When the OD600 reached 0.8, IPTG was added to a final concentration of 0.2 mM to induce expression, and the induction temperature was 25 °C for 16-20 h. The culture was centrifuged at 4000 rpm, 4 °C for 10 min, and the cells were collected and washed once with 100 mM potassium phosphate buffer (pH 8.0), and the cells were stored at -80 °C.

[0048] The cells were resuspended in 50 mL centrifuge tubes with 10 mL of 100 mM potassium phosphate buffer (pH 8.0) (5% glycerol, 1% isopropanol, isopropanol dehydrogenase, 0.1 mM NADP + ) and immediately frozen in liquid nitrogen. Then it was placed in water to thaw at room temperature, and after melting, 5 mL of bacterial suspension was taken in a 100 mL flask, 250 uL of steroid substrate stock solution (100 mM stock solution prepared with 22% cyclodextrin solution) was added, and the reaction was carried out at 25 °C, 220 rpm for 6 hours. Intervals were sampled, and the reaction solution was extracted with an equal volume of methanol, high-speed centrifuged for 1 min, and the supernatant was filtered with a 0.22 μm filter membrane into an injection bottle, and the conversion rate and product distribution of the reaction were detected by HPLC.

[0049] The chromatographic column was ZORBAX SB C18 (250 x 4.6 mm) column, the mobile phase was acetonitrile / ultra-pure water: 2 min (10:90), 2-15 min (70:20), 15-17 min (10:90); the column temperature was 40 °C, the flow rate was 1.5 mL / min, and the injection volume was 10 uL. The UV detection wavelength of acid dehydrotestosterone and hydroxylated products was 250 nm.

[0050] The data of P450BM3 mutant LG-23 catalyzing the 7β-hydroxylation of acid dehydrotestosterone at a concentration of 5 mM (1.36 g / L) are shown in Table 1, and the HPLC analysis results are shown in Figure 1 .

[0051] Table 1 Mutants LG-23 and LG-23 / T438S catalyze the 7β-hydroxylation of steroids

[0052]

[0053] According to Figure 1 , the equations of P450BM3 mutant LG-23 catalyzing the C7-hydroxylation of acid dehydrotestosterone are shown in (1) and (2), respectively.

[0054]

[0055] According to the results of Table 1, mutant LG-23 has a 95% selectivity for the C7 hydroxylation of the acid-degraded. For nandrolone, mutant LG-23 has a 60% selectivity for the 7 hydroxylation. The results show that mutant LG-23 has an excellent conversion rate for catalyzing the 7 hydroxylation of steroids, and can be used to synthesize dehydro-nandrolone acetate from dehydrogenated nandrolone acetate.

[0056] Example 2 Construction of recombinant plasmid for co-expression of LG23 and isopropanol dehydrogenase and construction of recombinant plasmid for expression of 17β-HSDcl

[0057] Although LG-23 can be directly used to catalyze the 7β-hydroxylation of nandrolone to generate 7β-hydroxynandrolone, which can then be used to synthesize dehydro-nandrolone acetate by using a two-step chemical method or a one-pot two-step chemical method, it is considered that LG23 has a higher selectivity for the acid-degraded, and the acid-degraded is more inexpensive than nandrolone. Therefore, in combination with 17β-hydroxysteroid dehydrogenase (17β-HSD) which can reduce the 17-ketone of steroids to a hydroxyl group, dehydrogenated nandrolone acetate can be generated from the more inexpensive and readily available acid-degraded by using mutant LG-23 and 17β-HSD or mutant thereof in a one-pot method, and isopropanol dehydrogenase can be used for the regeneration and circulation of cofactor NADPH.

[0058] The isopropanol dehydrogenase is mutant IPADHM4 from Brucella suis, and its catalytic equation is shown in equation (3):

[0059]

[0060] In order to catalyze the acid-degraded to generate 7β-hydroxynandrolone, the genes of the above three enzymes can be cloned and expressed in a host to realize the catalysis and conversion of the substrate by using multiple cell systems; or the mutant LG-23 enzyme gene, the isopropanol dehydrogenase gene and the 17β-HSDcl enzyme gene can be transferred into the same host cell to make them co-expressed, so as to realize the catalysis and conversion of the substrate by using a single cell system; or the mutant LG-23 enzyme gene and the isopropanol dehydrogenase gene can be transferred into the same host cell to make them co-expressed, and the 17β-HSDcl enzyme or mutant thereof gene is expressed alone, so as to realize the catalysis and conversion of the substrate by using two cell systems.

