An endophytic fungus MD9F, a microbial inoculum and its applications

The endophytic fungus MD9F isolated and purified from the leaves of the medicinal plant Ophiopogonis leaves, solved the problem of lack of chloramphenicol degradation strains in plant endophytic fungi, achieved efficient degradation of chloramphenicol and transformed its structure, providing an environmentally friendly governance approach.

CN119020179BActive Publication Date: 2025-07-15ZHEJIANG UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411514042.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-29
Publication Date
2025-07-15
Estimated Expiration
2044-10-29

AI Technical Summary

Technical Problem

In the prior art, there have been few reports of fungi, especially plant endophytic fungi, degraded chloramphenicol strains, and it is urgent to develop low-cost, environmentally friendly chloramphenicol treatment methods.

Method used

An endophytic fungus MD9F was provided, which was screened and isolated from the leaves of the medicinal plant Ophiopogon japonicus, and had significant chloramphenicol degradation ability, and prepared a fungic agent for degrading chloramphenicol.

Benefits of technology

The endophytic fungus MD9F can efficiently degrade chloramphenicol, with a degradation rate of up to 98.5%, and convert chloroacetyl groups into acetyl groups, enriching the germplasm resource library of chloramphenicol-degrading bacteria and providing an effective way for environmental pollution control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119020179B_ABST
    Figure CN119020179B_ABST
Patent Text Reader

Abstract

The present invention provides an endophytic fungus MD9F, a microbial agent and its application, belonging to the field of microbial technology. The endophytic fungus (Mycoleptodiscus sp.) strain MD9F provided by the present invention is isolated from the leaves of the medicinal plant Ophiopogon japonicus, identified as Mycoleptodiscus sp., and has been deposited in the General Microbiology Center of the China Center for Type Culture Collection on August 7, 2024, with the deposit number of CGMCC No. 3.28116. The endophytic fungus MD9F provided by the present invention is obtained through multiple activity screenings and isolation and purification, has significant chloramphenicol degradation ability, enriches the germplasm resource library of chloramphenicol-degrading bacteria, and provides an effective treatment approach for the environmental pollution of chloramphenicol antibiotics.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology, and particularly relates to an endophytic fungus MD9F, a microbial agent thereof and applications thereof. Background Art

[0002] Chloramphenicol is a broad-spectrum antibiotic of the amide alcohol type with optical activity, and is widely used for treating infections caused by various bacteria and fungi. However, chloramphenicol pollution can cause environmental and health problems, and there is an urgent need to develop low-cost and environmentally friendly chloramphenicol treatment methods. In recent years, although there have been occasional reports of microorganisms with the ability to degrade chloramphenicol, such as Rhodococcus sp. CAP2, Raoultella sp. db-1, and Sphingobium sp. WTD-1, most of them are of bacterial origin, and there are few reports of chloramphenicol-degrading strains derived from fungi, especially plant endophytic fungi. Summary of the Invention

[0003] The purpose of the present invention is to provide an endophytic fungus MD9F, a microbial agent thereof and applications thereof, and the endophytic fungus MD9F of the present invention can efficiently degrade chloramphenicol.

[0004] The present invention provides an endophytic fungus (Mycoleptodiscus sp.) MD9F, which is preserved in the China General Microbiological Culture Collection Center, and the preservation number is CGMCC No. 3.28116.

[0005] The present invention also provides spores of the endophytic fungus MD9F described in the above solution.

[0006] The present invention also provides a microbial agent, which comprises the endophytic fungus MD9F or the spores described in the above solution.

[0007] The present invention also provides a degrading agent for chloramphenicol antibiotics, which comprises the endophytic fungus MD9F, the spores or the microbial agent described in the above solution.

[0008] Preferably, it further comprises materials for culturing the endophytic fungus MD9F.

[0009] Preferably, the materials for culturing the endophytic fungus MD9F include a PDA medium.

[0010] The present invention also provides applications of the endophytic fungus MD9F, the spores, the microbial agent or the degrading agent described in the above solution in degrading chloramphenicol antibiotics.

[0011] The present invention also provides a method for degrading chloramphenicol antibiotics, which includes the following steps: inoculating or applying the degrading agent described in the above solution to the material to be degraded containing chloramphenicol antibiotics for degradation.

