Sapindus mukorossi smap3 gene and application thereof

Abstract

This invention discloses a Sapindus mukorossi SmAP3 gene and its application. The SmAP3 gene, when expressed in plants, regulates flowering time and promotes pistil development and growth. The SmAP3 gene is the nucleotide sequence shown in Seq ID NO.1 or the nucleotide sequence encoding the amino acid sequence shown in Seq ID NO.2. The SmAP3 gene is used to breed new Sapindus mukorossi varieties with different flowering times and elongated pistils. Through observation of whole plants of 35S::SmAP3 transgenic Arabidopsis and analysis of differences in flowering time, overexpression of the SmAP3 gene advanced bolting and flowering times, and elongated pistils. The flowering time, bolting days, and number of rosette leaves at bolting of transgenic Arabidopsis plants differed significantly from wild-type plants, which is beneficial for promoting female flower development and accelerating the breeding cycle of Sapindus mukorossi, thus accelerating the cultivation of high-yielding varieties.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, and relates to a gene that affects the flowering time of plants, the protein encoded by the gene, an expression vector containing the gene, a primer set for cloning the gene from plant DNA, and the use of the gene. Background Technology

[0002] Soapberry (scientific name: *Sapindus mukorossi* Gaertn.), also known as soap tree, is a deciduous tree belonging to the genus *Sapindus* (Sapindus L.) of the family Sapindaceae. As a multifunctional economic forest tree, soapberry not only plays an important role in landscaping, but its rich germplasm resources also give it broad application potential in the fields of daily chemical industry, medicine, and biomass energy.

[0003] The growth and development of Sapindus mukorossi is quite complex, consisting of two main parts: vegetative growth and reproductive development. Vegetative growth primarily involves the development of buds, leaves, and stems, while reproductive development includes stages such as flower bud formation, inflorescence emergence, flowering, fruit development, ripening, and senescence leading to dormancy. Spring is a crucial period for the growth of Sapindus mukorossi branches and leaves. Flower development begins with small "yellow spots" in the leaf axils, followed by the induction of flowering, the initiation of flowers, the differentiation of flower buds, and finally, the development and ripening of the fruit.

[0004] However, the long juvenile period of Sapindus mukorossi (soapberry) limits the progress of breeding work and the rapid realization of economic benefits. To address this issue, conducting research on flowering regulation in Sapindus mukorossi and developing new genetic resources have become crucial for improving breeding efficiency and promoting economic returns. This study aims to use genetic engineering to advance the flowering and fruiting time of Sapindus mukorossi and shorten its juvenile period, which has significant theoretical and practical implications for Sapindus mukorossi variety improvement. Summary of the Invention

[0005] Therefore, this invention aims to provide a novel Sapindus mukorossi SmAP3 gene, which plays a significant role in regulating the flowering time of plants and will contribute to the development of Sapindus mukorossi breeding technology. This invention focuses on the SmAP3 gene in Sapindus mukorossi, a gene that can significantly regulate the flowering time of plants. Through transgenic technology, the application of the SmAP3 gene is expected to accelerate the breeding cycle of Sapindus mukorossi and promote the cultivation of high-yielding varieties. Furthermore, this invention also involves multiple aspects such as the cloning of the SmAP3 gene, the construction of expression vectors, and the analysis of gene expression patterns, providing a scientific basis for a deeper understanding of the function and application of the SmAP3 gene.

[0006] Through long-term exploration and experimentation, and continuous reform and innovation, the inventors have provided a technical solution to solve the above-mentioned technical problems: a Sapindus mukorossi SmAP3 gene, which is expressed in plants to regulate flowering time and promote pistil development and growth. The SmAP3 gene contains nucleotide sequences selected from the following group:

[0007] A. The nucleotide sequence shown in Seq ID NO.1 of the sequence listing;

[0008] B. The nucleotide sequence of the amino acid sequence shown in Seq ID NO.2 of the coding sequence listing.

[0009] The present invention also provides a protein encoded by the Sapindus mukorossi SmAP3 gene, wherein the amino acid sequence of the protein is selected from the amino acid sequence shown in Sequence Listing Seq ID NO.2.