[0061] 1. Construction method of recombinant expression vector for co-expression of LG-23 enzyme and isopropanol dehydrogenase

[0062] The gene encoding isopropanol dehydrogenase and the plasmid vector pRSFDuet-LG-23 obtained in Example 1 are PCR amplified using primers containing 20 bp homologous ends (the RBS sequence is located therein) to linearize them. Then the isopropanol dehydrogenase gene and the linearized vector are connected together by forming 20 bp cohesive ends under the action of T5 exonuclease. First, the primers containing the homologous ends are designed.

[0063] Linearization vector pRSFDuet-LG-23 primers are as follows:

[0064] Upstream primer: 5'-TAACCTAGGCTGCTGCCACCGC-3'; downstream primer: 5'-GATATATCTCCTTAGGTACCTTACCCAGCCCACACGTC-3';

[0065] The linearization vector pRSFDuet-LG-23 is obtained by conventional PCR amplification;

[0066] Isopropanol dehydrogenase gene fragment amplification primers are as follows:

[0067] Upstream primer:

[0068] GGTACCTAAGGAGATATATCATGCGCTTTAAAGATAAGGTTGTGATTGT -

[0069] Downstream primer:

[0070] 5'-GGTGGCAGCAGCCTAGGTTATTACTGGGCGGTATAGCCACCATC -3';

[0071] The isopropanol dehydrogenase gene fragment is obtained by conventional PCR amplification.

[0072] The fragment size and purity of the PCR product are confirmed by agarose gel electrophoresis, and the target nucleic acid fragment is recovered by agarose gel electrophoresis. The concentration and purity of the recovered nucleic acid sample are detected by a microspectrophotometer. The recovered isopropanol dehydrogenase gene fragment and plasmid vector fragment are ligated using T5 exonuclease, specifically: in a 5 μL reaction system, the target fragment and linearized vector are added in a molar ratio of 3:1 (the amount of linearized vector is controlled at 30-50 ng), 0.5 μL T5 exonuclease and 1 μL NE buffer are added, and sterile distilled water is added to 5 μL. After adding T5 exonuclease, strictly time for 5 min, immediately after the time, 50 μL E. coli DH5α competent cells are added and transformed according to the basic steps of conventional transformation, and the culture medium is recovered for 1 h and then uniformly coated on a solid LB plate containing 50 μg / mL kanamycin. After overnight culture at 37°C, single colonies are selected and cultured in 3 mL of LB liquid medium containing 50 μg / mL kanamycin, and then sent to a sequencing company for sequencing to obtain the correct recombinant plasmid, which is named: pRSFDuet-LG-23_IPADHM4.

[0073] 2. Functional verification of co-expression recombinant plasmid

[0074] The recombinant plasmid pRSFDuet-LG-23_IPADHM4 was transformed into E. coli BL21 competent cells, and after 1 h of recovery in culture medium, it was uniformly coated on solid LB plates containing 50 μg / mL kanamycin and incubated at 37°C overnight. 500 μL of bacterial solution was inoculated into a 100 mL flask containing 50 mL of TB medium and incubated at 37°C, 220 rpm. When the absorbance OD 600 of the culture solution reached 0.8, IPTG was added to a final concentration of 0.2 mM to induce expression, the induction temperature was 25°C, and the induction time was 16-20 h. The culture solution was centrifuged at 4000 rpm, 4°C for 10 min, the cells were collected, and washed once with 100 mM potassium phosphate buffer (pH 8.0), and the cells were stored at -80°C.

[0075] The cells were resuspended in a 50 mL centrifuge tube with 100 mM potassium phosphate buffer (pH 8.0, 5% glycerol, 1% isopropanol), OD 600 =20-30, and immediately frozen in liquid nitrogen. Then it was placed in water at room temperature to thaw, and 5 mL of bacterial suspension was taken in a 100 mL flask, 250 uL of steroid substrate mother liquor (100 mM mother liquor prepared with 22% cyclodextrin solution) was added, and the reaction was carried out at 25°C, 220 rpm for 6 h. Intervals were taken for sampling, and the reaction solution was extracted with an equal volume of methanol, centrifuged at high speed for 1 min, and the supernatant was filtered with a 0.22 μm filter membrane into a sample bottle. The conversion rate and product distribution of the reaction were detected by HPLC. The reaction process and detection results of the whole cell catalysis of E. coli co-expressing P450BM3-LG-23 and IPADHM4 to convert acid des to 7β-hydroxy acid des are shown in Figure 1 .

