A cell line for specific quantitative calibration of interleukin-15 activity and its application

Abstract

The present invention provides a cell line for specific quantitative calibration of interleukin 15 (IL-15) activity and its application. Specifically, the present invention provides a construct, a vector, a host cell, a kit and its application and preparation method. The construct, the vector, the host cell and the kit of the present invention can be used to construct an IL-15 reporter cell for specific quantitative calibration of interleukin 15 (IL-15) activity, thereby achieving stable, highly accurate and highly sensitive quantitative detection of IL-15 activity, and providing accurate quality control means for the development of IL-15 related drugs.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more specifically to a cell line for specifically quantitatively calibrating interleukin 15 (IL-15) activity and an application thereof. Background Art

[0002] IL-15 is a T cell growth factor, mainly produced by monocytes and macrophages. IL-15 mRNA is expressed in many tissues of the human body, such as the heart, lungs, kidneys, and especially the placenta and muscles. IL-15Rα is widely expressed in humans and mice. The main mechanism of the IL-15 signaling pathway is that after IL-15 binds to the IL-15Rα subunit on the cell, IL-15 stays on the cell surface and forms an immune synapse with the IL-2R / IL-15Rβ-γc on the nearby effector NK cells or T cells, activating the JAK1 / JAK3 and STAT3 / STAT5 pathways. IL-15 has similar biological functions to IL-2 and can induce the differentiation and proliferation of T cells, B cells, and natural killer cells (NK cells). At present, IL-15 is often used in combination with IL-2 for in vitro expansion and culture of T cells or NK cells. Another characteristic of IL-15 in immunotherapy is that it maintains memory T cells, thus playing an important role in long-term anti-tumor activity. As a multi-effect cytokine, IL-15 plays an important role in immunity, tumorigenesis, allergic reactions and autoimmune diseases. Therefore, it is particularly important to detect and compare the biological activity of IL-15 with high precision. The storage stability test of its drug activity is also a crucial step in the drug development process.

[0003] In the prior art, the detection method for cytokines such as IL-15 activity has a background leakage expression of the reporter gene due to the inherent transcription initiation activity of the LTR sequence on the viral vector backbone, which greatly reduces the detection accuracy and sensitivity of the target cytokine. Therefore, the art needs to develop a highly accurate and sensitive detection method for quantitatively calibrating IL-15 activity. Summary of the invention

[0004] The purpose of the present invention is to provide a cell line for specific quantitative calibration of interleukin 15 (IL-15) activity and its application in detecting IL-15 activity.

[0005] In a first aspect of the present invention, a construct is provided, comprising:

[0006] (i) a first construct comprising an expression cassette for expressing a CD132 protein;

[0007] (ii) a second construct comprising an expression cassette for expressing a CD122 protein;

[0008] (iii) a third construct, wherein the third construct contains an expression cassette for expressing a STAT5 protein;

[0009] (iv) a fourth construct comprising an expression cassette for expressing a CD25 protein;

[0010] (v) a fifth construct comprising an expression cassette for expressing a JAK3 protein; and

[0011] (vi) a sixth construct comprising an expression cassette for inducible expression of a reporter protein.

[0012] In another preferred embodiment, the coding sequence of the CD132 protein is shown in SEQ ID NO: 2.

[0013] In another preferred embodiment, the coding sequence of the CD122 protein is shown in SEQ ID NO: 3.

[0014] In another preferred embodiment, the STAT5 protein is STAT5b protein.

[0015] In another preferred example, the coding sequence of the STAT5b protein is shown in SEQ ID NO: 4.

[0016] In another preferred embodiment, the coding sequence of the CD25 protein is shown in SEQ ID NO: 5.

[0017] In another preferred example, the coding sequence of the JAK3 protein is shown in SEQ ID NO: 6.

[0018] In another preferred embodiment, the reporter protein is encoded by a reporter gene.

[0019] In another preferred embodiment, the reporter protein is selected from the following group: fluorescent protein, β-galactosidase, luciferase, chloramphenicol acetyltransferase, human growth hormone (hGH), secretory alkaline phosphatase (SEAP), antibiotic resistance protein, or a combination thereof.

[0020] In another preferred embodiment, the reporter protein is luciferase.

[0021] In another preferred embodiment, the fluorescent protein is selected from the following group: green fluorescent protein, red fluorescent protein, blue fluorescent protein, yellow fluorescent protein, cyan fluorescent protein, orange fluorescent protein, or a combination thereof.

[0022] In another preferred embodiment, the reporter gene is selected from the following group: fluorescent protein gene, β-galactosidase gene, luciferase gene, chloramphenicol acetyltransferase gene, human growth hormone gene, secretory alkaline phosphatase gene, antibiotic resistance gene, or a combination thereof.

[0023] In another preferred embodiment, the expression cassette of the first construct, the second construct, the third construct, the fourth construct, the fifth construct and / or the sixth construct further contains a promoter.

[0024] In another preferred embodiment, the first construct, the second construct, the third construct, the fourth construct, the fifth construct and / or the sixth construct further contain a marker gene.

[0025] In another preferred embodiment, the marker gene is a resistance gene.

[0026] In another preferred embodiment, the resistance gene is selected from the following group: hygromycin resistance gene, blasticidin resistance gene, neomycin resistance gene, puromycin resistance gene, ampicillin resistance gene, tetracycline resistance gene, kanamycin resistance gene, chloramphenicol resistance gene, bleomycin resistance gene, or a combination thereof.

[0027] In another preferred embodiment, the first construct, the second construct, the third construct, the fourth construct, the fifth construct and / or the sixth construct further contain a promoter for driving the expression of a marker gene.

[0028] In another preferred embodiment, the promoter is a constitutive promoter, an inducible promoter and / or a tissue-specific promoter.

[0029] In another preferred embodiment, the promoter is selected from the following group: CMV promoter, EF1a promoter, PGK promoter, U6 promoter, H1 promoter, ubiquitin promoter, CAG promoter, T7 promoter, SV40 promoter, CBh promoter, CBA promoter, ACTB promoter, SFFV promoter, MSCV promoter, MND promoter, or a combination thereof.

[0030] In another preferred embodiment, the inducible promoter is selected from the following group: a chemically inducible promoter (such as a tetracycline-inducible promoter), a light-inducible promoter, a temperature-inducible promoter, a hormone-inducible promoter, an adverse stress-inducible promoter, or a combination thereof.

[0031] In another preferred embodiment, the inducible promoter is RE340 promoter.

[0032] In another preferred example, the RE340 promoter has a sequence as shown in SEQ ID NO: 7.

[0033] In another preferred example, the first construct, the second construct, the third construct, the fourth construct, the fifth construct and / or the sixth construct are independent or connected in series.

[0034] In another preferred example, the first construct, the second construct, the third construct, the fourth construct, the fifth construct and / or the sixth construct are located on the same or different vectors.

[0035] In another preferred example, the first construct and the second construct are located on the same vector.

[0036] In another preferred example, the first construct and the second construct are connected in series.