[0010] The present invention also provides a primer pair for cloning the Sapindus mukorossi SmAP3 gene, the base sequence of which is as follows:

[0011] First upstream primer F: 5'-ATGGCTAGAGGGAAAATCCAGA-3',

[0012] First downstream primer R: 5'-CTACTCAAGCAAAGGGTAAATTTTG-3';

[0013] And selectively containing a second upstream primer F and a second downstream primer R with restriction enzyme sites:

[0014] Second upstream primer F: 5'-AGAACACGGGGGACTCTTGACATGGCTAGAGGGAAAATCCAGA-3'.

[0015] Second downstream primer R: 5'-GGGGAAATTCGAGCTGGTCACCTACTCAAGCAAAGGGTAAATTTT G-3'.

[0016] This invention also provides a fluorescence quantitative primer pair for the Sapindus mukorossi SmAP3 gene, the base sequence of which is as follows:

[0017] Third upstream primer F: 5'-CTCAACAAACAGGCAGGTCA-3',

[0018] Third downstream primer R: 5'-ATCGATCCCCAAGTTCCTCT-3'.

[0019] This invention also provides an expression vector containing the Sapindus mukorossi SmAP3 gene as described in claim 1. The pCAMBIA1301 vector plasmid is double-digested using restriction endonucleases BstEII-HF and Ncol-HF. II. The vector was ligated using the One Step Cloning Kit to obtain the overexpression vector pCAMBIA1301-SmAP3.

[0020] The present invention also provides a use for the Sapindus mukorossi SmAP3 gene, for breeding new Sapindus mukorossi varieties with different flowering times.

[0021] The present invention also provides a method for breeding new plant varieties, which utilizes the SmAP3 gene to regulate flowering time and promote pistil development and growth in order to obtain new varieties with desired flowering characteristics.

[0022] The present invention also provides a method for transgenic plants, comprising introducing the expression vector into plant cells to alter the flowering time of the plant.

[0023] This invention also provides a method for analyzing gene expression patterns related to the regulation of flowering time in plants. By measuring the expression level of the SmAP3 gene at different developmental stages, the regulatory mechanism of flowering time in plants can be analyzed.

[0024] The present invention also provides a method for determining the expression level of genes related to flowering time regulation, using the aforementioned quantitative fluorescent primer pair to quantitatively analyze the expression level of genes related to flowering time regulation in transgenic plants.

[0025] Compared with the prior art, one of the above technical solutions has the following advantages:

[0026] The SmAP3 gene from Sapindus mukorossi of this invention exhibits a significant effect on regulating plant flowering time. Through transgenic technology, the SmAP3 gene can induce plants to enter the flowering stage earlier. Experimental results in the model plant Arabidopsis thaliana show that the flowering time, bolting days, and number of rosette leaves at bolting of transgenic plants are significantly different from those of the wild type, thus demonstrating the potential of the SmAP3 gene in accelerating the plant growth and development cycle. Through observation of whole plants transgenic Arabidopsis thaliana and analysis of differences in flowering time, the SmAP3 gene can advance the flowering time of plants to varying degrees. The flowering time, bolting days, and number of rosette leaves at bolting of transgenic Arabidopsis thaliana plants are significantly different from those of wild-type plants, which is beneficial for accelerating the breeding cycle of Sapindus mukorossi and expediting the cultivation of high-yielding varieties.

[0027] The application of the SmAP3 gene has revolutionized the breeding of plants such as Sapindus mukorossi. Traditional breeding methods are time-consuming and inefficient, while the use of the SmAP3 gene can significantly shorten this cycle and accelerate the selection of new varieties. This not only improves the efficiency of breeding work but also provides agricultural producers and related industries with the possibility of achieving economic benefits more quickly, enhancing the market competitiveness of plant varieties.

[0028] Furthermore, in-depth research into the function and mechanism of action of the SmAP3 gene can provide a new theoretical and practical basis for the molecular regulation of plant growth and development, further promoting the development of plant science and molecular design breeding. Attached Figure Description

[0029] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained from these drawings without creative effort.

[0030] Figure 1 This is a clone electrophoresis image of the SmAP3 gene.

[0031] Figure 2 These are the results of a phylogenetic analysis of AP3 subclass proteins from different species.

[0032] Figure 3 These are the results of the cis-acting element analysis of the SmAP3 gene.

[0033] Figure 4 This is a predicted diagram of the tertiary structure of the SmAP3 protein.

[0034] Figure 5 The results are from the analysis of the expression pattern of SmAP3 during the development of male and female flower buds.

[0035] Figure 6 The results of the expression pattern analysis of SmAP3 in male and female floral organs.

