High pH-tolerant glucose dehydrogenase mutant and its application
By performing site-directed mutagenesis on glucose dehydrogenase, a mutant with high pH tolerance was prepared, which solved the problem of insufficient catalytic reaction efficiency of glucose dehydrogenase under different pH conditions and achieved efficient application in a wide pH range.
Patent Information
- Application Number
- CN202411254902.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-09
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2044-09-09
AI Technical Summary
The existing glucose dehydrogenase has insufficient catalytic reaction efficiency and stability under different pH conditions, which limits its application in fields such as biopharmaceuticals.
By performing site-directed mutagenesis on glucose dehydrogenase from Bacillus sphaericus, four mutants, G28V/A55N, G28V/A55M, V72L/L122M and L122V, were prepared to improve their enzyme activity in different pH ranges.
The mutant maintains high enzyme activity in the pH range of 5.0-12.0, improves the production efficiency of D-gluconic acid and NADH, and is suitable for the food and pharmaceutical industries.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The invention relates to a glucose dehydrogenase mutant, in particular to a pH stress-resistant glucose dehydrogenase mutant and a preparation method thereof, and belongs to the field of protein engineering. Background Art
[0002] Glucose dehydrogenase (GDH) is an oxidoreductase that is widely present in nature. GDH mainly catalyzes the oxidation reaction of glucose, converting glucose into gluconic acid and hydrogen ions. This process not only involves the oxidation of glucose, but also involves the transfer of electrons. The generated hydrogen ions can react with the oxidized coenzyme NAD. + or NADP + GDH combines with the reduced coenzyme NADH or NADPH, forming a cofactor regeneration cycle. Therefore, GDH is used in drug development. For example, in the manufacture of chiral cerebrospinal fluid inhibitors, GDH acts as a coenzyme for imine reductase to form the NAD(P)H cycle. Furthermore, GDH has a wide range of applications in industries such as prodrug screening, biomarker detection, food safety, biosensors, and biofuel cells.
[0003] Despite its applications in numerous fields, GDH's activity as a biocatalyst is limited by its specific catalytic environment, including metal ions, cofactors, and pH. For example, in drug quality control and testing, pH can vary significantly depending on the properties of different solutions and samples. Existing GDH can tolerate a limited pH range, failing to maintain good catalytic reaction efficiency and stability at high or low pH levels, thus limiting its application in biopharmaceutical processes. Summary of the Invention
[0004] Purpose of the invention: The purpose of the present invention is to provide a glucose dehydrogenase mutant with high pH tolerance, and to provide a nucleic acid molecule encoding the mutant, a vector or recombinant cell or product containing the mutant, and a preparation method and application of the mutant.
[0005] Technical solution: In the first aspect of the present invention, four glucose dehydrogenase mutants are provided. The amino acid sequence of the glucose dehydrogenase mutant is obtained by mutation of the sequence shown in SEQ ID NO.1, and the mutation is G28V / A55N or G28V / A55M or V72L / L122M or L122V.
[0006] Furthermore, the mutant has high pH tolerance, and the high pH tolerance includes that the mutant has higher enzyme activity at pH 5.0-12.0.
[0007] The present invention uses glucose dehydrogenase derived from Lysinibacillus sphaericus as the original enzyme, whose amino acid sequence is shown in SEQ ID No. 1 and nucleotide sequence is shown in SEQ ID No. 2. The present invention obtains the glucose dehydrogenase mutant by site-directed mutagenesis. The present invention uses standard single-letter amino acid substitution notation: G28V means that glycine (G) at position 28 of the N-terminus is replaced by valine (V); G28V / A55N means that glycine (G) at position 28 of the N-terminus is replaced by valine (V), and alanine (A) at position 55 of the N-terminus is replaced by asparagine (N).
[0008] In a second aspect, the present invention provides a nucleic acid molecule encoding the glucose dehydrogenase mutant described in the first aspect. The nucleotide sequence of the nucleic acid molecule is obtained by base mutation of the sequence shown in SEQ ID NO. 2.
[0009] In a third aspect, the present invention provides a vector comprising the nucleotide sequence described in the second aspect. The vector includes a cloning vector or an expression vector. The vector may be a plasmid or a virus.
