A tea tree-derived transmembrane transporter gene CsMATE33 and its application

Abstract

The present invention provides a tea tree-derived transmembrane transporter gene CsMATE33 and an application thereof, belonging to the technical field of biological breeding. The nucleotide sequence of the tea tree-derived transporter gene CsMATE33 is shown in SEQ ID No. 1. Studies have shown that the tea tree-derived transporter gene CsMATE33 provided by the present invention can increase the content of EGCG in yeast, tea trees and tobacco, and provides valuable gene resources for cultivating high-EGCG plants and microbial varieties, and has good application prospects and value.

Description

Technical Field

[0001] The invention belongs to the technical field of biological breeding, and in particular relates to a tea tree-derived transmembrane transporter gene CsMATE33 and an application thereof. Background Art

[0002] Tea tree (Camellia sinensis) is an economic crop, and tea products made from young leaves are deeply loved by the people. Tea tree catechin compounds are important secondary metabolites in tea trees, which affect the flavor of tea. Epigallocatechin gallate (EGCG) is one of the main components of catechin compounds. It is not only an important component of tea flavor substances, but also has multiple physiological functions such as antioxidant, antibacterial, and anti-inflammatory. In recent years, people's demand for EGCG has grown rapidly, and related research on the synthesis and accumulation of EGCG has become a hot topic.

[0003] However, most current studies focus on the synthesis of catechins, and there are few reports on how catechins are transported and stored in tea leaves. Exploring the EGCG accumulation mechanism of tea trees is conducive to the molecular breeding of tea trees, and has important practical significance for the study of tea quality components and the improvement of tea quality. In addition, with the rapid development of biotechnology, heterologous synthesis and accumulation strategies based on synthesis and transport biology have developed into an important means of efficient preparation of secondary metabolites. Saccharomyces cerevisiae and tobacco are widely used in the heterologous synthesis and accumulation of secondary metabolites. However, the weak heterologous accumulation ability of natural products will greatly limit the biosynthesis efficiency and yield of natural products. Therefore, exploring the EGCG accumulation mechanism and preparing yeast strains with high EGCG accumulation and tobacco plants with high EGCG accumulation can increase the yield of EGCG heterologous synthesis and accumulation.

[0004] Recent studies have shown that transporter genes play an important role in the transport of plant secondary metabolites, xenobiotic detoxification, plant growth and development, and stress response. Among them, MATE transporters are predicted to play an important role in the transport of EGCG. However, so far, there have been no reports on the role of tea tree-derived MATE transporter genes and their encoded products in regulating the accumulation of EGCG in tea leaves. At the same time, as a perennial woody plant, tea trees have many problems such as long traditional breeding cycles, low efficiency, and the lack of a sound transgenic technology system. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide a tea tree-derived transmembrane transporter gene CsMATE33 and its application. The tea tree-derived transporter gene CsMATE33 can increase the EGCG content in yeast, tea trees and tobacco, providing valuable gene resources and technical means for cultivating high-EGCG plants or microbial varieties.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides a tea tree-derived transport protein gene CsMATE33, and the nucleotide sequence of the tea tree-derived transport protein gene CsMATE33 is shown in SEQ ID No.1.

[0008] The present invention also provides a protein encoded by the tea tree-derived transporter gene CsMATE33, and the amino acid sequence of the protein is shown in SEQ ID No.2.

[0009] The present invention also provides the use of overexpressing the tea tree-derived transporter gene CsMATE33 in increasing the EGCG content of fungi, wherein the fungi is yeast.

[0010] The present invention also provides the use of overexpressing the tea tree-derived transporter gene CsMATE33 in increasing the EGCG content in plant leaves, wherein the plant includes tea tree or tobacco.

[0011] The present invention also provides the use of the tea tree-derived transporter gene CsMATE33 in preparing a high-yield EGCG yeast strain, tea tree or tobacco.

[0012] The present invention also provides a recombinant vector for overexpressing the tea tree-derived transport protein gene CsMATE33, comprising the tea tree-derived transport protein gene CsMATE33 and an expression vector.

[0013] Preferably, the expression vector comprises one of pDR196, pBI121 and S1300.