[0012] Preferably, the mass concentration of chloramphenicol antibiotics in the material to be degraded is ≤50 μg / mL.

[0013] Preferably, the degradation is carried out under light-shielded conditions; the temperature of the degradation includes 30°C.

[0014] The present invention provides an endophytic fungus (Mycoleptodiscus sp.) MD9F, which is isolated from the leaves of the medicinal plant Ophiopogon japonicus, identified as Mycoleptodiscus sp., and deposited in the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on August 7, 2024, with the deposit number CGMCC No. 3.28116. The endophytic fungus MD9F provided by the present invention is obtained through multiple activity screenings and isolation and purification. It has significant chloramphenicol degradation ability, enriches the germplasm resource library of chloramphenicol-degrading bacteria, and provides an effective treatment approach for the environmental pollution of chloramphenicol antibiotics. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0016] Figure 1 It is the colony phenotype of the endophytic fungus MD9F in Example 1 of the present invention;

[0017] Figure 2 It is the phylogenetic tree of the endophytic fungus MD9F constructed based on ITS in Example 1 of the present invention;

[0018] Figure 3 It is the result diagram of the degradation effect of the endophytic strain MD9F on chloramphenicol in Example 2 of the present invention; among them, A is the blank control, indicating the treatment of the PDA solid medium with a high concentration of chloramphenicol without inoculating the strain, and MD9F indicates the treatment of the PDA solid medium with a high concentration of chloramphenicol after inoculating the strain MD9F; the number 2 represents the chloramphenicol degradation product; the number 1 represents chloramphenicol; B represents the relative efficiency of the strain MD9F degrading chloramphenicol detected by HPLC, which is calculated by comparing the ultraviolet signal intensity of the remaining chloramphenicol detected in the crude extract of the fermentation broth of MD9F at different culture time periods with the ultraviolet signal intensity of the remaining chloramphenicol in the crude extract of the corresponding blank control medium;

[0019] Figure 4 This is the high-resolution mass spectrum and nuclear magnetic resonance spectrum of chloramphenicol degradation product 2 in Example 2 of the present invention; among them, A is the high-resolution mass spectrum, and B is the nuclear magnetic resonance spectrum (proton spectrum).

[0020] Biological deposit description: Endophytic fungus (Mycoleptodiscus sp.) MD9F was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on August 7, 2024. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 3.28116. Detailed implementation manners

[0021] The present invention provides an endophytic fungus (Mycoleptodiscus sp.) MD9F, which is deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms, and the deposit number is CGMCC No. 3.28116.

[0022] The endophytic fungus MD9F of the present invention is isolated from the leaves of the medicinal plant Ophiopogon japonicus, specifically the fresh leaves of 2- to 3-year-old Ophiopogon japonicus. The endophytic fungus MD9F of the present invention is obtained through multiple activity screenings and isolation and purification, and is identified as Mycoleptodiscus sp.

[0023] The endophytic fungus MD9F of the present invention has characteristics such as round colonies, white fluffy hyphae, uniform and compact texture, and fast growth potential.

[0024] The endophytic fungus MD9F of the present invention has excellent tolerance to chloramphenicol and has significant chloramphenicol degradation ability, and can efficiently degrade chloramphenicol.

[0025] In the present invention, the isolation process of the endophytic fungus MD9F includes the following steps:

[0026] Cut the surface-sterilized Ophiopogon japonicus leaves into 1 cm segments and inoculate them on the surface of a PDA solid medium containing 10 μg / mL of chloramphenicol; pick the hyphae at the periphery of the new colony and inoculate them on the surface of a PDA solid medium containing 20 μg / mL of chloramphenicol for primary purification; separate the hyphae after primary purification again and inoculate them on the surface of a PDA solid medium containing 50 μg / mL of chloramphenicol for secondary purification until a single pure strain is obtained. In the present invention, the surface-sterilized Ophiopogon japonicus leaves are obtained by rinsing the fresh Ophiopogon japonicus leaves with running water and performing surface disinfection on the leaves using a three-step disinfection method in a laminar flow hood.

[0027] After inoculation on the surface of PDA solid medium containing 10 μg / mL chloramphenicol, the present invention preferably further includes separating different strains to a new PDA solid medium containing a low concentration of chloramphenicol (10 μg / mL) according to the morphology, color, texture, growth vigor, etc. of the grown colonies.