[0010] In a fourth aspect, the present invention provides a recombinant cell comprising the vector described in the third aspect.
[0011] In a fifth aspect, the present invention provides a method for preparing the glucose dehydrogenase mutant described in the first aspect, comprising the following steps: (1) designing point mutation primers, using a plasmid containing the SEQ ID NO.2 sequence as a template, performing a PCR reaction, followed by a digestion reaction and a recombination reaction to obtain an expression vector carrying the mutant gene; (2) transferring the expression vector into a host bacterium for fermentation expression; and (3) collecting the host bacterium, disrupting the cells, and centrifuging to obtain the supernatant to obtain the glucose dehydrogenase mutant.
[0012] In a sixth aspect, the present invention provides a product comprising the glucose dehydrogenase mutant or the nucleic acid molecule or the vector or the recombinant cell.
[0013] In the seventh aspect, the present invention provides a product according to the sixth aspect in catalyzing the reaction of D-glucose and NAD + Application in generating D-gluconic acid and NADH.
[0014] Beneficial effects: Compared with the existing technology, the present invention has the following significant advantages: 1. The four glucose dehydrogenase mutants provided by the present invention have high pH tolerance. The enzyme activity of the mutants G28V / A55N, G28V / A55M and V72L / L122M in alkaline solution is better than that of the original enzyme, and the enzyme activity of G28V / A55M and L122V in acidic solution is better than that of the original enzyme; 2. The glucose dehydrogenase mutants provided by the present invention can improve the production efficiency and product quality of D-gluconic acid and NADH, can be applied to many fields such as the food industry and the pharmaceutical industry, and are conducive to the development of new technologies and methods. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 A schematic diagram of the structure of glucose dehydrogenase used in the present invention (with amino acid positions 28 and 55 highlighted);
[0016] Figure 2 A schematic diagram of the structure of glucose dehydrogenase used in the present invention (with amino acid positions 72 and 122 highlighted);
[0017] Figure 3 Schematic diagram of the enzyme activity of glucose dehydrogenase mutants in different alkaline solutions;
[0018] Figure 4 Schematic diagram of the enzyme activity of glucose dehydrogenase mutants in different acidic solutions. DETAILED DESCRIPTION
[0019] The technical solution of the present invention will be further described below with reference to the accompanying drawings.
[0020] The culture medium and components used in the embodiments of the present invention are as follows:
[0021] LB medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L;
[0022] LB solid medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, agar 15 g / L;
[0023] TB medium: yeast extract 12 g / L, tryptone 12 g / L, glycerol 4 ml / L, dipotassium hydrogen phosphate 12.5 g / L, potassium dihydrogen phosphate 2.3 g / L.
[0024] Example 1 Glucose dehydrogenase mutant G28V / A55N
[0025] In this example, the 28th glycine of the original enzyme sequence of glucose dehydrogenase shown in SEQ ID No. 1 is mutated to valine, and the 55th alanine is mutated to asparagine. The nucleic acid sequence of the original enzyme of glucose dehydrogenase is shown in SEQ ID No. 2, and the structure is shown in Figure 1 The preparation method of the mutant G28V / A55N is as follows: 1. Constructing a recombinant plasmid; 2. Expressing the enzyme mutant and preparing a crude enzyme solution. The specific method is as follows:
[0026] 1. Construction of recombinant plasmid
[0027] The original GDH enzyme gene, shown in SEQ ID No. 2, was synthesized by GenWeiZhi (Suzhou) and inserted between the NdeI and XhoI restriction sites of the pET22b plasmid. This plasmid was used as a template for the first round of point-mutation PCR. The primers are shown in Table 1, and the reaction system and procedure are shown in Tables 2 and 3.
[0028] Table 1 Primers for the first round of point mutation PCR of mutant G28V / A55N
[0029] Point mutation primer name Sequence (5'-3') G28V-F GCGCTTTGTGGAAGAAAAAGCGAAAGTTATCG G28V-R TTTCTTCACAAAGCGCAGCGCCATCGCTTTG
[0030] Table 2 Point mutation PCR system
[0031] Ingredients volume 2×ProofastMaxMasterMix 12.5μL 10 pmol / μL Forward Primer 1 μL 10 pmol / μL Reverse Primer 1 μL DNA template <50ng <![CDATA[ddH2O]]> up to 25 μL
[0032] Table 3 Point mutation PCR reaction procedures
[0033]
[0034] After PCR, the digestion reaction was performed as described in Table 4.