[0014] The present invention also provides a recombinant bacterium over-expressing the tea tree-derived transporter gene CsMATE33, and the recombinant vector is transferred into the genetically engineered bacterium.

[0015] Preferably, the genetically engineered bacteria include Agrobacterium GV3101 or Saccharomyces cerevisiae AD1-8.

[0016] The present invention also provides the use of the recombinant vector and the recombinant bacteria in increasing the EGCG content in fungi or plant leaves.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention uses RT-PCR and RACE technology to isolate and clone a tea tree-derived transporter gene CsMATE33 for the first time, and verifies the biological function of the gene for the first time through homologous and heterologous overexpression experiments, proving that it can improve the EGCG accumulation capacity of microorganisms and plants, providing valuable gene resources and technical means for preparing yeast strains with high EGCG accumulation and cultivating new varieties of high EGCG plants, and has good application prospects and value. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the gel electrophoresis image of the PCR amplification product of the full length of the CsMATE33 gene;

[0020] Figure 2 The map of the recombinant vector for overexpression of CsMATE33 gene in yeast;

[0021] Figure 3 The growth of CsMATE33 overexpressing yeast and control yeast in solid medium containing EGCG;

[0022] Figure 4 The growth of CsMATE33 overexpressing yeast and control yeast in yeast culture medium containing EGCG;

[0023] Figure 5 is the measured EGCG content in CsMATE33 overexpressing yeast and control yeast;

[0024] Figure 6 The map of the recombinant vector for overexpression of CsMATE33 gene in tobacco;

[0025] Figure 7 The EGCG content in the control tobacco leaves and the CsMATE33 overexpressing tobacco leaves was measured after the CsMATE33 gene was transiently overexpressed for 48 h;

[0026] Figure 8 The map of the recombinant vector for overexpression of CsMATE33 gene in tea plants;

[0027] Fig. 9 The EGCG content in the control tea leaves and the CsMATE33 overexpressing tea leaves was measured after the CsMATE33 gene was transiently overexpressed for 48 hours;

[0028] Fig.10The figure shows the relative expression level of the CsMATE33 gene in the overexpressed plants; the left figure shows the relative expression level of the CsMATE33 gene in the control tobacco leaves and the CsMATE33 overexpressed tobacco leaves after 48 hours of transient overexpression; the right figure shows the relative expression level of the CsMATE33 gene in the control tea leaves and the CsMATE33 overexpressed tea leaves after 48 hours of transient overexpression. DETAILED DESCRIPTION

[0029] The present invention provides a tea tree-derived transport protein gene CsMATE33, and the nucleotide sequence of the tea tree-derived transport protein gene CsMATE33 is shown in SEQ ID No.1.

[0030] In the present invention, the nucleotide sequence of the tea tree-derived transporter gene CsMATE33 is specifically:

[0031] ATGAAGATGAGGCTACAAATCAAATCCTTTAAAGAGGGGGGTTTGCATGGAAGTTCTTCCAAGAGTGAAGCCATGAACAACATGAATTCAGAAGAGTTAGATTACCAGCAGCAATTGCTGCCTCCAGGAGGAGGAGGGGCTCAAGTTTCTGGTTTGTCCTCCTCTGAGGTTGAAGACATCTTGGCACGAAAGCCTGTACCCTTTAAATGGTATTTTCGACTCCTGGGTTGGGAGTCGA