[0037] In another preferred embodiment, when the first construct and the second construct are located in the same vector, an expression cassette for expressing a connecting peptide is further included between the first construct and the second construct.

[0038] In another preferred example, the third construct and the fourth construct are located on the same vector.

[0039] In another preferred example, the third construct and the fourth construct are connected in series.

[0040] In another preferred embodiment, when the third construct and the fourth construct are located in the same vector, an expression cassette for expressing a connecting peptide is further included between the third construct and the fourth construct.

[0041] In another preferred embodiment, the first construct further contains CMV promoter and / or EF1a promoter.

[0042] In another preferred embodiment, the second construct further contains a CMV promoter and / or an EF1a promoter.

[0043] In another preferred embodiment, the third construct further contains EF1a promoter and / or PGK promoter.

[0044] In another preferred embodiment, the fourth construct further contains EF1a promoter and / or PGK promoter.

[0045] In another preferred embodiment, the fifth construct further contains CMV promoter and / or EF1a promoter.

[0046] In another preferred embodiment, the sixth construct further contains RE340 promoter.

[0047] In another preferred embodiment, the reporter protein in the sixth construct is induced to express when the STAT5 protein is phosphorylated.

[0048] In another preferred embodiment, the STAT5 protein phosphorylation is induced by IL-15.

[0049] In another preferred embodiment, the first construct and the second construct are located on the same vector, the third construct and the fourth construct are located on the same vector, and the construct comprises:

[0050] (Z1) a first construct, wherein the first construct comprises an expression cassette for expressing CD132 protein, wherein the expression cassette comprises the sequence shown in SEQ ID NO: 2 and a CMV promoter;

[0051] (Z2) a second construct, wherein the second construct contains an expression cassette for expressing CD122 protein, wherein the expression cassette contains the sequence shown in SEQ ID NO: 3;

[0052] (Z3) a third construct, wherein the third construct comprises an expression cassette for expressing a STAT5b protein, wherein the expression cassette comprises the sequence shown in SEQ ID NO: 4;

[0053] (Z4) a fourth construct, wherein the fourth construct comprises an expression cassette for expressing a CD25 protein, wherein the expression cassette comprises a sequence as shown in SEQ ID NO: 5 and an EF1a promoter;

[0054] (Z5) a fifth construct, comprising an expression cassette for expressing a JAK3 protein, wherein the expression cassette comprises a sequence as shown in SEQ ID NO: 6 and a CMV promoter; and

[0055] (Z6) a sixth construct, wherein the sixth construct contains an expression cassette for inducing expression of luciferase, wherein the expression cassette contains a coding sequence of luciferase and a RE340 promoter;

[0056] Wherein, the CMV promoter in the first construct drives the expression of CD132 protein and CD122 protein at the same time; the EF1a promoter in the fourth construct drives the expression of CD25 protein and STAT5b protein at the same time;

[0057] An expression cassette for expressing a connecting peptide is further included between the first construct and the second construct and between the third construct and the fourth construct;

[0058] The luciferase is induced to express when the STAT5b protein is phosphorylated, and the sequence of the RE340 promoter is shown in SEQ ID NO: 7.

[0059] In another preferred embodiment, the connecting peptide is P2A or T2A or F2A or E2A.

[0060] In another preferred example, the second construct further contains a hygromycin resistance gene.

[0061] In another preferred embodiment, the second construct further contains an EF1a promoter for driving the expression of a hygromycin resistance gene.

[0062] In another preferred embodiment, the third construct further contains a blasticidin resistance gene.

[0063] In another preferred embodiment, the third construct further contains a PGK promoter for driving the expression of a blasticidin resistance gene.

[0064] In another preferred example, the fifth construct further contains a neomycin resistance gene.

[0065] In another preferred embodiment, the fifth construct further contains an EF1a promoter for driving the expression of a neomycin resistance gene.

[0066] In another preferred example, the sixth construct further contains a puromycin resistance gene.

[0067] In another preferred example, the sixth construct further contains a splicing acceptor (SA) element.

[0068] In another preferred embodiment, the sixth construct contains an expression cassette for inducing the expression of luciferase and an expression cassette for expressing a puromycin resistance gene.

[0069] In another preferred embodiment, the puromycin resistance gene is expressed by an endogenous promoter.

[0070] In the second aspect of the present invention, a vector is provided, wherein the vector contains the construct as described in the first aspect of the present invention.

[0071] In another preferred embodiment, the vector is selected from the following group: DNA, RNA, viral vector, plasmid, transposon, other gene transfer systems, or a combination thereof.

[0072] In another preferred embodiment, the viral vector is selected from the following group: lentivirus, adenovirus, AAV virus, retrovirus, or a combination thereof.

[0073] In another preferred embodiment, the viral vector is a lentiviral vector.

[0074] In another preferred embodiment, the viral vector is an AAV viral vector.

[0075] In another preferred embodiment, the vector is a plasmid.

[0076] In another preferred embodiment, the vector is selected from the following group: pCDH, pTomo, plenti, pLVTH, pLJM1, pHCMV, pLBS.CAG, pHR, pLV, etc., or a combination thereof.

[0077] In another preferred embodiment, the vector is a pCDH series vector.

[0078] In another preferred embodiment, the vector is a ZFN donor plasmid.

[0079] In another preferred embodiment, the vector further comprises an element selected from the following group: a promoter, a transcription enhancing element WPRE, a long terminal repeat sequence LTR, etc., or a combination thereof.

[0080] In the third aspect of the present invention, a host cell is provided, wherein the host cell comprises the vector as described in the second aspect of the present invention, or the construct as described in the first aspect of the present invention is integrated into its genome.

[0081] In another preferred embodiment, the host cell includes a prokaryotic cell or a eukaryotic cell.

[0082] In another preferred embodiment, the host cell is selected from the group consisting of Escherichia coli, yeast cells, mammalian cells, or a combination thereof.

[0083] In another preferred embodiment, the host cell is a 293T cell.

[0084] In another preferred embodiment, the host cell is a cell line for specific quantitative calibration of interleukin 15 (IL-15) activity.

[0085] In a fourth aspect of the present invention, a kit is provided, the kit comprising a container, and the construct according to the first aspect of the present invention or the vector according to the second aspect of the present invention located in the container.

[0086] In another preferred embodiment, the kit comprises a container, and located in the container:

[0087] (i) a first construct comprising an expression cassette for expressing a CD132 protein;

[0088] (ii) a second construct comprising an expression cassette for expressing a CD122 protein;

[0089] (iii) a third construct, wherein the third construct contains an expression cassette for expressing a STAT5 protein;

[0090] (iv) a fourth construct comprising an expression cassette for expressing a CD25 protein;

[0091] (v) a fifth construct comprising an expression cassette for expressing a JAK3 protein; and

[0092] (vi) a sixth construct comprising an expression cassette for inducible expression of a reporter protein.

[0093] In another preferred example, the first construct, the second construct, the third construct, the fourth construct, the fifth construct and / or the sixth construct are located in the same or different containers.

[0094] In another preferred example, the first construct and the second construct are located in the same container.