[0036] Figure 7 This is the result of an analysis of the expression patterns of the SmAP3 gene at eight stages of pericarp development.

[0037] Figure 8 This is the result of an analysis of the expression patterns of the SmAP3 gene at eight stages of seed development.

[0038] Figure 9 Results of expression pattern analysis of the SmAP3 gene during the flowering induction period.

[0039] Figure 10This is the identification result of the 35S::SmAP3 transgenic plant.

[0040] Figure 11 This is a phenotypic comparison between the wild type and the 35S::SmAP3 transgenic line.

[0041] Figure 12 This is a comparison of the flowering time between the wild type and the 35S::SmAP3 transgenic line.

[0042] Figure 13 This is a statistical chart showing the bolting time, number of rosette leaves, and flowering time of wild-type and 35S::SmAP3 transgenic lines.

[0043] Figure 14 This is a graph showing the expression levels of genes related to regulating flowering time in Arabidopsis thaliana flower tissues. Detailed Implementation

[0044] The following description, in conjunction with the accompanying drawings and specific embodiments, will be provided.

[0045] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention provided in the accompanying drawings is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention.

[0046] Example 1

[0047] The Sapindus mukorossi SmAP3 gene described in this embodiment has a nucleotide sequence as shown in Sequence Listing Seq ID NO.1. Based on this nucleotide sequence, the amino acid sequence shown in Sequence Listing Seq ID NO.2 can be obtained. The CDS sequence is shown in Sequence Listing Seq ID NO.9.

[0048] The SmAP3 gene of Sapindus mukorossi is expressed in plants, particularly Sapindus mukorossi. Functional verification and transgenic verification in Arabidopsis thaliana show that this gene can significantly regulate the flowering time of plants. Utilizing the SmAP3 gene of Sapindus mukorossi can shorten the breeding cycle of Sapindus mukorossi and accelerate the development of high-yield Sapindus mukorossi varieties.

[0049] Example 2

[0050] The primer pair described in this embodiment for cloning the Sapindus mukorossi SmAP3 gene is used to clone the Sapindus mukorossi SmAP3 gene described in Example 1. The base sequence of the primer pair is as follows:

[0051] First upstream primer F: 5'-ATGGCTAGAGGGAAAATCCAGA-3',

[0052] First downstream primer R: 5'-CTACTCAAGCAAAGGGTAAATTTTG-3'.

[0053] The first upstream primer F is shown in Seq ID NO.3 of the sequence listing, and the first downstream primer R is shown in Seq ID NO.4 of the sequence listing.

[0054] Example 3

[0055] The primer pair for cloning the Sapindus mukorossi SmAP3 gene described in this embodiment is based on the primer pair described in Example 2 with the addition of restriction enzyme sites, resulting in the second upstream primer F as shown in Sequence Listing Seq ID NO.5 and the second downstream primer R as shown in Sequence Listing Seq ID NO.6. The base sequences of the primer pair including the restriction enzyme sites are as follows:

[0056] Second upstream primer F: 5'-AGAACACGGGGGACTCTTGACATGGCTAGAGGGAAAATCCA GA-3',

[0057] Second downstream primer R: 5'-GGGGAAATTCGAGCTGGTCACCTACTCAAGCAAAGGGTAAAT TTTG-3'.

[0058] The cloning primer sequences were designed using Primer3web (4.1.0) (https: / / bioinfo.ut.ee / primer3 / ) and then sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for synthesis.

[0059] Example 4

[0060] The quantitative fluorescence primer pair for the Sapindus mukorossi SmAP3 gene described in this embodiment is used for quantitative analysis of the Sapindus mukorossi SmAP3 gene. The base sequences of the quantitative fluorescence primer pair are shown in Seq ID NO.7 and Seq ID NO.8 of the sequence listing:

[0061] Third upstream primer F: 5'-CTCAACAAACAGGCAGGTCA-3',

[0062] Third downstream primer R: 5'-ATCGATCCCCAAGTTCCTCT-3'.

[0063] The primer sequences for quantitative fluorescence were designed using Primer3web (4.1.0) (https: / / bioinfo.ut.ee / primer3 / ) and then synthesized by Beijing Ruiboxingke Biotechnology Co., Ltd.

[0064] Example 5

[0065] This embodiment is an example of verifying the nucleotide sequence and amino acid sequence described in Example 1 using the primers described in Examples 3 and 4.