[0032] AACTTCTATGGCTCCTTTCTGGGGCAACCATTGCTGTCTCTGTCTGCAA

[0033] TTATATGCTCAGTTTTGTTACCCTTACTTTTTCTGGCCAGTTGGGTGCTT

[0034] TGCAGCTTGCTGGTGCTTCCATTGCTATGGTCGGCACTCAAGGCCTTGC

[0035] CTACGGATCATGTTGGGGATGGCAAGTGCTGTTCAAACTGTGTGCGG

[0036] CCAAGCATACGGAGCAAAGCAATACGATGCGATGGGCATAATTTGCCA

[0037] GAGAGCAATAATCCTACACTTAGCAGCAGCAATTCTTCTGACTTTTCTC

[0038] TACTGGTACTTCGGTGAAGTCCTTCTATTAATTGGACAAGCGGAGAGCA

[0039] TAGCCAAAGAGGGTCAAATCTTCGCGCGAGGCATGATTCTGCAACTCT

[0040] ATGCGTTCGCGATAAGTTGTCCAATGCAAAGGTTTCTTCAAGCACAGA

[0041] ACATTGTGAACCCATTGGCATACATGTCAATGGGGGTTTTGGTATTGCA

[0042] CAGTGTGTTGACATGGGTTGTGGTTAATTACTTGCATTATGGGCTTCTTG

[0043] GAGCAGCGCTTACGCTCAGCTTCTCCTGGTGGGTACTGGTTTTGCTACA

[0044] AGGACTTTACGTACTTTTCAGCCCTTCTTGCAAGAATACTTGGACTGGC

[0045] TTCTCTATCAAAGCTGTTCATGGGATTTGGCCTTATTTCAAGTTGACTAT

[0046] TGCTTCTGCTGTTATGTTGTGTCTAGAGATATGGTACAACCAAGGACTT

[0047] GTACTTATATCAGGCCTCCTCCCCAACCCAACAATTGCCTTAGATTGCCT

[0048] TTCTATTTGTATAAATTACTGGACATGGGACATTGAGTTCATGTTGGGGC

[0049] TGAGCGCGGCAGTAAGCGTTCGAGTCGGTAATGAGCTTGGGGCAGGA

[0050] CATCCAATGGTTGCAAAATTTTCAATGATTGTAGTTATCATGACAAGTAT

[0051] TCTCATTAGTATATTTTTTAGTGCAATTGTTCTCATTTTCCGGATTGGATT

[0052] GAGCAAACTCTTTACAAGCGACCAAGATGTTATTGCTGCAGTGTCCAAT

[0053] ATGACTCCATTACTTGCTATTTCTGTATTCTTAAATGGCATTCAACCTATA

[0054] CTTTTCTGGGGTGGCCATAGGGAGTGGATGGCAATCTATTGTGGCTTATG

[0055] TTAATCTAGCCACTTATTATATTGTTGGCCTGCCCATTGGATGTGTCCTA

[0056] GGGTTCAAAACACGGTTAGGAGCTGCAGGGCTTTGGGTGGGGGATGATT

[0057] ATTGGAGTCCTCCTACAAACAGTATGTCTAATCATCATAACTGCCAGAA

[0058] CAAATTGGAATGCAGAGGTTGCTAAAGCTGTTGAGAGGTTGAAAAAAT

[0059] CTGCAAATGAAGTTCACCCTTGGACCAATTGGACAGTGTTCCTAA

[0060] (SEQ ID No.1).

[0061] The present invention also provides a protein encoded by the tea tree-derived transporter gene CsMATE33, and the amino acid sequence of the protein is shown in SEQ ID No.2.

[0062] In the present invention, the amino acid sequence of the protein is:

[0063] *(SEQ ID No.2).

[0064] The present invention also provides the use of overexpressing the tea tree-derived transporter gene CsMATE33 in increasing the EGCG content of fungi, wherein the fungi are preferably yeast, and more preferably yeast AD1-8.

[0065] The present invention also provides the use of overexpressing the tea tree-derived transporter gene CsMATE33 in increasing the EGCG content in plant leaves, wherein the plant preferably includes tea tree or tobacco.

[0066] The present invention also provides the use of the tea tree-derived transporter gene CsMATE33 in preparing a high-yield EGCG yeast strain, tea tree or tobacco.

[0067] The present invention also provides a recombinant vector for overexpressing the tea tree-derived transport protein gene CsMATE33, comprising the tea tree-derived transport protein gene CsMATE33 and an expression vector.

[0068] In the present invention, the expression vector preferably comprises one of pDR196, pBI121 and S1300.

[0069] The present invention also provides a recombinant bacterium over-expressing the tea tree-derived transporter gene CsMATE33, and the recombinant vector is transferred into the genetically engineered bacterium.

[0070] In the present invention, the genetically engineered bacteria preferably include Agrobacterium GV3101 or yeast AD1-8.