[0035] Table 4 Digestion reaction system
[0036] Ingredients content Point mutation PCR reaction products 25 μL DpnI 1 μL
[0037] The above reaction system was placed in a constant temperature of 37°C for 2 hours.
[0038] After the digestion reaction was completed, the recombination reaction was performed as described in Table 5.
[0039] Table 5 Recombination reaction system
[0040] Ingredients content DpnI digestion products 4μL 5×UFOBuffer 4μL UvsXase 2μL <![CDATA[ddH2O]]> up to 20 μL
[0041] The reaction system was placed in a constant temperature reaction at 37°C for 1 hour. The resulting product was a recombinant plasmid containing the designed point mutation G28V, and was sequenced by Genwi (Suzhou) Company to confirm the mutation result.
[0042] The second round of point mutation PCR was performed using the recombinant plasmid with the point mutation G28V as a template. The primers used are shown in Table 6.
[0043] Table 6 Second round PCR primers for mutant G28V / A55N
[0044] Point mutation primer name Sequence (5'-3') A55N-F GTGAAAAAAAACGGCGGCGATGCGATTGCGGTG A55N-R GCCGCCGTTTTTTTTCACGCCTTCCACCACCGCG
[0045] The PCR reaction system and reaction procedures were consistent with those in Tables 2 and 3 above. After PCR, digestion and recombination reactions were performed, and the reaction procedures and conditions were consistent with those in Tables 4 and 5 above. After the recombination reaction, the resulting product was a recombinant plasmid containing the designed point mutation G28V / A55N, and the mutation results were confirmed by sequencing by Genwi (Suzhou) Co., Ltd.
[0046] 2. Express enzyme mutants and prepare crude enzyme solution
[0047] The plasmid carrying the mutant enzyme gene was transformed into E. coli BL21(DE3) and screened using LB solid medium containing 100 μg / mL ampicillin. Positive transformants were selected and cultured overnight in LB liquid medium containing 100 μg / mL ampicillin to serve as the seed solution for fermentation. This seed solution was inoculated into a 250 mL Erlenmeyer flask containing 30 mL of TB medium at a 5% inoculum and incubated at 37°C and 200 rpm for 6-8 hours. 24 μL of 0.5 M IPTG was added to the fermentation broth, the culture temperature was adjusted to 24°C, and the culture was continued for 18 hours. After fermentation, the entire fermentation broth was collected and centrifuged at low temperature, and the supernatant was removed. The cells were resuspended in 15 mL of the appropriate buffer and sonicated for 3 minutes to disrupt the cells until the suspension was slightly clear. The cell suspension was centrifuged at 4000 g for 10 minutes, and the supernatant was used as the crude enzyme solution containing the mutant.
[0048] Example 2 Glucose dehydrogenase mutant G28V / A55M
[0049] In this example, the amino acid glycine at position 28 of the original glucose dehydrogenase sequence shown in SEQ ID No. 1 is mutated to valine, and the amino acid alanine at position 55 is mutated to methionine. The nucleic acid sequence of the original glucose dehydrogenase is shown in SEQ ID No. 2, and the structure is shown in Figure 1 The second round of point mutation primers are shown in Table 7, and the rest of the preparation method is the same as Example 1.
[0050] Table 7 Second round of point mutation PCR primers for mutant G28V / A55M
[0051] Point mutation primer name Sequence (5'-3') A55M-F GTGAAAAAAATGGGCGGCGATGCGATTGCGGTG A55M-R GCCGCCCATTTTTTTCACGCCTTCCACCACCGCG
[0052] Example 3 Glucose dehydrogenase mutant V72L / L122M
[0053] In this example, the amino acid valine at position 72 of the original glucose dehydrogenase sequence shown in SEQ ID No. 1 is mutated to leucine, and the amino acid leucine at position 122 is mutated to methionine. The nucleic acid sequence of the original glucose dehydrogenase is shown in SEQ ID No. 2, and the structure is shown in Figure 2 The first and second round point mutation primers are shown in Tables 8 and 9, and the rest of the preparation method is the same as Example 1.