[0095] In another preferred example, the third construct and the fourth construct are located in the same container.

[0096] In another preferred embodiment, the kit further comprises instructions.

[0097] In another preferred embodiment, the instructions indicate a method for using the kit to prepare the host cell as described in the third aspect of the present invention.

[0098] In another preferred embodiment, the instructions specify a method for specifically quantifying the activity of interleukin 15 (IL-15).

[0099] In another preferred embodiment, the kit further comprises: IL-15 standard.

[0100] In the fifth aspect of the present invention, a use of the construct as described in the first aspect of the present invention, the vector as described in the second aspect of the present invention, or the kit as described in the fourth aspect of the present invention is provided for preparing the host cell as described in the third aspect of the present invention.

[0101] In the sixth aspect of the present invention, a use of the construct as described in the first aspect of the present invention, the vector as described in the second aspect of the present invention, the host cell as described in the third aspect of the present invention, or the kit as described in the fourth aspect of the present invention is provided for preparing a cell line for specific quantitative calibration of interleukin 15 (IL-15) activity.

[0102] In another preferred embodiment, the cell line is 293T cell line.

[0103] In a seventh aspect of the present invention, a method for preparing the host cell according to the third aspect of the present invention is provided, the method comprising the steps of:

[0104] (S1) providing cells to be modified; and

[0105] (S2) Introducing the construct described in the first aspect of the present invention or the vector described in the second aspect of the present invention into the cell, thereby obtaining the host cell.

[0106] In another preferred embodiment, the host cell expresses CD132 protein, CD122 protein, STAT5 protein, CD25 protein and JAK3 protein.

[0107] In another preferred embodiment, when the host cell is contacted with IL-15, the host cell is induced to express a reporter protein.

[0108] In another preferred embodiment, when the host cell is not contacted with IL-15, the host cell does not express the reporter protein.

[0109] In another preferred embodiment, the cells to be transformed are 293T cells.

[0110] In another preferred embodiment, the host cell is a 293T cell.

[0111] In another preferred embodiment, the method is an in vitro method.

[0112] In another preferred embodiment, the method is for non-disease treatment purposes or non-disease diagnosis purposes.

[0113] In an eighth aspect of the present invention, a method for preparing a cell line for specifically quantitatively calibrating interleukin 15 (IL-15) activity is provided, the method comprising the steps of:

[0114] (S1) providing cells to be modified;

[0115] (S2) knocking a reporter gene into the AAVS1 site of the cell genome using gene editing technology, wherein the reporter gene is an inducible expression reporter gene, and the reporter gene is induced to express when the STAT5 protein is phosphorylated;

[0116] (S3) introducing the following construct into the cells obtained in step (S2):

[0117] (i) a first construct comprising an expression cassette for expressing a CD132 protein;

[0118] (ii) a second construct comprising an expression cassette for expressing a CD122 protein;

[0119] (iii) a third construct, wherein the third construct contains an expression cassette for expressing a STAT5 protein;

[0120] (iv) a fourth construct comprising an expression cassette for expressing a CD25 protein; and

[0121] (v) a fifth construct, the fifth construct comprising an expression cassette for expressing a JAK3 protein;

[0122] Thus, the cell line for specific quantitative calibration of interleukin 15 (IL-15) activity is obtained.

[0123] In another preferred embodiment, the method is an in vitro method.

[0124] In another preferred embodiment, the method is for non-disease treatment purposes or non-disease diagnosis purposes.

[0125] In another preferred embodiment, the gene editing technology is CRISPR / Cas9.

[0126] In another preferred example, the gene editing technology in the step (S2) uses sgRNA, and the template sequence of the sgRNA is shown in SEQ ID NO: 1.

[0127] In another preferred embodiment, the cells to be transformed are 293T cells.

[0128] In another preferred embodiment, the cell line for specific quantitative calibration of interleukin 15 (IL-15) activity is 293T cell line.

[0129] In another preferred embodiment, when the cell line specifically quantifying interleukin 15 (IL-15) activity is contacted with IL-15, the reporter gene is induced to express.

[0130] In another preferred embodiment, when the cell line for specifically quantitatively marking interleukin 15 (IL-15) activity is not contacted with IL-15, the reporter gene is not expressed.

[0131] In another preferred embodiment, the reporter gene is a luciferase reporter gene.

[0132] In another preferred embodiment, the STAT5 protein is STAT5b protein.

[0133] In another preferred embodiment, the step (S2) uses a sixth construct, which contains an expression cassette for inducing the expression of luciferase, wherein the expression cassette contains a coding sequence of luciferase and a RE340 promoter, and the sequence of the RE340 promoter is shown in SEQ ID NO: 7.

[0134] In another preferred embodiment, the method comprises the steps of: constructing the first, second, third, fourth, fifth and / or sixth construct.

[0135] In another preferred embodiment, the method comprises the step of constructing a vector containing the first, second, third, fourth, fifth and / or sixth construct.

[0136] In another preferred embodiment, the method comprises the steps of: constructing a host cell, wherein the host cell comprises a vector containing the first, second, third, fourth, fifth and / or sixth construct, or the first, second, third, fourth, fifth and / or sixth construct is integrated into its genome.

[0137] In another preferred embodiment, the first construct and the second construct are located on the same vector, the third construct and the fourth construct are located on the same vector, and the construct comprises:

[0138] (Z1) a first construct, wherein the first construct comprises an expression cassette for expressing CD132 protein, wherein the expression cassette comprises the sequence shown in SEQ ID NO: 2 and a CMV promoter;

[0139] (Z2) a second construct, wherein the second construct contains an expression cassette for expressing CD122 protein, wherein the expression cassette contains the sequence shown in SEQ ID NO: 3;

[0140] (Z3) a third construct, wherein the third construct comprises an expression cassette for expressing a STAT5b protein, wherein the expression cassette comprises the sequence shown in SEQ ID NO: 4;

[0141] (Z4) a fourth construct, wherein the fourth construct comprises an expression cassette for expressing a CD25 protein, wherein the expression cassette comprises a sequence as shown in SEQ ID NO: 5 and an EF1a promoter;

[0142] (Z5) a fifth construct, comprising an expression cassette for expressing a JAK3 protein, wherein the expression cassette comprises a sequence as shown in SEQ ID NO: 6 and a CMV promoter; and

[0143] (Z6) a sixth construct, wherein the sixth construct contains an expression cassette for inducing expression of luciferase, wherein the expression cassette contains a coding sequence of luciferase and a RE340 promoter;

[0144] Wherein, the CMV promoter in the first construct drives the expression of CD132 protein and CD122 protein at the same time; the EF1a promoter in the fourth construct drives the expression of CD25 protein and STAT5b protein at the same time;

[0145] An expression cassette for expressing a connecting peptide is further included between the first construct and the second construct and between the third construct and the fourth construct;

[0146] The luciferase is induced to express when the STAT5b protein is phosphorylated, and the sequence of the RE340 promoter is shown in SEQ ID NO: 7.