[0076] The results show that when the reaction time reaches 3 h, the substrate acid des has been completely converted to 7-hydroxy acid des, and the product accounts for 96%.

[0077] Example 3 Construction and functional verification of 17β-HSDcl enzyme mutants

[0078] 1. Site-directed mutagenesis of 17β-HSDcl

[0079] The present embodiment is based on the steroid 17-position carbonyl reductase gene (17β-HSDcl) known in the prior art, which is derived from Curvularia lunata (Fernandez Cabezon L, Galan B, Garcia J L. Engineering Mycobacterium smegmatis for testosterone production [J]. Microbial Biotechnology, 2017, 10(1): 151-61.) and uses the plasmid vector pRSFDuet-17β-HSDcl expressing mutant 17β-HSDcl as a template. The gene of mutant 17β-HSDcl is subjected to site-directed mutagenesis by primer PCR mutagenesis technology, and the 161st valine is mutated to glycine; the 164th histidine is mutated to glycine or tryptophan; and the 212th tyrosine is mutated to alanine. A pair of primers is designed for the mutation site, and the plasmid vector pRSFDuet-17β-HSDcl is already available in the unit.

[0080] wherein 17β-HSD is a steroid 17β-hydroxysteroid dehydrogenase 17β-HSDcl enzyme from Cochliobolus lunatus, which catalyzes the equation as shown in (4) or (5):

[0081]

[0082]

[0083] The present embodiment takes mutant 17β-HSDcl / V161G as an example, and provides a mutation primer that can be used when obtaining mutant 17β-HSDcl / V161G by site-directed mutagenesis:

[0084] Upstream primer: AAGGACTTCTCGGGTCCGAAGCACTC; downstream primer: GGTGGCAGCAGCCTAGGTTATTAGGCGGCGCCGCCGTCCA

[0085] The PCR system (20 μL) is as follows: 0.1-1 ng of template, 1 μL (10 μM) of each mutant primer, 5 μL of Prime STAR Max DNA polymerase, and sterilized distilled water to 20 μL.

[0086] PCR reaction procedure is as follows: (1) pre-denaturation at 98°C for 3 min; (2) denaturation at 98°C for 10 sec, (3) annealing at 56°C for 15 sec, (4) elongation at 72°C for 20 sec, steps (2)-(4) are repeated for 28 cycles, and finally elongation at 72°C for 5 min, and preservation at 8°C.

[0087] The PCR product obtained by amplification is detected by 0.7% agarose gel electrophoresis, and a band with a length equivalent to that of the 17β-HSDcl gene is observed, thus judging that the gene encoding the mutant of interest has been amplified. Therefore, the restriction endonuclease Dpn I is directly added to the PCR product, and after 3-5 h of digestion at 37°C, the competent cells of E. coli BL21 (DE3) are transformed, and after 1 h of recovery in culture medium, they are uniformly spread on solid LB plates containing 50 μg / mL kanamycin. After overnight culture at 37°C, single colonies are selected and cultured in 3 mL of LB liquid medium containing 50 μg / mL kanamycin, and then sent to a sequencing company for sequencing to obtain the correct mutant, which is named 17β-HSDcl / V161G.

[0088] 2. Function verification

[0089] According to the cell culture method in Example 1, 17β-HSDcl / V161G is cultured and induced. The cells are resuspended in a 50 mL centrifuge tube with 10 mL of 100 mM potassium phosphate buffer at pH 8.0 (containing 5% glucose, 5% glycerol, 0.5 mM NADP+, and 10 U GDH), and immediately frozen in liquid nitrogen. Then it is placed in water at room temperature to thaw until it melts, and 5 mL of bacterial suspension is taken in a 50 mL flask, 50 uL of steroid substrate stock solution (prepared in DMF to a 100 mM stock solution) is added, and the reaction is carried out at 25°C and 220 rpm for 5 hours. Sample at intervals, extract the reaction solution with an equal volume of methanol, centrifuge at high speed for 3 min, filter through a 0.22 μm filter into a sample bottle, and detect the conversion rate and product distribution of the reaction by HPLC.