[0071] The present invention also provides the use of the recombinant vector and the recombinant bacteria in increasing the EGCG content in fungi or plant leaves.

[0072] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0073] Example 1 Acquisition of tea tree derived transporter gene CsMATE33

[0074] The total RNA from the leaves of tea plant 'Longjing 43' (two-year-old potted seedlings, obtained by cuttings and propagation in the laboratory) was extracted using RNAPlant Plus Kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.). The concentration and quality of the extracted total RNA were tested using Nanodrop, and RNA samples with test results of OD260 / 280>2.0 and OD260 / 230>1.8 were considered qualified RNA. PrimeScript TM The RT reagentKit reverse transcription kit (purchased from TaKaRa) was used to reverse transcribe qualified RNA into cDNA. The detailed operation method was carried out according to the manufacturer's instructions.

[0075] Primers capable of amplifying the full length of the CMATE33 gene were designed using the NCBI Primer Blast website to obtain a primer pair consisting of an upstream primer with a nucleotide sequence of 5'ATGAACAACATGAAT--3' (SEQ ID No. 3) and a downstream primer with a nucleotide sequence of 5'-TTAGGAAACACTGTCCAATT-3' (SEQ ID No. 4).

[0076] The cDNA obtained by reverse transcription was used as a template to perform PCR amplification of the full length of the CsMATE33 gene using KOD high-fidelity enzyme (purchased from Toyobo Co., Ltd.) to obtain a PCR purified product containing the complete CsMATE33 gene coding region sequence. The bands obtained by the reaction were as follows: Figure 1 shown.

[0077] The PCR amplification system is: 50 μL, cDNA template 2 μL, 2×PCR buffer 25 μL, 2 mM dNTP 10 μL, 10 pmol / μL upstream primer 1.5 μL, 10 pmol / μL downstream primer 1.5 μL, KOD high-fidelity enzyme 1 μL, water 9 μL. The amplification conditions are: 98°C×4min→(98°C×20sec→62°C×20sec→68°C×60sec)×35 cycles→68°C×3min.

[0078] The PCR purified product obtained by the above amplification was connected to the pEASYblunt zero vector (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) to obtain pEASY-CsMATE33.

[0079] Plasmid PCR identification was performed using universal primers M13 (M13F: 5'-GTAAAACGACGGCCAGT-3' (SEQ ID No. 5), M13R: 5'-CAGGAAACAGCTATGAC-3' (SEQ ID No. 6).

[0080] The specific connection method and PCR identification method were carried out according to the manufacturer's instructions. The positive plasmid obtained by identification was sent to Hangzhou Youkang Biotechnology Co., Ltd. for sequencing, and the CsMATE33 gene sequence shown in SEQ ID NO.1 was obtained after sequencing.

[0081] Example 2 Effect of tea tree derived transporter CsMATE33 on yeast strains

[0082] 2.1 Construction of a recombinant vector overexpressing the tea tree-derived transporter CsMATE33

[0083] Using the pEASY-CsMATE33 plasmid obtained in Example 1 as a template, PCR amplification was performed using a primer pair consisting of an upstream primer: 5'-TCCCCCGGGCTGCAGGAATTCATGAACAACATGAAT-3' (SEQ ID No. 7) and a downstream primer: 5'-GGGCCCCCCCTCGAGGTCGACTTAGGAAACACTGTC-3' (SEQ ID No. 8) to obtain the PCR product rDNA-1.

[0084] The PCR amplification system is: 50 μL, plasmid template 2 μL, 2×PCR buffer 25 μL, 2 mM dNTP 10 μL, 10 pmol / μL upstream primer 1.5 μL, 10 pmol / μL downstream primer 1.5 μL, KOD high-fidelity enzyme (purchased from Toyobo Co., Ltd.) 1 μL, water 9 μL. The PCR amplification conditions are: 98°C×4min→(98°C×20sec→62°C×20sec→68°C×60sec)×35 cycles→68°C×3min.

[0085] The PCR product rDNA-1 and the expression vector pDR196 (purchased from Wuhan Boyuan Biotechnology Co., Ltd.) were subjected to EcoRI / SalI double restriction enzyme digestion reaction to obtain linearized rDNA-1 and linearized vector pDR196.