[0147] In another preferred embodiment, the method further comprises the steps of:

[0148] (S4) A step of amplifying and / or detecting the cell line that specifically and quantitatively calibrates the activity of interleukin 15 (IL-15).

[0149] In another preferred embodiment, the detection includes activity detection.

[0150] In another preferred embodiment, the detection comprises:

[0151] (1) Determination of the expression of CD132 protein, CD122 protein, STAT5 protein, CD25 protein and / or JAK3 protein; and / or

[0152] (2) Identify whether the reporter gene that induces expression is inserted.

[0153] In another preferred embodiment, the detection includes PCR detection, flow cytometry and / or Western blot identification.

[0154] In the ninth aspect of the present invention, a cell line for specifically and quantitatively calibrating interleukin 15 (IL-15) activity is provided, wherein the cell line is prepared by the method described in the eighth aspect of the present invention.

[0155] In a tenth aspect of the present invention, a method for specifically quantifying interleukin 15 (IL-15) activity is provided, the method comprising:

[0156] (S1) providing the host cell according to the third aspect of the present invention or the cell line according to the ninth aspect of the present invention;

[0157] (S2) contacting the host cell or the cell line with the IL-15 to be tested; and

[0158] (S3) Quantitatively detecting the expression of the reporter protein or reporter gene at the detection time point, and characterizing the IL-15 activity by the expression amount of the reporter protein or reporter gene.

[0159] In another preferred embodiment, the host cell is a 293T cell.

[0160] In another preferred embodiment, the reporter protein is luciferase.

[0161] In another preferred embodiment, the method further comprises the steps of:

[0162] (i) providing a number of known concentrations of IL-15; and

[0163] (ii) contacting the host cells with the known concentration of IL-15, respectively; and

[0164] (iii) quantitatively detecting the expression of the reporter protein or reporter gene at the detection time point, and fitting a standard curve using the known concentration of IL-15 and the corresponding expression level of the reporter protein or reporter gene.

[0165] In another preferred embodiment, the method further comprises the steps of:

[0166] (iv) according to the expression level of the reporter protein or reporter gene corresponding to the IL-15 to be tested obtained by quantitative detection, the corresponding IL-15 concentration is obtained from the standard curve, and the IL-15 concentration represents the activity of the IL-15 to be tested.

[0167] In another preferred embodiment, the quantitative detection is performed by chemiluminescence.

[0168] In another preferred embodiment, the expression level of the reporter protein or reporter gene is characterized by the absorbance or fluorescence intensity of the reporter protein.

[0169] In another preferred embodiment, the detection time point is 2-12 hours, preferably 6-8 hours.

[0170] In another preferred embodiment, the limit of detection (LOD) of the method is ≤1 ng / ml, preferably ≤0.5 ng / ml, more preferably ≤0.1 ng / ml, and most preferably ≤0.05 ng / ml.

[0171] In another preferred example, the limit of detection (LOD) of the method is 0.05 ng / ml.

[0172] In another preferred embodiment, the quantitative detection limit (LOQ) of the method is ≤2 ng / ml, preferably ≤1 ng / ml, more preferably ≤0.5 ng / ml, and most preferably ≤0.1 ng / ml.

[0173] In another preferred example, the limit of quantification (LOQ) of the method is 0.1 ng / ml.

[0174] In another preferred embodiment, the method is for non-disease treatment purposes or non-disease diagnosis purposes.

[0175] In the eleventh aspect of the present invention, a use of the host cell according to the third aspect of the present invention or the cell line according to the ninth aspect of the present invention is provided for specific quantitative calibration of interleukin 15 (IL-15) activity.

[0176] In another preferred embodiment, the use is for non-disease treatment purposes or non-disease diagnosis purposes.

[0177] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0178] Figure 1 A schematic diagram of the signaling pathway is shown.

[0179] Figure 2 The results after the inducible promoter RE340 was inserted are shown: (A) PCR detection results; and (B) fragment Sanger sequencing results.

[0180] Figure 3 The expression detection of CD25 protein, CD122 protein, CD132 protein, and STAT5b protein is shown.

[0181] Figure 4 The expression of JAK3 protein is shown.

[0182] Figure 5 The flowchart for constructing 293T-IL15 reporter cells and performing element expression verification and IL-15 activity verification is shown.

[0183] Figure 6 A flow chart for IL-15 activity detection using chemiluminescence is shown.

[0184] Figure 7The RLU results of 293T-IL15 reporter cells at different time points under the action of the same concentration of IL-15 (10 ng / ml) are shown.

[0185] Figure 8 The luciferase results of 293T-IL15 reporter cells under the action of different concentrations of IL-15 are shown.

[0186] Fig. 9 Shown are the responses of 293T-IL15 reporter cells to stimulation with different interleukins.

[0187] Fig.10 Shows leaky expression of luciferase in cell lines after viral infection with STAT5-inducible luciferase reporter. DETAILED DESCRIPTION

[0188] After extensive and in-depth research and a large number of screenings, the inventors creatively discovered for the first time that by introducing elements that stably express CD132 protein, CD122 protein, CD25 protein, STAT5 protein (such as STAT5b protein) and JAK3 protein into cell lines such as 293T cells, and knocking in elements that induce the expression of reporter genes when STAT5 protein is phosphorylated at the AAVS1 site of the cell genome, the IL-15 reporter cells thus constructed can achieve reporter gene expression induced only when IL-15 is present. The IL-15 activity detection method constructed based on the IL-15 reporter cells of the present invention can avoid the background leakage expression of the reporter gene caused by the inherent transcription initiation activity of the LTR sequence on the viral vector backbone in conventional reporter plasmids or reporter cells, and thus can more stably, accurately and sensitively quantitatively detect IL-15 activity. The present invention was completed on this basis.

[0189] the term

[0190] In order that the present disclosure may be more readily understood, certain terms are first defined. As used in this application, unless otherwise expressly provided herein, each of the following terms shall have the meaning given below.

[0191] The term "about" can refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined.

[0192] The term "construct" refers to a DNA molecule constructed by genetic engineering technology, which usually contains elements such as a target gene, a promoter, and a selection marker, and is used to express a specific protein or RNA in a host cell.

[0193] The term "cell line" refers to a cell population obtained through in vitro culture that has specific biological characteristics and can continue to proliferate and be passed down.

[0194] As used herein, the term "IL-15 reporter cell" also refers to IL-15 reporter cell(s), IL-15reporter cell, which refers to the reporter cell line constructed in the present invention that can specifically and quantitatively calibrate the activity of interleukin 15 (IL-15), preferably a reporter cell line obtained by transformation based on 293T cells (such as 293T-IL15 reporter cells).

[0195] As used herein, the term "Splicing Acceptor (SA)" refers to the splicing site on the right side of the intron, which is one of the sequences on both sides of the splicing junctions at the cutting and rejoining sites. In contrast, the splicing donor (SD) is located on the left side of the intron. Preferably, the splicing acceptor (SA) is a Promoter-lesssplice-acceptor (SA), i.e., a promoter-free splicing acceptor, which is an important tool in genetic engineering and molecular biology research, and plays a key role in gene trapping technology in particular. Promoter-lesssplice-acceptor (SA) refers to a splicing acceptor element that does not contain a promoter in a gene trap vector. This structure makes SA not independently initiate transcription after integration into the host cell genome, but relies on the cis-regulatory elements (such as promoters, enhancers, etc.) of endogenous genes in the host cell genome to initiate transcription.