[0054] Table 8: First round PCR primers for mutant V72L / L122M
[0055] Point mutation primer name Sequence (5'-3') V72L-F GAAGATCTGATTAACCTGGTGCAGACCGCG V72L-R GTTAATCAGATCTTCTTCCACGGTCACATC
[0056] Table 9 Second round PCR primers for mutant V72L / L122M
[0057] Point mutation primer name Sequence (5'-3') L122M-F GCGTTTATGGGCAGCCGCGAAGCGATTAAAT L122M-R GCTGCCCATAAACGCGCCGGTCAGGTTGGTG
[0058] Example 4 Glucose dehydrogenase mutant L122V
[0059] In this example, the amino acid leucine at position 122 of the original glucose dehydrogenase sequence shown in SEQ ID No. 1 is mutated to valine. The nucleic acid sequence of the original glucose dehydrogenase is shown in SEQ ID No. 2, and the structure is shown in Figure 2 In this example, only one point mutation was performed. The primers are shown in Table 10. The rest of the preparation method is the same as in Example 1.
[0060] Table 10 PCR primers for mutant L122M point mutation
[0061]
[0062]
[0063] Example 5 Determination of glucose dehydrogenase activity in different alkaline solutions
[0064] The method in Example 1 was used to express the original glucose dehydrogenase and prepare a crude enzyme solution.
[0065] Glucose dehydrogenase catalyzes the conversion of glucose to NAD + Based on the principle of synthesizing gluconic acid and NADH, and the specific absorption of NADH at 340 nm, the enzymatic activities of the glucose dehydrogenase mutants and the original glucose dehydrogenase from Examples 1-4 were measured in different alkaline solutions. Enzyme activity is defined as 1 nmol of NADH produced per minute per 1 mL of sample, which is defined as one unit of enzyme activity (U). The specific determination method is as follows:
[0066] Prepare different alkaline solutions: (1) 100mM Tris-HCl buffer solution, pH 8.0: Take 12.11g of Tris, add 1L of deionized water, and adjust the pH to 8.0 with 38% concentrated hydrochloric acid; (2) 100mM Tris-HCl buffer solution, pH 9.0: Take Tris 12.11 g, add 1 L of deionized water, and adjust the pH to 9.0 with 38% concentrated hydrochloric acid; (3) 100 mM, pH 10.0 glycine-sodium hydroxide buffer: take 7.51 g of glycine, add 1 L of deionized water, and adjust the pH to 10.0 with sodium hydroxide; (4) 100 mM, pH 11.0 glycine-sodium hydroxide buffer: take 7.51 g of glycine, add 1 L of deionized water, and adjust the pH to 11.0 with sodium hydroxide; (5) 100 mM, pH 12.0 glycine-sodium hydroxide buffer: take 7.51 g of glycine, add 1 L of deionized water, and adjust the pH to 12.0 with sodium hydroxide.
[0067] Preheat the microplate reader for 30 minutes, use the endpoint method, adjust the wavelength to 340nm, and adjust to zero with deionized water. Add 100μL of 20mM glucose solution, 100μL of 20mM NAD solution, and 50μL of crude enzyme solution to the 96-well microplate, respectively, and place in a 30°C water bath. Immediately start the reaction and measure the absorbance of the reaction solution at 340nm at the beginning of the reaction and 10 minutes of reaction, respectively, and record it as A0 and A1. The difference between the two measured values represents the amount of NADH generated by the GDH enzymatic reaction, recorded as ΔA. GDH enzyme activity is defined as the production of 1 nmol of NADH per minute per 1mL sample as one enzyme activity unit (U). Calculate the enzyme activity according to the following formula:
[0068] GDH enzyme activity (U / L) = ΔA ÷ (ε × d) × 10 9 ×V 反应 ÷V 样品 ÷T
[0069] Where, ε is the molar extinction coefficient of NADH, 6220 (L / mol / cm); d is the optical path of the ELISA plate, 0.6 cm; 10 9 is the unit conversion factor; V 反应 is the total reaction volume, 0.3 ml; V 样品 is the added sample volume, 0.05 ml; T is the reaction time, 10 min.