[0066] In this embodiment, three Sapindus mukorossi sample trees were selected as experimental materials. Biological sampling was carried out three times. The sampling location was located in Jianning County, Sanming City, Fujian Province. The sampling time was fixed from 10:00 am to 12:00 pm. The middle and upper parts of one-year-old branches at the same height of the tree canopy were quickly placed into cryovials and frozen in liquid nitrogen. Then they were stored in a -80°C freezer for subsequent RNA extraction.

[0067] The four stages of flower induction and flower initiation (bud1-4) in Sapindus mukorossi are: flower bud dormancy period (bud1), flower induction period (bud2), flower initiation period (bud3), and inflorescence differentiation period (bud4).

[0068] After the formation of Sapindus mukorossi florets, the developmental stages of floral organs were analyzed. Eight stages were selected from the female (FF1-8) and male (MF1-8) florets of different sexes: F1 was the stage of complete formation of floral organ primordia; F2 was the stage of meiosis of stamens; F3 was the stage of microspore development; F4-6 was the stage of rapid elongation of filaments and styles; F7 was the stage of flowering development; and F8 was the stage of late flowering, totaling 48 groups of samples. Ten tissue parts of the important floral organs (petals, pistils, and stamens) were analyzed, covering the various parts of floral organs in the fourth stage (the stage of rapid elongation of filaments and styles) and the seventh stage (the stage of flowering development): the pistils of female flowers (PiFF4 and PiFF7), the pistils of male flowers (PiMF4 and PiMF7), the stamens of female flowers (StFF4 and StFF7), the stamens of male flowers (StMF4 and StMF7), as well as the petals of female flowers (PeFF) and male flowers (PeMF).

[0069] Following preliminary experimental screening, this embodiment ultimately used cDNA material from male flower buds at the second developmental stage as a template for PCR amplification. The primers described in Example 3 were used for amplification. The TA cloning reaction system is shown in Table 1 below. The reaction program was: 98℃ pre-denaturation for 3 min, 98℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 40 s, repeated 34 times, followed by a final extension at 72℃ for 5 min, and storage at 4℃. After adding 2 μl of 10× Loading buffer, the PCR product was separated by 1% agarose gel electrophoresis. The clean target fragment was excised from the gel and recovered using a DNA gel extraction kit. The entire process was performed on ice.

[0070] Table 1. TA Cloning PCR Sequence Amplification System

[0071]

[0072]

[0073] The recycled gel product was connected to the T-carrier, and the reaction system is shown in Table 2.

[0074] Table 2. T-cloning ligation vector system

[0075]

[0076] Incubate at room temperature (20-30℃) for 5 min. After the reaction, incubate at 4℃. Take 5 μl of ligation solution and add it to 50 μl of freshly thawed DH10B competent cells. Mix gently, incubate on ice for 30 min, heat shock in a 42℃ water bath for 30 s, and immediately place on ice for 2 min. Add 300-500 μL of sterile LB medium and incubate at 37℃ with shaking at 200 rpm for 1 h. Take 200 μl of the bacterial culture (containing ampicillin) and incubate overnight at 37℃ (12-16 h). Select single colonies for PCR molecular detection. Positive E. coli clones were sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for testing.

[0077] Electrophoresis analysis showed that the extracted total RNA bands were clear and intact, meeting the experimental requirements. The SmAP3 gene was cloned using cDNA from Sapindus mukorossi flower tissue as a template; the cloning electrophoresis image is shown below. Figure 1 After sequencing the target fragment, a 687bp coding sequence was obtained (see Sequence Listing Seq ID NO.1), which encodes 228 amino acids (see Sequence Listing Seq ID NO.2).

[0078] To further investigate the conserved motif sequence of Sapindus mukorossi SmAP3, protein sequences of MADS genes from various species databases in the Phytozome v13 public database were screened, including those of Arabidopsis thaliana TAIR10, soybean (Glycine max Wm82.a4.v1), apple (Malus domestica v1.1), grape (Vitis vinifera v2.1), poplar (Populus trichocarpa v4.1), and peach (Prunus persicav2.1). Combined with the Sapindus mukorossi SmMADS gene family, the MADS protein sequences of multiple species were MUSCLE aligned using MEGA7, and phylogenetic trees for Type I and Type II subfamilies were reconstructed using the NJ nearest neighbor method. The bootstrap parameter was checked and set to 1000 replicates.