[0196] As used herein, the term "ZFN donor plasmid" refers to a donor DNA template designed for use in conjunction with zinc finger nucleases (ZFNs). ZFNs are a gene editing tool that can recognize and bind to a specific DNA sequence, thereby cutting the DNA double strand at that location. When ZFNs are used together with a donor plasmid, the DNA of the donor plasmid can be inserted into the DNA break generated by the ZFNs, thereby achieving precise gene editing. The ZFN donor plasmid may contain a splice acceptor (SA) element, such as a promoterless splice acceptor, which is used to capture and interrupt the expression of endogenous genes in the host cell genome during gene trapping or gene editing; it may also contain a 2A peptide sequence, which may be used to achieve polycistronic expression during translation, that is, multiple gene products are expressed and separated through a single promoter; it may also contain a selection marker, such as a puromycin resistance gene; it may also contain pA (i.e., polyA tail, polyadenylic acid tail) for mRNA stabilization and processing.

[0197] Constructs

[0198] Typically, the constructs provided by the invention include:

[0199] (i) a first construct comprising an expression cassette for expressing a CD132 protein;

[0200] (ii) a second construct comprising an expression cassette for expressing a CD122 protein;

[0201] (iii) a third construct, wherein the third construct contains an expression cassette for expressing a STAT5 protein;

[0202] (iv) a fourth construct comprising an expression cassette for expressing a CD25 protein;

[0203] (v) a fifth construct comprising an expression cassette for expressing a JAK3 protein; and

[0204] (vi) a sixth construct comprising an expression cassette for inducible expression of a reporter protein.

[0205] The first construct, the second construct, the third construct, the fourth construct, the fifth construct and / or the sixth construct may be independent or connected in series. Preferably, the first construct and the second construct are located on the same vector, the third construct and the fourth construct are located on the same vector, and the construct comprises:

[0206] (Z1) a first construct, wherein the first construct comprises an expression cassette for expressing CD132 protein, wherein the expression cassette comprises the sequence shown in SEQ ID NO: 2 and a CMV promoter;

[0207] (Z2) a second construct, wherein the second construct contains an expression cassette for expressing CD122 protein, wherein the expression cassette contains the sequence shown in SEQ ID NO: 3;

[0208] (Z3) a third construct, wherein the third construct comprises an expression cassette for expressing a STAT5b protein, wherein the expression cassette comprises the sequence shown in SEQ ID NO: 4;

[0209] (Z4) a fourth construct, wherein the fourth construct comprises an expression cassette for expressing a CD25 protein, wherein the expression cassette comprises a sequence as shown in SEQ ID NO: 5 and an EF1a promoter;

[0210] (Z5) a fifth construct, comprising an expression cassette for expressing a JAK3 protein, wherein the expression cassette comprises a sequence as shown in SEQ ID NO: 6 and a CMV promoter; and

[0211] (Z6) a sixth construct, wherein the sixth construct contains an expression cassette for inducing expression of luciferase, wherein the expression cassette contains a coding sequence of luciferase and a RE340 promoter;

[0212] Wherein, the CMV promoter in the first construct drives the expression of CD132 protein and CD122 protein at the same time; the EF1a promoter in the fourth construct drives the expression of CD25 protein and STAT5b protein at the same time;

[0213] An expression cassette for expressing a connecting peptide is further included between the first construct and the second construct and between the third construct and the fourth construct;

[0214] The luciferase is induced to express when the STAT5b protein is phosphorylated, and the sequence of the RE340 promoter is shown in SEQ ID NO: 7.

[0215] The construct of the present invention and the vector comprising the same may also comprise an appropriate promoter or control sequence. The construct of the present invention and the vector comprising the same may be used to construct a host cell, preferably a cell line for specifically quantifying interleukin 15 (IL-15) activity, i.e., an IL-15 reporter cell.

[0216] Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells that can absorb DNA can be harvested after the exponential growth phase and treated with CaCl 2 Another method is to use MgCl 2 If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation method, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0217] The transformant obtained can be cultured by conventional methods to express the protein in the construct of the present invention. Depending on the host cell used, the culture medium used in the culture can be selected from various conventional culture media. Culture is carried out under conditions suitable for the growth of the host cells. When the host cells grow to an appropriate cell density, the promoter selected can be induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0218] Preparation method of IL-15 reporter cells

[0219] The present invention also provides a method for preparing IL-15 reporter cells, the method comprising the steps of:

[0220] (S1) providing cells to be modified;

[0221] (S2) knocking a reporter gene into the AAVS1 site of the cell genome using gene editing technology, wherein the reporter gene is an inducible expression reporter gene, and the reporter gene is induced to express when the STAT5 protein is phosphorylated;

[0222] (S3) introducing the following construct into the cells obtained in step (S2):

[0223] (i) a first construct comprising an expression cassette for expressing a CD132 protein;

[0224] (ii) a second construct comprising an expression cassette for expressing a CD122 protein;

[0225] (iii) a third construct, wherein the third construct contains an expression cassette for expressing a STAT5 protein;

[0226] (iv) a fourth construct comprising an expression cassette for expressing a CD25 protein; and

[0227] (v) a fifth construct, the fifth construct comprising an expression cassette for expressing a JAK3 protein;

[0228] Thus, the cell line for specific quantitative calibration of interleukin 15 (IL-15) activity is obtained.

[0229] Among them, the AAVS1 site, also known as the PPP1R2C site, is a specific genomic location, mainly located on human chromosome 19 (position 19q13.42). This site is generally considered a safe site ("safe harbor" site) in gene editing, especially in the CRISPR-Cas9 system. This site is an open chromosome structure that ensures that the transferred gene can be transcribed normally, and inserting exogenous target fragments at this site has no known side effects on cells.

[0230] Preferably, the first construct and the second construct are located on the same vector, the third construct and the fourth construct are located on the same vector, and the constructs comprise:

[0231] (Z1) a first construct, wherein the first construct comprises an expression cassette for expressing CD132 protein, wherein the expression cassette comprises the sequence shown in SEQ ID NO: 2 and a CMV promoter;

[0232] (Z2) a second construct, wherein the second construct contains an expression cassette for expressing CD122 protein, wherein the expression cassette contains the sequence shown in SEQ ID NO: 3;

[0233] (Z3) a third construct, wherein the third construct comprises an expression cassette for expressing a STAT5b protein, wherein the expression cassette comprises the sequence shown in SEQ ID NO: 4;

[0234] (Z4) a fourth construct, wherein the fourth construct comprises an expression cassette for expressing a CD25 protein, wherein the expression cassette comprises a sequence as shown in SEQ ID NO: 5 and an EF1a promoter;

[0235] (Z5) a fifth construct, comprising an expression cassette for expressing a JAK3 protein, wherein the expression cassette comprises a sequence as shown in SEQ ID NO: 6 and a CMV promoter; and

[0236] (Z6) a sixth construct, wherein the sixth construct contains an expression cassette for inducing expression of luciferase, wherein the expression cassette contains a coding sequence of luciferase and a RE340 promoter;

[0237] Wherein, the CMV promoter in the first construct drives the expression of CD132 protein and CD122 protein at the same time; the EF1a promoter in the fourth construct drives the expression of CD25 protein and STAT5b protein at the same time;

[0238] An expression cassette for expressing a connecting peptide is further included between the first construct and the second construct and between the third construct and the fourth construct;

[0239] The luciferase is induced to express when the STAT5b protein is phosphorylated, and the sequence of the RE340 promoter is shown in SEQ ID NO: 7.