[0028] In the specific implementation process of the present invention, the time for the primary purification is 3 d; the time for the secondary purification is 7 d.

[0029] In the specific implementation process of the present invention, after obtaining a single pure strain, ITS detection is used to complete the molecular identification of the strain, and the endophytic fungus Mycoleptodiscus sp. MD9F with high-efficiency biodegradation of chloramphenicol in Zhejiang Ophiopogon japonicus is obtained.

[0030] In the present invention, the PDA solid medium includes components with the following concentrations: 6.0 g / L of potato powder, 20 g / L of glucose, and 20 g / L of agar powder. The pH of the PDA solid medium is 5.4 - 5.8, preferably 5.6.

[0031] The present invention also provides the spores of the endophytic fungus MD9F described in the above scheme.

[0032] The present invention also provides a microbial agent, which contains the endophytic fungus MD9F or the spores described in the above scheme.

[0033] In the present invention, in the microbial agent, the spore concentration of the endophytic fungus MD9F is preferably 10 6 ~10 7 CFU / mL.

[0034] In the present invention, the microbial agent is preferably prepared by the following method: inoculating the endophytic fungus MD9F on the PDA solid medium, performing activation culture until sporulation, slowly rinsing the strains on the surface of the medium with glycerol aqueous solution for multiple times, resuspending the spores to obtain a spore biological bacterial solution; inoculating the spore biological bacterial solution into the PDB liquid medium for seed culture to obtain a seed solution; the volume concentration of glycerol in the glycerol aqueous solution is 10%.

[0035] In the present invention, the temperature of the activation culture is 30°C; the activation culture is preferably carried out in a constant temperature biological incubator; the activation culture is preferably carried out under light-shielded conditions; the activation culture is static culture; the time of the activation culture is preferably 5 - 7 d.

[0036] In the present invention, the time of the seed culture is preferably 2 d.

[0037] In the present invention, the PDB liquid medium preferably comprises components with the following concentrations: 6.0 g / L of potato extract powder and 20 g / L of glucose. The pH of the PDB liquid medium is 5.4 - 5.8, preferably 5.6.

[0038] The present invention also provides a degrading agent for chloramphenicol antibiotics, comprising the endophytic fungus MD9F, the spores or the bacterial agent described in the above solution.

[0039] In the present invention, the degrading agent preferably further comprises materials for culturing the endophytic fungus MD9F; the materials for culturing the endophytic fungus MD9F preferably include PDA medium.

[0040] The present invention also provides the application of the endophytic fungus MD9F, the spores, the bacterial agent or the degrading agent described in the above solution in degrading chloramphenicol antibiotics.

[0041] The present invention also provides a method for degrading chloramphenicol antibiotics, comprising the following steps: inoculating or applying the degrading agent described in the above solution to the material to be degraded containing chloramphenicol antibiotics for degradation.

[0042] In the present invention, the mass concentration of chloramphenicol antibiotics in the material to be degraded is preferably ≤50 μg / mL, more preferably 50 μg / mL.

[0043] In the present invention, the chloramphenicol antibiotics include chloramphenicol and thiamphenicol; the degrading effect of the endophytic fungus MD9F on chloramphenicol is to degrade the chloroacetyl group in its structure into an acetyl group. Similarly, MD9F can degrade thiamphenicol which also contains a chloroacetyl functional group.

[0044] In the present invention, the degradation is preferably carried out under light - avoiding conditions to prevent partial degradation of chloramphenicol under long - term visible light; the temperature for the degradation preferably includes 30°C.

[0045] In the present invention, the endophytic fungus MD9F can carry out dechlorination degradation on chloramphenicol, and the product is N - [(1R,2R) - 2 - hydroxy - 1 - (hydroxymethyl) - 2 - (4 - nitrophenyl)ethyl]acetamide.

[0046] To further illustrate the present invention, the following describes in detail an endophytic fungus MD9F, a bacterial agent and their applications provided by the present invention with reference to the drawings and examples, but they should not be construed as limiting the protection scope of the present invention.

[0047] Example 1: Isolation and identification of the endophytic fungus MD9F with high efficiency in degrading chloramphenicol from Ophiopogon japonicus.