[0079] The AP3 amino acid sequences of each species were screened and phylogenetic analysis was performed. (See attached image.) Figure 2 The number of AP3 proteins in Arabidopsis thaliana, grape, soybean, peach, apple and Sapindus mukorossi in each group were 1, 2, 2, 9, 3 and 1, respectively. Evolution shows that SmAP3 and soybean AP3 proteins are distantly related, and the regulatory functions of AP3 proteins in different species are significantly different.

[0080] The promoter sequences of the SmMADS gene family upstream of the coding region in Type I and Type II subclasses were taken respectively. The cis-regulatory elements were predicted using the online data analysis software PlantCARE, and statistical plotting was performed using Excel. (See figure) Figure 3 .

[0081] Figure 3 This indicates that the expression of SmAP3 transcription factors may be involved in the response to various biotic and abiotic stresses, possessing the ability to sense and respond to environmental stresses, plant hormones, and photoperiod, and participating in the regulation of plant growth and development. Besides some common basic elements (TATA), SmAP3 has four other main categories:

[0082] (1) Hormone regulation-related elements: Jasmonic acid response elements (CGTCA-motif and TGACG-motif);

[0083] (2) Relevant elements for plant growth and development regulation (AAGAA-motif and O2-site);

[0084] (3) Drought-induced binding site-related elements (MYB and MYC) and anaerobic-related elements (ARE) respond to plant abiotic stress;

[0085] (4) A large number of photoperiodic response elements (TCT-motif and G-box) regulate the diurnal rhythm of plants.

[0086] Protein function and structure are closely related. Therefore, the three-dimensional structure of the SmAP3 protein was constructed using the online SWISS-MODEL website, see [link to SmAP3 structure]. Figure 4 .

[0087] RNA extraction and real-time fluorescence quantitative assay

[0088] All centrifuge tubes, pipette tips, and mortars used in the experiment were sterile. Samples from various tissue parts of *Sapindus mukorossi* were ground with liquid nitrogen, and total RNA was extracted using the Omega RNA kit. RNA concentration was determined using a NanoDrop 2000 spectrophotometer (ThermoScientific, USA). RNA integrity was assessed by 1% agarose gel electrophoresis. cDNA was synthesized using the TransScript All-in-One First-Strand cDNA Synthesis SuperMIX for qPCR reverse transcription kit, and the obtained cDNA was diluted with nuclease-free water.

[0089] The SmAP3 gene was subjected to qRT-PCR using TB Green Premix Ex Taq (SYBR Green) enzyme, while SmACT was used as an internal control gene for quantitative real-time PCR. The primer sequences for the gene's quantitative real-time PCR are shown in Table 3.

[0090] Table 3 qRT-PCR amplification reaction system

[0091]

[0092] The qRT-PCR reaction program was set as follows: 95℃ for 30 s; 95℃ for 5 s, 61℃ for 30 s, for 40 cycles. After cycling, product specificity was detected using melting curve analysis: the temperature was slowly increased from 60℃ to 95℃, with 5 fluorescence signals collected for each 1℃ increase. The Sapindus mukorossi SmACT gene was used as an internal control for detection. Three biological replicates and three technical replicates were set up, and the average value was calculated. A 23 -ΔΔCt Gene expression levels were calculated and plotted using a method.

[0093] like Figure 5 As shown, the expression pattern of SmAP3 in trophic organs was similar in each of the eight developmental stages of male and female flowers. The expression of SmAP3 gene showed an initial increase followed by a slow decrease, with the highest expression level in both male and female flowers at stage 2 (stamen meiosis).

[0094] Figure 6 In the diagram, PiFF4 represents the pistil of female flowers during the rapid elongation phase of the filament and style; PiFF7 represents the pistil of female flowers during the flowering and development phase; PiMF4 represents the pistil of male flowers during the rapid elongation phase of the filament and style; PiMF7 represents the pistil of male flowers during the flowering and development phase; StFF4 represents the stamen of female flowers during the rapid elongation phase of the filament and style; StFF7 represents the stamen of female flowers during the flowering and development phase; StMF4 represents the stamen of male flowers during the rapid elongation phase of the filament and style; StMF7 represents the stamen of male flowers during the flowering and development phase; PeFF represents the petals of female flowers; PeMF represents the petals of male flowers. It can be seen that the SmAP3 gene participates in regulating the development of stamens, pistils, and petals, especially showing the most significant expression in the pistils of female flowers during stage 4 (rapid elongation phase of the filament and style) and stage 7 (flowering and development phase).