[0240] In some preferred embodiments, the method further comprises the steps of:

[0241] (S4) a step of amplifying and / or detecting the cell line for specific quantitative calibration of interleukin 15 (IL-15) activity. The detection may be an activity detection, for example, including: (1) determination of the expression of CD132 protein, CD122 protein, STAT5 protein, CD25 protein and / or JAK3 protein; and / or (2) identification of whether a reporter gene for inducing expression is inserted.

[0242] Quantitative detection method of IL-15 activity

[0243] The present invention also provides a method for quantitatively detecting IL-15 activity, the method comprising the steps of:

[0244] (S1) providing a host cell as described in the third aspect of the present invention;

[0245] (S2) contacting the host cell with the IL-15 to be tested; and

[0246] (S3) Quantitatively detecting the reporter protein at the detection time point, and characterizing the IL-15 activity by the expression level of the reporter protein.

[0247] In some preferred embodiments, the method further comprises the steps of:

[0248] (i) providing a number of known concentrations of IL-15; and

[0249] (ii) contacting the host cells with the known concentration of IL-15, respectively; and

[0250] (iii) The reporter protein was quantitatively detected at each detection time point, and a standard curve was fitted using the known concentration of IL-15 and the corresponding expression level of the reporter protein.

[0251] In some preferred embodiments, the method further comprises the steps of:

[0252] (iv) according to the expression level of the reporter protein corresponding to the IL-15 to be tested obtained by quantitative detection, the corresponding IL-15 concentration is obtained from the standard curve, and the IL-15 concentration represents the activity of the IL-15 to be tested.

[0253] The expression level of the reporter protein can be characterized by the absorbance or fluorescence intensity of the reporter protein.

[0254] The quantitative detection method of IL-15 activity provided by the present invention can realize stable, quantitative, highly sensitive and highly specific IL-15 activity detection, with a detection limit (LOD) of ≤1 ng / ml, optimally ≤0.05 ng / ml; and a quantitative detection limit (LOQ) of ≤2 ng / ml, optimally ≤0.1 ng / ml.

[0255] Main advantages of the present invention

[0256] 1. The IL-15 reporter cells and IL-15 activity detection method constructed by the present invention induce the expression of the reporter gene only when IL-15 is present, which can avoid the background leakage expression of the reporter gene caused by the inherent transcription initiation activity of the LTR sequence on the viral vector backbone in conventional reporter plasmids or reporter cells.

[0257] 2. The IL-15 reporter cells and IL-15 activity detection method constructed by the present invention can realize stable, highly accurate and highly sensitive quantitative detection of IL-15 activity, providing accurate quality control means for the development of IL-15 related drugs.

[0258] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually performed under conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0259] Sequence information

[0260] sgRNA template sequence (SEQ ID NO: 1)

[0261] GGGGCCACTAGGGACAGGAT

[0262] CD132 protein coding sequence (SEQ ID NO: 2)

[0263]

[0264] CD122 protein coding sequence (SEQ ID NO: 3)

[0265]

[0266] STAT5b protein coding sequence (SEQ ID NO: 4)

[0267]

[0268] CD25 protein coding sequence (SEQ ID NO: 5)

[0269] ATGGACAGCTACCTGCTGATGTGGGGCCTGCTGACCTTTATCATGGTGCCCGGCTGCCAAGCCGAGCTGTGCGACGATGATCCTCCCGAGATCCCCCACGCCACCTTCAAGGCCATGGCCTACAAGGAGGGCACCATGCTGAACTGCGAGTGCAAGAGAGGCTTCAGAAGAATCAAGAGCGGCAGCCTGTACATGCTGTGCACCGGCAACAGCAGCCACAGCAGCTGGGACAATCAGTGTCAGTGCACAAGCAGCGCCACAAGAAACACCACCAAGCAAGTGACCCCTCAGCCCGAGGAGCAGAAGGAGAGAAAGACCACCGAGATGCAGAGCCCTATGCAACCCGTCGACCAAGCCTCCCTGCCTGGGCACTGCAGAGAGCCCCCTCCCTGGGAGAACGAGGCCACCGAGAGAATCTACCACTTCGTGGTGGGGCAGATGGTGTACTATCAGTGCGTGCAAGGCTACAGAGCCCTGCACAGAGGCCCCGCCGAGAGCGTGTGCAAGATGACCCACGGCAAGACAAGATGGACACAGCCTCAGCTGATCTGCACCGGCGAGATGGAAACCTCCCAATTCCCCGGCGAGGAGAAGCCCCAAGCTTCCCCCGAGGGCAGACCCGAGAGCGAGACAAGCTGCCTGGTGACCACAACCGACTTTCAGATTCAGACCGAGATGGCCGCCACCATGGAAACAAGCATCTTCACCACCGAGTACCAAGTGGCCGTGGCCGGCTGCGTGTTCCTGCTGATCAGCGTGCTGCTCCTGAGCGGCCTGACCTGGCAGAGAAGACAGAGAAAGAGCAGAAGAACCATC

[0270] JAK3 protein coding sequence (SEQ ID NO: 6)

[0271]

[0272] RE340 promoter (SEQ ID NO: 7)

[0273] ATCGATCGCACCAGCGTGTGGATCGCTTTTAGATTTCTAGGAATTCAATCCTTTTAGATTTCTAGGAATTCAATCCTTTAGATTTCTAGGAATTCAATCCTTTTAGATTTCTAGGAATTCAATCCTTTTAGATTTCTAGGAATTCAATCCTTTTAGATTTCTAGGAATTCAATCCGATCCGAGAACAGATCTGGCCTCGGCGGCCAAGCTTAGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAGCTTGGCAATCCGGTACTGTTGGTAAAGCCACC

[0274] Experimental materials

[0275] Cells: 293T (ATCC, CRL-3216)

[0276] Antibody: APC anti-human CD132 (common γ chain) Antibody (Biolegend, 338608)

[0277] Brilliant Violet 421™ anti-human CD122 (IL-2Rβ) Antibody (Biolegend, 339010)

[0278] Alexa Fluor® 488 anti-human CD25 Antibody (Biolegend, 356116)

[0279] Human STAT5b Alexa Fluor® 594-conjugated Antibody (RD, IC1584T-100UG)

[0280] Mouse IgG2B Alexa Fluor 594-conjugated Isotype Control (RD, IC0041T)

[0281] Jak3 (D7B12) Rabbit mAb (CST, 8863S)

[0282] Anti-rabbit IgG, HRP-linked Antibody (CST, 7074P2)

[0283] Example 1: Vector construction, virus packaging and electroporation

[0284] According to Table 1, the synthesized sequence or the synthesized sequence plus a promoter was inserted into the viral packaging plasmid pCDH-CMV to construct vectors 1-3.