[0070] The reaction results are as follows Figure 3 As shown in Figure 2, at pH 8.0, 10.0, 11.0, and 12.0, the enzyme activities of mutants G28V / A55N, G28V / A55M, and V72L / L122M were significantly improved compared to the original enzyme. When the pH was 8.0, the enzyme activity of mutant G28V / A55N increased by 40.0% compared to the original enzyme, reaching 5.0×10 5U / mL; when the pH was 10.0 and 11.0, the enzyme activity of the mutant G28V / A55M increased by 108.0% and 192.4% respectively compared with the original enzyme, reaching 4.4×10 5 U / mL, 4.9×10 5 U / mL; when the pH was 12.0, the enzyme activity of the mutant V72L / L122M was increased by 2.86 times compared with the original enzyme, reaching 2.6×10 5 The above results show that the mutants G28V / A55N, G28V / A55M, and V72L / L122M provided by the present invention maintain good enzyme activity under alkaline conditions compared to the original enzyme, and have the ability to be used in alkaline reaction conditions.
[0071] Example 6 Determination of glucose dehydrogenase activity in different acidic solutions
[0072] The enzyme activity assay method of this example is the same as that of Example 5 except that an acidic solution is used.
[0073] Prepare different acidic solutions: (1) 100 mM, pH 7.0 phosphate buffer: take 8.59 g of disodium hydrogen phosphate and 4.73 g of sodium dihydrogen phosphate, add deionized water and make up to 1 L; (2) 100 mM, pH 6.0 phosphate buffer: take 1.65 g of disodium hydrogen phosphate and 10.60 g of sodium dihydrogen phosphate, add deionized water and make up to 1 L; (3) 100 mM, pH 5.0 acetate buffer: take 1.743 mL of glacial acetic acid and 5.72 g of sodium acetate, add deionized water and make up to 1 L.
[0074] The reaction results are as follows Figure 4 As shown in the results, at pH 7.0, 6.0, and 5.0, the enzyme activities of mutants G28V / A55M and L122V were superior to those of the original enzyme. When the pH was 7.0, the enzyme activity of mutant G28V / A55M increased by 178.1% compared with the original enzyme, reaching 5.1×10 5 U / mL; when the pH was 6.0 and 5.0, the enzyme activity of mutant L122V increased by 3.2 times and 9.5 times respectively compared with the original enzyme, reaching 1.9×10 5 U / mL, 1.3×10 5 The above results show that the mutants G28V / A55M and L122V provided in the present invention have improved enzyme activity under acidic conditions compared with the original enzymes, and have application potential in acidic conditions.
Claims
1. A glucose dehydrogenase mutant, characterized in that The amino acid sequence of the glucose dehydrogenase mutant is obtained by mutation of the sequence shown in SEQ ID NO. 1, wherein the mutation is G28V / A55N or G28V / A55M.
2. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the glucose dehydrogenase mutant according to claim 1.
3. The nucleic acid molecule according to claim 2, characterized in that The nucleotide sequence of the nucleic acid molecule is obtained by base mutation of the sequence shown in SEQ ID NO.
2.
4. A carrier, characterized in that Comprising the nucleotide sequence of claim 3.
5. A recombinant cell, characterized in that The recombinant cell comprises the vector of claim 4.
6. A method for preparing the glucose dehydrogenase mutant according to claim 1, characterized in that: The following steps are involved: (1) Designing point mutation primers, using the plasmid containing the sequence of SEQ ID NO.2 as a template, performing a PCR reaction, followed by a digestion reaction and a recombination reaction, to obtain an expression vector carrying the mutant gene; (2) Transforming the expression vector into a host bacterium for fermentation expression; (3) Collecting the host bacterium, disrupting the cells, and centrifuging to obtain the supernatant to obtain the glucose dehydrogenase mutant.
7. A product, characterized in that The product comprises the glucose dehydrogenase mutant according to claim 1 or the nucleic acid molecule according to any one of claims 2 to 3 or the vector according to claim 4 or the recombinant cell according to claim 5.
8. A product according to claim 7 in catalyzing the reaction of D-glucose and NAD + Application in generating D-gluconic acid and NADH.
Citation Information
Patent Citations
Endoglucanase mutant with improved pH tolerance and preparation method thereof
CN118910016A
Heat-resistant glucose dehydrogenase mutant and preparation method thereof
CN119193516A