[0095] Figure 7 and Figure 8 The expression trend of the SmAP3 gene is similar across the eight stages of pericarp and seed development, with the highest expression level in stage 1 (early fruiting stage) and then a slow decline.

[0096] See Figure 9 SmAP3 is almost not expressed in the bud1-3 stage of Sapindus mukorossi flower buds, but its expression level is significantly increased in the bud4 stage (inflorescence differentiation stage).

[0097] Construction of SmAP3 gene overexpression vector

[0098] The SmAP3 bacterial culture plasmid with a confirmed sequence was extracted using a high-purity plasmid DNA miniprep kit. The pCAMBIA1301 plasmid (preserved in our laboratory) was double-digested with restriction endonucleases BstEII-HF and Ncol-HF. The digestion system is shown in Table 4. The reaction program was 37℃ for 30 min. After digestion, the vector was purified using a DNA gel extraction kit and detected by electrophoresis. The digested products were stored at -20℃.

[0099] Table 4. Enzyme digestion reaction system for the 1301 expression vector

[0100]

[0101] use II. The vector was ligated using the One Step Cloning Kit. The ligation system is shown in Table 5. The pCAMBIA1301-SmAP3 overexpression vector was obtained. The recombinant was introduced into Agrobacterium GV3101 competent cells for subsequent infection of Arabidopsis thaliana.

[0102] Table 5. 1301 expression vector ligation reaction system

[0103]

[0104] Cultivation and Infection of Wild-type Arabidopsis

[0105] Under sterile conditions, take an appropriate amount of wild-type Arabidopsis seeds, place them in a 1.5ml centrifuge tube, add 1 / 50 volume of sodium hypochlorite solution, mix well, shake repeatedly up and down for 10-15 minutes, and after sterilization, wash 4-5 times with sterile distilled water. Spread the seeds evenly on sterilized 1 / 2MS solid medium, vernalize at 4℃ for 3 days, and then expose to light for one week. Transplant the Arabidopsis seedlings into sterilized culture soil (a mixture of substrate soil and vermiculite = 1:1) and place them in a light incubator for long-day (16 / 8h) cultivation at 22℃ and a relative moisture content of 70%. Transform Arabidopsis plants using the flower immersion method. When the Arabidopsis plants have bolted and grown 3-4 stem leaves, remove the terminal inflorescence from all plants simultaneously to utilize apical dominance to promote lateral branch growth and flowering. A large number of unopened flower buds were infected with Agrobacterium, soaked for 15-30 seconds, and then dried. The plants were then placed in a dark environment for about 24 hours. The infection was repeated 4 times during the flowering period, with an interval of about one week between each infection, to improve the conversion efficiency.

[0106] Screening and identification of transgenic Arabidopsis thaliana

[0107] After infection with Arabidopsis thaliana, seeds were mixed and harvested to obtain the first generation (T0 generation). These seeds were sown on 1 / 2 MS solid medium containing 30 mg / L hygromycin. Normally growing transgenic seedlings were selected. For resistant plants, DNA was extracted and used as a template for PCR amplification and molecular testing according to the Plant Direct PCR Kit instructions. Gel electrophoresis was used to observe the presence of the target band. The above process was repeated to obtain T2 generation homozygous transgenic plants. Subsequent phenotypic observation and functional analysis were then performed.

[0108] DNA was extracted from leaves of WT wild-type Arabidopsis thaliana and 35S::SmAP3 overexpressing plants, respectively, and used as templates for SmAP3 gene detection. The results are as follows: Figure 10 As shown in the figure, Marker represents the DL2000 marker; WT represents wild-type Arabidopsis thaliana; OE represents the 35S::SmAP3 plant. According to... Figure 10 Wild-type lines served as the control group and did not show any bands. The T1 generation lines that were successfully transfected with the exogenous gene showed the target bands. A total of 6 lines were verified.

[0109] During the growth of wild-type and transgenic Arabidopsis thaliana, the bolting time, flowering time, and number of rosette leaves were recorded and compared in real time. ANOVA analysis was performed using IBM SPSS Statistics 27 software to obtain the mean, standard deviation, etc., and graphs were generated using Excel 2020 software.