[0048] 1. Isolation, purification and preservation of endophytic fungi with high efficiency in degrading chloramphenicol from Ophiopogon japonicus

[0049] Collect fresh leaves of 2 - 3 - year - old Ophiopogon japonicus suitable for the experiment, and rinse them with running water until the surface is clean. Then gently dry the surface moisture of the leaves with a sterilized filter paper.

[0050] In a laminar flow hood, treat the Ophiopogon japonicus leaves using a three - step disinfection method. First, immerse the washed Ophiopogon japonicus leaves in an ethanol aqueous solution with a volume concentration of 75% for 1 min, and then rinse them 4 times with sterile water. Subsequently, soak the leaves in a sodium hypochlorite solution with a mass concentration of 1% for another 5 min, and wash them 4 times again with sterile water. Finally, treat them with an ethanol aqueous solution with a volume concentration of 75% for 1 min. After washing 4 times with sterile water, dry the surface moisture of the leaves with a sterilized filter paper. Then use a sterile scissors to cut the surface - sterilized Ophiopogon japonicus leaves into small segments 1.0 cm long, and use sterile forceps to evenly inoculate (with sufficient space between each other) the small segments on the surface of a PDA solid medium containing a low concentration of chloramphenicol (10 μg / mL). Incubate them in a biological incubator at 28 °C in the dark and static for several days. The PDA solid medium used needs to be autoclaved (121 °C, 20 min), and filter - sterilized chloramphenicol is added before solidification.

[0051] After the endophytic bacteria grow out, according to factors such as colony morphology, color, texture, and growth rate in a timely manner, use a sterile inoculation loop to pick a small amount of mycelium from the edge of the colony and inoculate it onto the surface of a new PDA solid medium containing a medium concentration of chloramphenicol (20 μg / mL). Incubate it in a constant - temperature incubator at 28 °C in the dark and static for several days. Observe the growth state of the initially purified strain, and repeat the previous operation to continue picking the mycelium on the periphery of the colony and inoculate it onto the surface of a new PDA medium containing a high concentration of chloramphenicol (50 μg / mL) for 7 d. After continuous purification twice, a single strain with consistent colony state, color, uniform and stable texture, and fast growth rate is obtained, named MD9F.

[0052] Finally, use 1 mL of sterilized water to slowly rinse the strain on the surface of the suspension medium, collect the spore liquid of the strain, and mix it with an equal volume of a glycerol aqueous solution with a volume concentration of 50% (sterilized) to obtain a spore mixture. The spore mixture is quickly cooled by liquid nitrogen and stored in a - 80 °C refrigerator for long - term preservation.

[0053] 2. Identification of endophytic fungus MD9F

[0054] (1) Morphological identification: As shown in Figure 1 the figure, the fungus can still grow rapidly and normally on a PDA solid medium containing a high concentration of chloramphenicol. The colony is a regular circle, the surface mycelium is white and fluffy, evenly spreading outwards, with a dense texture and stable growth.

[0055] (2) ITS fungal strain identification: ① Activate the preserved MD9F strain, streak inoculate it on the surface of PDA solid medium without chloramphenicol and culture for 5 d. Then, take 1 mL of sterile water to dissolve and suspend the colonies on the surface to obtain a spore suspension.

[0056] ② Inoculate the spore suspension into 50 mL of PDB liquid medium, culture it in the dark at 28 °C in a constant temperature shaker (200 rpm / min) for 2 d, and then centrifuge to collect the thalli.

[0057] ③ Transfer the collected thalli to a 2 mL centrifuge tube, quickly freeze them in liquid nitrogen, and then grind them thoroughly into a homogenate. Add 1 mL of CTAB buffer (containing 0.5% β-mercaptoethanol), invert and shake well for 0.5 min, and treat them in a water bath at 60 °C for 1 h.

[0058] ④ After the water bath, centrifuge at 12000 rpm for 5 min, collect the supernatant into a new 2 mL centrifuge tube. Add an equal volume of chloroform, invert and mix well, centrifuge at 12000 rpm for 3 min, and carefully pipette 200 μL of the supernatant into a new 2 mL centrifuge tube. Add an equal volume of pre-cooled isopropanol, gently invert and mix well, and quickly place it in an environment at -20 °C to precipitate for 2 h.