[0285] Table 1 Carrier information

[0286]

[0287] Vectors 1-3 were packaged with lentivirus respectively, the process is as follows:

[0288] 293T cells with good growth status were digested and seeded in 10 cm culture dishes (8×10 6 / dish), and culture overnight. Check the next day to ensure that the 293T in the culture dish has reached 80-90% confluence. Prepare the following transfection complex: Tube A: 500 μl Opti-MEM + 10 μg pCDH + 10 μg pSPAX2 + 10 μg pMD2.0, mix by pipetting; Tube B: 500 μl Opti-MEM + 25 μl PEI, mix by pipetting. Transfer the solution in tube A to tube B, mix with a pipette, and let stand at room temperature for 15-20 minutes. Transfer the DNA-PEIPro mixture to a 10 cm culture dish and shake gently. Culture in a 37°C incubator. After 6 hours, remove the culture supernatant, wash with PBS, and then add 10 ml complete culture medium again.

[0289] Optionally, a virus concentration step can also be performed: collect 48hr or 72hr virus liquid from the 293T culture dish into a centrifuge tube; centrifuge at 4°C, 500g for 5 minutes, and transfer the supernatant to a new centrifuge tube; filter the virus liquid into a new centrifuge tube using a 0.45 μm filter and a syringe; add a concentrate of 1 / 3 of the volume of the virus liquid, and mix by pipetting; after standing at 4°C for 1hr, centrifuge at 4°C, 1500g for 45 minutes, remove the supernatant, and retain the precipitate at the bottom of the centrifuge tube; add a virus freezing solution of 1 / 100 of the volume of the original virus liquid to resuspend the bottom precipitate.

[0290] Electroporation: Digest 293T with Trypsin cell dissociation reagent, centrifuge and remove supernatant, wash once with PBS, count, and take 1E6 cells for electroporation. Electroporation was performed using the RNP system, which includes sgRNA and Cas9 protein. sgRNA (5'-GGGGCCACTAGGGACAGGAT-3', SEQ ID NO: 1) and Cas9 (IDT, 1081061) were mixed at a molar ratio of 2:1. 100 μl of electroporation system requires 250 pmol of sgRNA and 125 pmol of Cas9 protein. The two were mixed evenly and allowed to stand at room temperature for 15 min. Electroporation was performed using the SF Cell Line 4D Nuclear Transfection Kit (Lonza, V4XC-2012) and the Lonza 4D Nuclear Transfection Electroporator was used according to the instructions. After electroporation, the cells were transferred to a culture dish and cultured at 37°C. One week later, Puromycin was added for selection at a concentration of 1 μg / ml.

[0291] According to the experimental requirements, the plasmid structure of SA-P2A-puro-STAT5-inducible reporter-luciferase was designed, and the element was knocked into the AAVS1 site by electroporation. The endogenous promoter of AAVS1 was used to drive the expression of puro, and the STAT5-inducible reporter was used to drive the expression of luciferase (the inducible promoter for inducing luciferase expression was the RE340 promoter, and the sequence of the RE340 promoter was SEQ ID NO: 7). The cells with the element knocked in have the puro resistance gene. The cells after electroporation were screened with puro to obtain cells with STAT5-inducible reporter-luciferase knocked in. Stable knocked-in cell lines can be obtained without the need for monoclonal selection, and preliminary experiments such as functional verification can be completed.

[0292] like Figure 1 As shown, a schematic diagram of the signal pathway established in the presence of IL-15 based on CD132 protein, CD122 protein, STAT5 protein, CD25 protein, JAK3 protein and STAT5-inducible reporter-luciferase in vectors 1-4 is shown.

[0293] Example 2: 293T-STAT5-inducible reporter-luciferase virus infection and single clone selection

[0294] The cell concentration was adjusted and inoculated into a 6-well plate at 1E6 / well. The cell state was observed the next morning to ensure that the cell confluence reached 60-80%, and the virus prepared in Example 1 was added for infection. After 48 hours, the cells were passaged and cultured continuously. After the cell state was stable, the cells were screened at the concentrations of 7.5 μg / ml of Blasticidin and 150 μg / ml of Hygromycin, respectively. After most of the cells in the control wells died, the remaining cells in the experimental wells were infected cells.

[0295] After infection, cells were routinely cultured, and monoclonal plates could be plated after the state stabilized. After infection, cells were digested, stained with CD25 antibody (Biolegend, 356116), and positive cells were plated into 96-well plates using Namocell Single Cell Dispenser, with only one cell in each well. Culture was continued for 14 days, and monoclonal clones were selected after they grew up. Monoclones with good growth were selected, washed with PBS, and digested with 50 μl Accutase digestion solution. After digestion, the cells were evenly blown with a pipette tip, and 40 μl was transferred to a 12-well plate containing culture medium for culture, and 5 μl was transferred to a PCR tube for STAT5-inducible reporter-luciferase, flow cytometry, and Western blot identification.

[0296] Example 3: STAT5-inducible reporter-luciferase and identification of inserted elements

[0297] The 5 μl sample taken during single clone selection was used for crude genome extraction using the PrepGEM DNA extraction kit, the kit number is MicroGEM-PUN0500. The 20 μl reaction system contains 5 μl sample, 2 μl 10X blue buffer, 0.4 μl PrepGEM enzyme, and 12.6 μl water. After the above reaction system is mixed evenly, it is placed in a PCR instrument and incubated at 75 degrees for 10 minutes and 95 degrees for 2 minutes. After the incubation, it can be used as a template for PCR experiments. Take 2 μl as a template, add DNA amplification enzymes and primers for PCR experiments, and identify whether the single clone has inserted STAT5-inducible reporter-luciferase and its genotype. After completing this step, select positive clones for continued cultivation.

[0298] like Figure 2 As shown, the PCR detection results after the inducible promoter RE340 was inserted and the fragment Sanger sequencing results were shown, and the results all indicated that the inducible promoter RE340 had been successfully inserted into the genome of 293T cells.

[0299] Detection of protein expression of each component: After cell digestion, count the cells and take 2E5 cells to continue the experiment. Samples that need to detect proteins on the membrane are directly incubated with flow cytometry antibodies for 30 minutes after washing and centrifugation, and then tested on the machine after washing. Intracellular proteins need to be fixed and permeated for 10 minutes, then incubated with antibodies for 30 minutes, and then tested on the machine after washing.