[0110] Figure 11Figure A and Figure B show a comparison between wild-type Arabidopsis thaliana (left) and 35S::SmAP3 transgenic plants (right). Figure A shows that overexpression of the SmAP3 gene in Arabidopsis thaliana affects bolting and flowering time, causing earlier flowering. Figure B shows that the flower morphology is normal, and the number of petals, sepals, pistils, and stamens are all normally developed. Compared to the wild type, half of the 35S::SmAP3 transgenic plants showed a slight increase in pistil size, and this phenomenon was evident in 3 out of 6 lines. Figure C shows that at the same fold increase, the number and size of stamens in 35S::SmAP3 plants are consistent with those in the wild type, further confirming the increase in pistil size in 35S::SmAP3 plants. Figure D shows that the inflorescences of 35S::SmAP3 plants are indeterminate, just like the wild type. Figures E and F show that the pod size and seed setting rate of the 35S::SmAP3 plant are consistent with those of the wild type.

[0111] The results comparing the flowering time of the wild-type and the 35S::SmAP3 transgenic lines can be found in [link to relevant documentation]. Figure 12 . Figure 12 In Figure G: the left side shows the WT wild-type plant, from left to right, 35S::SmAP3#2; Figure H: the first plant on the left is the WT wild-type plant, from left to right, 35S::SmAP3#3, 35S::SmAP3#5, and 35S::SmAP3#7 transgenic plants; Figure I: from left to right, WT wild-type plant, 35S::SmAP3#8, and 35S::SmAP3#9 transgenic plants. It can be seen that the flowering time of all six 35S::SmAP3 transgenic lines is earlier than that of WT Arabidopsis.

[0112] Figure 13 In Figures a through c, WT represents wild-type Arabidopsis thaliana, with a total of six 35S::SmAP3 transgenic lines. Figure a: Statistical analysis of bolting time (days); Figure b: Statistical analysis of rosette leaves (number of leaves) at bolting; Figure c: Statistical analysis of flowering time (days). The bolting time (Figure b) and flowering time (Figure c) of these six lines were significantly different from those of the wild-type plants, and SPSS analysis showed statistical significance. The bolting time of wild-type Arabidopsis thaliana was 20.16 days, with 12.83 rosette leaves at bolting, and the flowering time was 22 days; the bolting time of the six transgenic lines was 15.16 days, with 11 rosette leaves at bolting, and the flowering time was 17 days. The flowering time of 35S::SmAP3 plants was advanced to varying degrees, specifically by 5 days. Furthermore, the number of rosette leaves in most 35S::SmAP3 transgenic lines was positively correlated with the bolting time; the earlier the bolting, the fewer the number of rosette leaves.

[0113] Study on the expression patterns of endogenous genes in transgenic plants

[0114] Representative transgenic lines were selected from Arabidopsis thaliana exhibiting differences in flowering time. Flowers from positive transgenic plants and wild-type Arabidopsis thaliana were extracted. RNA was extracted from WT wild-type plants and 35S::SmAP3#2, 35S::SmAP3#5, and 35S::SmAP3#8 transgenic plants, respectively, and detected by electrophoresis. All samples showed clear and intact total RNA bands. cDNA was obtained by reverse transcription and used as a template for subsequent qRT-PCR experiments. The AtEF1 gene was used as an internal control gene. The quantitative PCR method was the same as described above. Simultaneously, AtEF1 was used as an internal control gene for quantitative PCR experiments. The primer sequences for quantitative PCR of the genes are shown in Table 6.

[0115] Use 2 -ΔΔCt Gene expression levels were calculated and plotted using a method.

[0116] Table 6 Primers for quantitative real-time PCR.

[0117]

[0118] To further investigate gene regulation in 35S::SmAP3 transgenic plants and explain their phenotypic changes at the molecular level, the expression levels of genes upstream and downstream of AP3 regulating flowering time were measured in the floral tissues of Arabidopsis thaliana and compared with those in wild-type plants subjected to WT. (See [link to relevant documentation]). Figure 11 . Figure 11 In the study, WT represents wild-type Arabidopsis thaliana plants and transgenic lines 35S::SmAP3#2, 35S::SmAP3#5, and 35S::SmAP3#8. Firstly, the expression level of the SmAP3 gene in the floral parts of the 35S::SmAP3 transgenic plants was extremely high, significantly different from the wild type, indicating that the SmAP3 gene regulates flowering time, and its overexpression leads to earlier flowering in Arabidopsis thaliana.