[0086] The enzyme digestion reaction system is: based on 20 μL, 3 μL of rDNA-1 or pDR196 plasmid, 2 μL of 10× buffer, 1 μL of EcoRI, 1 μL of SalI, and 13 μL of water.

[0087] The obtained linearized rDNA-1 and linearized vector pDR196 were purified using a PCR purification kit (purchased from Axygen), and then the two were subjected to homologous recombination and Golden Gate ligation reaction to obtain the overexpression recombinant vector pDR196-CsMATE33. The map of the overexpression recombinant vector is shown in Figure 2 shown.

[0088] Sequencing analysis showed that the overexpression recombinant vector pDR196-CsMATE33 was a vector obtained by cloning the CsMATE33 gene shown in SEQ ID No.1 into the plasmid pDR196, and the vector expressed the CsMATE33 protein shown in SEQ ID No.2.

[0089] 2.2 Construction of recombinant bacteria overexpressing tea tree-derived transporter CsMATE33

[0090] The overexpression recombinant vector pDR196-CsMATE33 obtained in 2.1 was transferred into Saccharomyces cerevisiae AD1-8 (donated by Professor Mohan Gupta of the University of Chicago) by chemical transformation to obtain overexpression recombinant yeast named AD1-8 / pDR196-CsMATE33.

[0091] At the same time, the empty vector pDR196 was transformed into Saccharomyces cerevisiae AD1-8 to obtain the control yeast AD1-8 / pDR196.

[0092] 2.3 Determination of the accumulation capacity of epigallocatechin gallate (EGCG) in recombinant yeast transiently overexpressing the CsMATE33 gene

[0093] 2.3.1 AD1-8 / pDR196-CsMATE33 and AD1-8 / pDR196 obtained in 2.2 were cultured to OD600 = 0.2, diluted 10 times, 100 times and 1000 times, respectively, and cultured at 30°C for 3 days in a solid culture medium containing 0mM and 3mM EGCG (purchased from Beijing Coolbobo Technology Co., Ltd.). Yeast growth was as follows Figure 3 shown.

[0094] AD1-8 / pDR196-CsMATE33 and AD1-8 / pDR196 constructed in 2.2 were cultured to OD600 = 2, 1 ml of bacterial solution was added to 50 mL of yeast culture solution containing 1 mM EGCG (purchased from Beijing Coolbo Technology Co., Ltd.), and cultured at 30°C, 200 rpm constant temperature shaker for 2 days. The bacterial solution concentrations were detected at 12, 15, 18, 21, 24, 30, 36, 42 and 48 hours of culture. The experimental results are shown in Figure 2. Figure 4 shown.

[0095] Depend on Figure 3 and Figure 4 It can be seen that compared with the control yeast strain, the recombinant yeast overexpressing the CsMATE33 gene grew more slowly in the culture medium containing EGCG, presumably because it accumulated more EGCG and increased the sensitivity of the yeast to EGCG toxicity.

[0096] 2.3.2 The AD1-8 / pDR196-CsMATE33 and AD1-8 / pDR196 obtained by the above construction were respectively placed in a liquid culture medium containing 0.5mM EGCG (purchased from Beijing Coolaibo Technology Co., Ltd.) and cultured until OD600 = 2, 150ml of bacterial solution was placed in a centrifuge and centrifuged at 3000g for 5 minutes, the bacteria were collected, and the supernatant was removed; resuspended with 50ml of sterile water, centrifuged again, and repeated twice; 1ml, 70% methanol was added to resuspend, and extracted in a 70℃ water bath for 20min. Cool to 25℃, centrifuge at 4000g for 10min in a centrifuge, and the extract was aspirated into a glass transparent injection bottle (purchased from Tianjin Jinteng Experimental Equipment Co., Ltd.). The EGCG content in yeast was detected according to "GB / T 8313-2018 Detection Method for Tea Polyphenols and Catechins in Tea". The experimental results are as follows Figure 5 shown.

[0097] Depend on Figure 5It can be seen that compared with the control strain, the yeast overexpressing the CsMATE33 gene contains more EGCG, which indicates that it has a strong EGCG accumulation ability.