[0090] Table 2. Steroid C17 reduction reactions of different 17β-HSDcl mutants

[0091]

[0092] According to the results in Table 2, the mutant 17β-HSDcl / V161G has good activity on 7β-hydroxy acid dehydrogenation, and the conversion rate of 7β-hydroxy acid dehydrogenation reaches 98% within one hour, compared with 70% conversion rate of 17β-HSDcl on 7β-hydroxy acid dehydrogenation (5 mM). The results show that the mutant 17β-HSDcl / V161G has relatively better effect on catalyzing the reduction of steroid C17 position. Subsequently, the mutant 17β-HSDcl / V161G is taken as an example to synthesize dehydrochloromethyltestosterone acetate. Before setting the reaction time to 1 hour, we also explore different reaction times of different 17β-HSDcl mutants, and optimize the reaction conditions, and the results are shown in Table 3. Figure 2 The sequence table of 17β-HSDcl, 17β-HSDcl / V161G, 17β-HSDcl / H164G, 17β-HSDcl / H164W and 17β-HSDcl / Y212A is shown as SEQ ID NO: 4-8.

[0093] Example 4 Synthesis of dehydrochloromethyltestosterone acetate

[0094] This example uses biological enzyme catalysis and chemical catalysis to generate dehydrochloromethyltestosterone acetate. First, the product enzyme catalyzes acid dehydrogenation to generate 7β-hydroxytestosterone, then chemical dehydration is used to generate dehydrochloromethyltestosterone acetate, and finally dehydrochloromethyltestosterone and acetic anhydride are subjected to esterification reaction to obtain dehydrochloromethyltestosterone acetate, and the reaction process is shown in Figure 3 .

[0095] Combining Figure 4 , the specific experimental process includes:

[0096] 1. Hydroxylation / reduction reaction

[0097] The whole cell of E. coli co-expressing LG-23 and isopropanol dehydrogenase obtained by culturing in Example 2 is resuspended with 1 L of 100 mM potassium phosphate buffer at pH 8.0 (OD600= 1.0), and then 1.0 g of 7β-hydroxytestosterone is added. The reaction is carried out at 30°C for 1 hour, and then the reaction is stopped by adding 1 mL of 0.5 M sodium pyruvate. 600To 5 L reaction flask, 1.0 g 7β-hydroxynorlone, 0.5 g 4- dimethylaminopyridine (DMAP), 0.5 g acetic anhydride, 10 mL isopropyl alcohol, 25 °C, 500 rpm stirring. After 3 h, TLC analysis showed that the starting material was completely reacted. Then, 1 L ethyl acetate was added to extract the reaction mixture three times. The combined ethyl acetate extracts were dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was then purified by silica gel column chromatography. The collected fractions were concentrated under reduced pressure to obtain 1.05 g of dehydro-norlone acetate.

[0098] 2. Two-step synthesis of dehydro-norlone acetate

[0099] Dehydration reaction:

[0100] To 10 mL chloroform, 1.0 g 7β-hydroxynorlone, 0.66 g p-toluenesulfonic acid monohydrate (1.0 eq), 35 °C, stirring for 4 h. TLC analysis showed that the starting material was completely reacted. Then, 10 mL saturated Na2CO3 solution was added to terminate the reaction. The organic layer was collected, and the aqueous layer was extracted with 15 mL chloroform twice. The combined organic layers were dried over anhydrous Na2SO4, and then concentrated under reduced pressure. The residue was then purified by silica gel column chromatography to obtain 0.90 g of dehydro-norlone.

[0101] Esterification reaction:

[0102] To 15 mL dichloromethane, 1.0 g dehydro-norlone, 0.05 g 4-dimethylaminopyridine (DMAP), 0.56 g acetic anhydride (1.5 eq), 35 °C, stirring for 3 h. TLC analysis showed that the starting material was completely reacted. Then, 15 mL saturated Na2CO3 solution was added to terminate the reaction. The organic layer was collected, and the aqueous layer was extracted with 15 mL dichloromethane twice. The combined organic layers were dried over anhydrous Na2SO4, and then concentrated under reduced pressure. The residue was then added to 2.5 g isopropyl ether to form a slurry, cooled to crystallize, filtered, and dried to obtain 1.05 g of dehydro-norlone acetate solid product.

[0103] 3. One-step synthesis of dehydro-norlone acetate

[0104] 1.0 g 7β-hydroxy deca-nortestosterone was dissolved in 15 mL dichloromethane, 0.05 g dimethylamino pyridine (DMAP) and 0.88 g acetic anhydride (2.5 eq) were added, the reaction was carried out at room temperature, TLC (developing agent, petroleum ether: acetone = 7:3) was used to monitor the reaction progress until the substrate was completely converted. After the reaction was completed, the reaction solution was washed with 15 mL saturated sodium carbonate solution. 15 mL dichloromethane was used to extract the washing solution, the organic phase was collected, extracted twice repeatedly, the organic phases were combined, dried with anhydrous Na2SO4, then the organic phase was evaporated, 2.5 g isopropyl ether was added to slurry, cooled to crystallize, filtered, and dried to obtain 6(7)-dehydrotestosterone acetate solid product 0.98 grams.