[0119] In the tissues of 35S::SmAP3 Arabidopsis thaliana flowers, the expression levels of genes such as AtSOC1, AtLFY, AtSEP2, AtCAL, AtCO, AtAP3, AtSHP1, AtSHP2, AtSEP3, AtSEP1, AtPI, AtFT, and AtSTK were higher than those in the wild type. The expression levels of genes such as AtSVP and AtTFL1 were lower than those in the wild type.

[0120] In Arabidopsis flower tissues, the expression levels of genes related to flowering time (AtFT and AtSOC1), floral organ development (AtAP3 and AtPI), and flowering meristem regulators (AtLFY and AtCAL) were higher than in the wild type, while the expression levels of flowering inhibitors (AtTFL1 and AtSVP) were lower. Therefore, overexpression of the SmAP3 gene promoted the expression of flowering integrons and flowering meristem regulators, resulting in earlier bolting and flowering in the 35S::SmAP3 transgenic Arabidopsis.

[0121] This embodiment demonstrates, using the model plant Arabidopsis thaliana, that the Sapindus mukorossi SmAP3 gene can be used to cultivate new Sapindus mukorossi varieties with different flowering times; the SmAP3 gene can be used to regulate flowering time to obtain new varieties with desired flowering characteristics. This embodiment also describes a plant transgenic method for introducing the expression vector into plant cells to alter the flowering time of plants. This embodiment further describes a method for analyzing the expression patterns of genes related to flowering time regulation by measuring the expression levels of the SmAP3 gene at different developmental stages. This embodiment also describes a method for determining the expression levels of genes related to flowering time regulation in transgenic plants using the described quantitative fluorescent primer pairs.

[0122] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A type of soapberry SmAP3 Genes, characterized by, The SmAP3 The nucleotide sequence of the gene is selected from the following group: A. The nucleotide sequence shown in Seq ID NO.1 of the sequence listing; B. The nucleotide sequence of the amino acid sequence shown in Seq ID NO.2 of the coding sequence listing.

2. A soapberry variety according to claim 1 SmAP3 Gene-encoded proteins are characterized by, The amino acid sequence of the protein is selected from the amino acid sequence shown in Sequence Listing Seq ID NO.

2.

3. A method for cloning the Sapindus mukorossi as described in claim 1 SmAP3 A primer pair for a gene, characterized in that, The base sequences of the primer pairs are as follows: First upstream primer F: 5'-ATGGCTAGAGGGAAAATCCAGA-3', First downstream primer R: 5'-CTACTCAAGCAAAGGGTAAATTTTG-3'.

4. A primer pair for cloning the Sapindus mukorossi SmAP3 gene as described in claim 1, characterized in that, The primer pair contains restriction enzyme sites, and the base sequence is as follows: Second upstream primer F: 5'-AGACACGGGGGACTCTTGACATGGCTAGAGGGAAAATCCAGA-3'. Second downstream primer R: 5'- GGGGAAATTCGAGCTGGTCACCTACTCAAGCAAAGGGTAAATTTTG -3'.

5. A method for processing the soapberry according to claim 1 SmAP3 Fluorescent quantitative primer pairs for gene quantification analysis are characterized by, The base sequences of the fluorescence quantitative primer pairs are as follows: The third upstream primer F: 5'-CTCAACAAACAGGCAGGTCA-3', Third downstream primer R: 5'-ATCGATCCCCAAGTTCCTCT-3'.

6. A type of soapberry containing the soapberry of claim 1 SmAP3 Gene expression vectors, characterized in that, The pCAMBIA1301 vector plasmid was double-digested with restriction endonucleases BstEII-HF and Ncol-HF, and the vector was ligated using the ClonExpress® II One Step Cloning Kit to obtain the overexpression vector pCAMBIA1301-SmAP3. 。 7. A soapberry according to claim 1 SmAP3 The uses of genes, characterized by, Used to cultivate new varieties of Sapindus mukorossi with earlier flowering time.

8. A method for cultivating new plant varieties, characterized in that, Overexpression of the claim 1 SmAP3 Genes advance the flowering time to obtain new varieties with desired flowering characteristics; the plant in question is either Arabidopsis thaliana or Sapindus mukorossi.

9. A method for transgenic plants, characterized in that, This includes introducing the expression vector of claim 6 into plant cells to advance the flowering time of the plant, wherein the plant is Arabidopsis thaliana or Sapindus mukorossi.

Images