[0098] Example 3 Effect of tea tree derived transporter CsMATE33 on tobacco

[0099] 3.1 Construction of a recombinant vector overexpressing the tea tree-derived transporter CsMATE33

[0100] Using the pEASY-CsMATE33 plasmid obtained in Example 1 as a template, PCR amplification was performed using a primer pair consisting of an upstream primer: 5'-ACGGGGGACTCTAGAGGATCCATGAACAACATGAAT-3' (SEQ ID No. 9) and a downstream primer: 5'-GCCCTTGCTCACCATGGTACCGGAAACACTGTCCAA-3' (SEQ ID No. 10) to obtain a PCR product rDNA-2.

[0101] The PCR amplification system is: 50 μL, plasmid template 2 μL, 2×PCR buffer 25 μL, 2 mM dNTP 10 μL, 10 pmol / μL upstream primer 1.5 μL, 10 pmol / μL downstream primer 1.5 μL, KOD high-fidelity enzyme (purchased from Toyobo Co., Ltd.) 1 μL, water 9 μL. The PCR amplification conditions are: 98°C×4min→(98°C×20sec→62°C×20sec→68°C×60sec)×35 cycles→68°C×3min.

[0102] The PCR product rDNA-2 and the expression vector pBI121 (purchased from Wuhan Boyuan Biotechnology Co., Ltd.) were subjected to BamHI / KpnI double restriction enzyme digestion reaction to obtain linearized rDNA-2 and linearized vector pBI121.

[0103] The enzyme digestion reaction system is: based on 20 μL, 3 μL of rDNA or pBI121 plasmid, 2 μL of 10× buffer, 1 μL of BamHI / , 1 μL of KpnI, and 13 μL of water.

[0104] The obtained linearized rDNA-2 and linearized vector pBI121 were purified using a PCR purification kit (purchased from Axygen), and then the two were subjected to homologous recombination and Golden Gate ligation reaction to obtain the overexpression recombinant vector pBI121-CsMATE33. The map of the overexpression recombinant vector is shown in Figure 6 shown.

[0105] Sequencing analysis showed that the overexpression recombinant vector pBI121-CsMATE33 was a vector obtained by cloning the CsMATE33 gene shown in SEQ ID No.1 into the plasmid pBI121, and the vector expressed the CsMATE33 protein shown in SEQ ID No.2.

[0106] 3.2 Construction of recombinant bacteria overexpressing tea tree-derived transporter CsMATE33

[0107] The overexpression recombinant vector pBI121-CsMATE33 obtained in 3.1 was transferred into Agrobacterium GV3101 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) by chemical transformation to obtain the overexpression recombinant bacteria named GV3101 / pBI121-CsMATE33.

[0108] At the same time, the empty vector pBI121 was introduced into Agrobacterium GV3101 to obtain the recombinant bacteria GV3101 / pBI121.

[0109] 3.3 Construction of tobacco plants transiently overexpressing the CsMATE33 gene

[0110] The recombinant bacteria GV3101 / pBI121-CsMATE33 constructed in 3.2 was injected into Nicotiana benthamiana leaves grown to 28 days old by Agrobacterium infiltration method to obtain CsMATE33-OE overexpressing tobacco plants.

[0111] The same method was used to transfer the recombinant bacteria GV3101 / pBI121 into tobacco leaves grown to 28 days to obtain control tobacco plants.

[0112] 3.4 Determination of the accumulation capacity of epigallocatechin gallate (EGCG) in tobacco plants transiently overexpressing the CsMATE33 gene

[0113] 500 mg of leaves from two tobacco plants cultured with 0.5 mM EGCG were selected and treated as follows: the leaves were ground into powder in liquid nitrogen, 1 ml of 70% methanol solution was added, and the leaves were extracted in a 70°C water bath for 20 min, cooled to 25°C, centrifuged at 4000 g for 10 min, and the extract was pipetted into a glass transparent injection bottle (purchased from Tianjin Jinteng Experimental Equipment Co., Ltd.), and passed through a 0.22 μm organic microporous filter membrane. According to the "GB / T8313-2018 Method for the Detection of Tea Polyphenols and Catechins in Tea", the EGCG content in tobacco leaves was detected using a Waters 2695 high performance liquid chromatograph (purchased from Waters Corporation). The experimental results are as follows: Figure 7 shown.