[0105] The specific embodiments of the application described above do not constitute a limitation of the protection scope of the application. Any other corresponding changes and modifications made according to the technical concept of the application should be included in the protection scope of the claims of the application.

Claims

1. A mutant of the 17β-HSDcl enzyme, characterized in that, The mutant of the 17β-HSD enzyme is selected from the group consisting of mutant 17β-HSDcl / V161G, 17β-HSDcl / H164G, 17β-HSDcl / H164W, 17β-HSDcl / Y212A; the amino acid sequences of the mutant 17β-HSDcl / V161G, 17β-HSDcl / H164G, 17β-HSDcl / H164W and 17β-HSDcl / Y212A are shown in SEQ ID NO: 5-8, respectively.

2. A vector, characterized in that, The gene comprises a gene encoding a dehydrogenase and a reductase, wherein the dehydrogenase is one or both of isopropanol dehydrogenase and glucose dehydrogenase; and the reductase is any mutant of claim 1.

3. A microorganism comprising the vector of claim 2, wherein, The microorganism is selected from the group consisting of Escherichia coli, Bacillus subtilis, Pichia pastoris, and Saccharomyces cerevisiae.

4. The microorganism of the carrier according to claim 3, characterized in that, The microorganism is Escherichia coli BL21 (DE3).

5. Use of a microorganism according to claim 3 or 4 for catalysing the 7β-hydroxylation of a steroid compound, characterised in that, The steroid compound is stanozolol; under the action of the mutant LG-23, the microorganism for expression vector of claim 3 or 4, and the dehydrogenase, the stanozolol is converted into 7β-hydroxystanozolol.

6. Use of a microorganism according to claim 5 for the preparation of 7β-hydroxynorprogesterone, characterized in that, The acid-deoxy under the action of mutant LG-23, dehydrogenase, generates 7β-hydroxy acid-deoxy; further, the E. coli cells expressing mutant LG-23 and dehydrogenase are resuspended with buffer, and then isopropanol or glucose is added, acid-deoxy, cofactor NADP + is added, and the reaction is completed at 20-30°C. After the acid-deoxy is completely converted into 7β-hydroxy acid-deoxy, E. coli cells expressing 17β-HSDcl enzyme or its mutant are added, and the reaction is completed at 20-30°C. After ethyl acetate is added to extract the reaction solution, ethyl acetate extract is obtained. The ethyl acetate extract is dehydrated with anhydrous sodium sulfate, suction filtered, and concentrated under reduced pressure to obtain 7β-hydroxy acid-deoxy.

7. Use according to claim 6, characterized in that, After the 7β-hydroxystanozolol is generated, a two-step or one-step chemical reaction is further included to prepare 6(7)-didehydrostanozolol acetate; The two-step method for preparing 6(7)-didehydrostanozolol acetate includes: dissolving the 7β-hydroxystanozolol in chloroform, then adding p-toluenesulfonic acid monohydrate, and after the reaction is completed, adding saturated sodium carbonate aqueous solution to terminate the reaction; extracting the reaction solution with chloroform to obtain a chloroform extract, dehydrating with anhydrous sodium sulfate, suction filtering, concentrating under reduced pressure, and then column chromatography separation, purification and concentration drying to obtain 6(7)-didehydrostanozolol; then dissolving the 6(7)-didehydrostanozolol in dichloromethane, adding dimethylaminopyridine and acetic anhydride, and after the reaction is completed, using saturated Na2CO3 solution to terminate the reaction, separating the layers, and collecting the organic layer; adding anhydrous Na2SO4 to dry, then rotary evaporating the organic phase to dryness, adding isopropyl ether to pulp, cooling and crystallizing, suction filtering, and drying to obtain the solid product of didehydrostanozolol acetate; The one-step method for preparing 6(7)-didehydrostanozolol acetate includes: dissolving the 7β-hydroxystanozolol in dichloromethane, adding dimethylaminopyridine and acetic anhydride until the substrate is completely converted; after the reaction is completed, washing the reaction solution with saturated sodium carbonate solution; extracting the washing solution with dichloromethane, collecting the organic phase, and then extracting and combining the organic phases, adding anhydrous Na2SO4 to dry, then rotary evaporating the organic phase to dryness, adding isopropyl ether to pulp, cooling and crystallizing, suction filtering, and drying to obtain the solid product of 6(7)-didehydrostanozolol acetate.

Images