[0300] like Figure 3 and Figure 4 As shown, CD25 protein, CD122 protein, CD132 protein, STAT5b protein and JAK3 protein were positively expressed in 293T cells. The above results indicate that 293T-IL15 reporter cells have been successfully established, and all elements are expressed. With the increase of passages, all elements continue to be expressed, and the cell line has a high homogeneity.

[0301] like Figure 5 As shown, a flowchart for constructing 293T-IL15 reporter cells and performing element expression verification and IL-15 activity verification is shown.

[0302] Example 4: Luciferase Assay

[0303] After cell digestion, cells were inoculated in a 96-well plate at 2E4 / well and cultured overnight at 37°C. The next day, cells were taken out of culture, the culture medium was removed, and the culture medium containing IL-15 was added to continue the culture. At the detection time point, 30 µl One-glo (Promega, E6120) was added, pipetted and mixed, and then cultured at room temperature for 5 minutes. All supernatants were transferred to a white plate and read by chemiluminescence.

[0304] like Figure 6 As shown, a flow chart of the above-mentioned IL-15 activity detection using chemiluminescence method is shown.

[0305] like Figure 7 As shown, the RLU results of 293T-IL15 reporter cells at different time points under the same concentration of IL-15 (10 ng / ml) are shown. In the detection of the same IL-15 concentration and different time points, the RLU continued to increase over time and gradually decreased after 10 hours. The RLU showed a high multiple relationship at different time points, proving the sensitivity of this cell line.

[0306] like Figure 8 As shown in the figure, the luciferase results of 293T-IL15 reporter cells under the action of different concentrations of IL-15 are shown. In the experiments with different concentrations, the concentration and luciferase readings also showed a good correlation, and the fitting curve formula was y = 67.801x 2+ 5761.5x - 8095.8, R² is 0.9677. The LOD of this cell line is 0.05 ng / ml, and the LOQ is 0.1 ng / ml.

[0307] In addition, in order to verify the specificity of 293T-IL15 reporter cells, different interleukins were added to the cells: IL-7 100 ng / ml and IL-15 100 ng / ml, and the luciferase value was detected after 6.5 h.

[0308] like Fig. 9 As shown, the results showed that IL-15 reporter cells only responded to IL-15 100 ng / ml and had no response to IL-7 stimulation, proving the specificity of this cell line.

[0309] Therefore, this cell line has extremely high stability, sensitivity and specificity as a method for detecting IL-15.

[0310] Comparative example: Cell line luciferase after viral infection with STAT5-inducible luciferase reporter Leakage expression

[0311] In the comparative example, the conventional STAT5-inducible luciferase reporter was introduced into cells by viral infection to construct three cell lines, Luc reporter Pool 1, Luc reporter Pool 2 and Luc reporter Pool 3.

[0312] like Fig.10 As shown, the results show that after the virus infects the STAT5-inducible luciferase reporter, even if IL-15 is not added for induction, the inherent transcription initiation activity of the LTR sequence on the viral vector backbone will still cause background leakage expression of the luciferase reporter. Such non-specific expression will greatly reduce the detection accuracy and sensitivity of the target cytokine IL-15. However, the IL-15 reporter cells constructed by the present invention do not have background leakage expression, so the detection accuracy and sensitivity of IL-15 can be significantly improved, overcoming the shortcomings of the prior art.

[0313] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A method for preparing a cell line for specific quantitative calibration of interleukin 15 (IL-15) activity, characterized in that: The method comprises the steps of: (S1) providing 293T cells to be transformed; (S2) knocking a reporter gene into the AAVS1 site of the cell genome using gene editing technology, wherein the reporter gene is an inducible expression reporter gene, and the reporter gene is induced to express when the STAT5b protein is phosphorylated; Wherein, the reporter gene is a luciferase gene; the step (S2) uses a sixth construct, the sixth construct contains an expression cassette for inducing expression of luciferase, the expression cassette contains a luciferase coding sequence and a RE340 promoter, and the sequence of the RE340 promoter is shown in SEQ ID NO: 7; (S3) introducing the following construct into the cells obtained in step (S2): (i) a first construct, wherein the first construct comprises an expression cassette for expressing a CD132 protein, wherein the expression cassette comprises a sequence as shown in SEQ ID NO: 2 and a CMV promoter; (ii) a second construct, wherein the second construct contains an expression cassette for expressing CD122 protein, wherein the expression cassette contains the sequence shown in SEQ ID NO: 3; (iii) a third construct, wherein the third construct comprises an expression cassette for expressing a STAT5b protein, wherein the expression cassette comprises the sequence shown in SEQ ID NO: 4; (iv) a fourth construct, wherein the fourth construct contains an expression cassette for expressing CD25 protein, wherein the expression cassette contains the sequence shown in SEQ ID NO: 5 and an EF1a promoter; and (v) a fifth construct, comprising an expression cassette for expressing a JAK3 protein, wherein the expression cassette comprises a sequence as shown in SEQ ID NO: 6 and a CMV promoter; Wherein, the first construct and the second construct are located on the same vector, and the third construct and the fourth construct are located on the same vector; the CMV promoter in the first construct drives the expression of CD132 protein and CD122 protein at the same time; the EF1a promoter in the fourth construct drives the expression of CD25 protein and STAT5b protein at the same time; An expression cassette for expressing a connecting peptide is further included between the first construct and the second construct and between the third construct and the fourth construct; Thus, the cell line for specific quantitative calibration of interleukin 15 (IL-15) activity is obtained.

2. The method according to claim 1, characterized in that The method comprises the steps of constructing said first, second, third, fourth, fifth and / or sixth construct.

3. The method according to claim 1, characterized in that The method comprises the steps of constructing a vector containing the first, second, third, fourth, fifth and / or sixth construct.

4. The method according to claim 1, characterized in that The method further comprises the steps of: (S4) A step of amplifying and / or detecting the cell line that specifically and quantitatively calibrates the activity of interleukin 15 (IL-15).

5. The method according to claim 4, characterized in that The detection includes: (1) Determination of the expression of CD132 protein, CD122 protein, STAT5 protein, CD25 protein and / or JAK3 protein; and / or (2) Identify whether the reporter gene that induces expression is inserted.

6. A cell line for specific quantitative calibration of interleukin 15 (IL-15) activity, characterized in that: The cell line is prepared by the method according to any one of claims 1 to 5.

7. A method for specific quantitative calibration of interleukin 15 (IL-15) activity for non-disease treatment purposes and non-disease diagnosis purposes, characterized in that: The method comprises: (S1) providing the cell line according to claim 6; (S2) contacting the cell line with the IL-15 to be tested; and (S3) Quantitatively detecting the expression of the reporter gene at the detection time point, and characterizing the IL-15 activity by the expression amount of the reporter gene.

8. The method according to claim 7, characterized in that The quantitative detection was performed by chemiluminescence method, the limit of detection (LOD) of the method was 0.05 ng / ml, and the limit of quantification (LOQ) of the method was 0.1 ng / ml.

9. A use of the cell line according to claim 6 for non-disease treatment purposes or non-disease diagnosis purposes, characterized in that: Used for specific quantitative calibration of interleukin 15 (IL-15) activity.

Images