[0114] Depend on Figure 7It can be seen that compared with the control tobacco, the CsMATE33 gene overexpression tobacco contains more EGCG, which indicates that the overexpression of the CsMATE33 gene enhances the EGCG accumulation ability of tobacco.

[0115] Example 4 Effect of tea tree-derived transporter CsMATE33 on tea trees

[0116] 4.1 Construction of a recombinant vector overexpressing the tea tree-derived transporter CsMATE33

[0117] Using the pEASY-CsMATE33 plasmid obtained in Example 1 as a template, PCR amplification was performed using a primer pair consisting of an upstream primer: 5'-GATGACGATGACAAGCCCGGGATGAACAACATGAAT-3' (SEQ ID No. 11) and a downstream primer: 5'-TTTTTGTTCGGGCCCGTCGACGGAAACACTGTCCAA-3' (SEQ ID No. 12) to obtain the PCR product rDNA-3.

[0118] The PCR amplification system is: 50 μL, plasmid template 2 μL, 2×PCR buffer 25 μL, 2 mM dNTP 10 μL, 10 pmol / μL upstream primer 1.5 μL, 10 pmol / μL downstream primer 1.5 μL, KOD high-fidelity enzyme (purchased from Toyobo Co., Ltd.) 1 μL, water 9 μL. The PCR amplification conditions are: 98°C×4min→(98°C×20sec→62°C×20sec→68°C×60sec)×35 cycles→68°C×3min.

[0119] The PCR product rDNA-3 and the expression vector S1300 (purchased from Wuhan Boyuan Biotechnology Co., Ltd.) were subjected to XmaI / SalI double restriction enzyme digestion reaction to obtain linearized rDNA and linearized vector S1300.

[0120] The enzyme digestion reaction system is: based on 20 μL, 3 μL of rDNA or pDR196 plasmid, 2 μL of 10× buffer, 1 μL of XmaI, 1 μL of SalI, and 13 μL of water.

[0121] The obtained linearized rDNA-3 and linearized vector S1300 were purified using a PCR purification kit (purchased from Axygen), and then the two were subjected to homologous recombination and Golden Gate ligation reaction to obtain the overexpression recombinant vector S1300-CsMATE33. The map of the overexpression recombinant vector is shown in Figure 8 shown.

[0122] According to sequencing analysis, the overexpression recombinant vector S1300-CsMATE33 is a vector obtained by cloning the CsMATE33 gene shown in SEQ ID No.1 into the plasmid S1300, and the vector expresses the CsMATE33 protein shown in SEQ ID No.2.

[0123] 4.2 Construction of recombinant bacteria overexpressing tea tree-derived transporter CsMATE33

[0124] The overexpression recombinant vector S1300-CsMATE33 constructed in 4.1 was transferred into Agrobacterium GV3101 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) by chemical transformation to obtain the overexpression recombinant bacteria named GV3101 / S1300-CsMATE33.

[0125] The empty vector S1300S was introduced into Agrobacterium GV3101 to obtain the recombinant bacteria GV3101 / S1300.

[0126] 4.3 Construction of tea plants with transient overexpression of CsMATE33 gene

[0127] The recombinant bacteria GV3101 / S1300-CsMATE33 constructed in 4.2 was injected into the third leaf of three-year-old "Longjing 43" tea tree potted seedlings (Longjing 43 tea tree potted seedlings were obtained by cutting propagation in the laboratory) by Agrobacterium infiltration to obtain CsMATE33-OE overexpressing tea plants.

[0128] The same method was used to transfer the recombinant bacteria GV3101 / S1300 into leaves at the same position of tea trees to obtain control tea plants.

[0129] 4.4 Determination of the accumulation capacity of epigallocatechin gallate (EGCG) in tea plants with transient overexpression of the CsMATE33 gene

[0130] The overexpressed tea plants and control tea plants obtained in 4.3 were selected and treated as follows: 100 mg of leaves were added to 1 ml of 70% methanol solution, extracted in a 70°C water bath for 20 min, cooled to 25°C, centrifuged at 4000 g for 10 min, and the extract was pipetted into a glass transparent injection bottle (purchased from Tianjin Jinteng Experimental Equipment Co., Ltd.), and filtered through a 0.22 μm organic microporous filter membrane. According to the "GB / T 8313-2018 Method for the Detection of Tea Polyphenols and Catechins in Tea", the EGCG content in tea leaves was detected using a Waters 2695 high performance liquid chromatograph (purchased from Waters Corporation). The experimental results are as follows: Fig. 9 shown.

[0131] Depend on Fig. 9It can be seen that compared with the control tea trees, the tea trees with overexpression of the CsMATE33 gene contain more EGCG; this indicates that overexpression of the CsMATE33 gene enhances the accumulation capacity of EGCG in tea trees.

[0132] Example 5 Detection of relative expression of CsMATE33 gene in overexpressed plants

[0133] The relative expression levels of CsMATE33 in the overexpressing tobacco plants and overexpressing tea plants constructed in Examples 4 and 5 were detected. The specific detection method is as follows:

[0134] Total RNA from tobacco and tea leaves was extracted using RNAPlantPlus Kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) and PrimeScript TM The total RNA was reverse transcribed using RTreagentKit (purchased from TaKaRa, Japan) to synthesize cDNA. The detailed operation method was carried out according to the manufacturer's instructions.

[0135] The Light Cycler480 fluorescence quantitative PCR system (qRT-PCR) was used to detect the relative expression of CsMATE33 in Arabidopsis and tea plants, respectively. The detection primer pair used consisted of an upstream primer: 5'-AGACATCTTGGCACGAAAGC-3' (SEQ ID No. 13) and a downstream primer: 5'-GCAGACAGAGACAGCAATGG-3' (SEQ ID No. 14). The detection results are shown in Fig.10 shown.

[0136] Depend on Fig.10 It can be seen that the overexpression effect of the CsMATE33 gene can be detected in tobacco plants with transient expression for 48 hours and tea plants with transient expression for 48 hours.

[0137] The above research results all prove the role of CsMATE33 gene and its encoded product in improving the EGCG accumulation capacity of microorganisms and plants, and its strong EGCG accumulation effect has been verified in microbial yeast, herbaceous tobacco and woody tea plants. This result provides genetic resources and basis for the preparation of yeast strains with high EGCG accumulation and the breeding and application of new varieties of high EGCG plants.

[0138] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A tea tree-derived transporter gene CsMATE33 , characterized in that, The tea tree-derived transporter gene CsMATE33 The nucleotide sequence is shown in SEQ ID No.

1.

2. The tea tree-derived transporter gene according to claim 1 CsMATE33 The encoded protein is characterized in that The amino acid sequence of the protein is shown in SEQ ID No.

2.

3. Overexpression of the tea tree-derived transporter gene of claim 1 CsMATE33 The application of the method for increasing the EGCG content in fungi is characterized in that: The fungus is yeast.

4. Overexpression of the tea tree-derived transporter gene of claim 1 CsMATE33 The application of the method for increasing the EGCG content in plant leaves is characterized in that: The plant is tea tree or tobacco.

5. The tea tree-derived transporter gene according to claim 1 CsMATE33 Application in the preparation of high-yield EGCG yeast strains, tea trees or tobacco.

6. Overexpression of tea tree-derived transporter gene CsMATE33 The recombinant vector is characterized in that Comprising the tea tree-derived transporter gene according to claim 1 CsMATE33 and expression vectors.

7. The recombinant vector according to claim 6, characterized in that The expression vector includes one of pDR196, pBI121 and S1300.

8. Overexpression of tea tree-derived transporter gene CsMATE33 The recombinant bacterium is characterized in that The recombinant vector according to claim 6 or 7 is introduced into genetically engineered bacteria.

9. The recombinant bacterium according to claim 8, characterized in that The genetically engineered bacteria include Agrobacterium GV3101 or yeast AD1-8.

10. Use of the recombinant vector according to claim 6 or 7, or the recombinant bacteria according to claim 8 or 9 in increasing the EGCG content in yeast, tea leaves or tobacco leaves.

Images