[0059] ⑤ After precipitation, centrifuge at 12000 rpm for 5 min, discard the supernatant, pipette 500 μL of 70% alcohol into the centrifuge tube. Invert and wash several times, let it stand at room temperature for 2 min, then centrifuge at 12000 rpm for 2 min, and discard the 70% alcohol solution. Repeat the 70% alcohol washing step once to obtain the DNA precipitate.

[0060] ⑥ In a laminar flow hood, air-dry the centrifuge tube containing the DNA precipitate, add 50 μL of pre-warmed (60 °C) sterilized water, and dissolve it at room temperature for 3 min to obtain the genomic DNA of endophytic fungus MD9F.

[0061] ⑦ Use the universal primers ITS1 (5’-3’: TCCGTAGGTGAACCTGCGG, SEQ ID NO.1) and ITS4 (5’-3’: TCCTCCGCTTATTGATATGC, SEQ ID NO.2) for fungal ITS sequencing to perform PCR amplification on the 16S rRNA of the MD9F genome, cut and recover the PCR electrophoresis amplification product, and send the sample to Shanghai Sangon Biotech Co., Ltd. for first-generation Sanger sequencing. The sequencing results are shown in SEQ ID NO.3, Seq-ITS:

[0062] CCTTAGGTGAACCTGCGGAAGGATCATTACAAGTTGAAACGGTTGCCCTCGCGGTGACCGGTTCTTCAAACCTCTGCGTACCAAACCTTTCAGTTGCCTCCGGCGGCCCTGGGCCGACGCGGCGCGCGACCTCCCCGTTCGCGGGGGGGCCGCTCCTCGCGGCGGACCACCCGCCGGGCGGTCATAAACAAAACCTTTTGTCGAGATGGCATCGTCTAATTTCTTCATAACACAATATGAAATACAACTTTTAACAATGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGATTTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCTCTTGGTATTCCTCGAGGCATGCCTGTTCGAGCGTCGTTACGCCCCTCAAGCGCAAGCTTGGTGTTGGGGATCGCCCCTGAGATACGGCGGCGGCCCTTAAATGCATCGGCGGTGCTGGTGTCAGCCCGGAGCGCAGCAGACATGCGGCTTCCAGGCGACCACGCGCCCGCCGGACAACGACCCGACTTTCAAACGTCGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA。

[0063] (3) Construct a phylogenetic tree: Based on the ITS sequencing results, the 16S rRNA information of the top 10 species with the highest similarity to the species obtained by blasting the Seq-ITS sequence against the NT database of the NCBI website was used to construct a phylogenetic tree related to the endophytic fungus MD9F through MEGA software. As Figure 2 shown, the results of the phylogenetic tree indicate that the 16S rRNA of the endophytic fungus MD9F has a very high genetic relationship with the registered strain Mycoleptodiscus sp. MK640614.1, and the ITS sequence identity between the two is as high as 99.6%. Therefore, based on the morphological and molecular biological identification results of the strain MD9F, its species classification was assigned to Mycoleptodiscus sp. MD9F and deposited in the General Microbiology Center of the China Microbial Culture Collection Center on August 7, 2024, with the deposit number: CGMCC No. 3.28116.

[0064] Example 2: Application of endophytic fungus MD9F in efficient degradation of chloramphenicol.

[0065] 1. Degradation of chloramphenicol by the endophytic fungus MD9F.

[0066] (1) Preparation of biological culture medium of strain MD9F: Select the MD9F strain stored in a -80℃ refrigerator, streak it on PDA solid medium without chloramphenicol for activation, and place it in a biological incubator at a constant temperature of 30℃ and away from light for 7 days to produce spores. Rinse the surface of the strain with 1 mL of 10% glycerol several times to obtain the obtained culture medium.

[0067] (2) Preparation of MD9F seed solution: Take 1 mL of biological culture solution prepared with 10% glycerol and add it to 50 mL of PDB liquid culture. Incubate in a constant temperature shaker at 30°C and 200 rpm in the dark for 30 h or until the logarithmic growth phase.

[0068] (3) Preparation of the fermentation broth extract of strain MD9F for detecting chloramphenicol residues: 0.5 mL of seed liquid was taken and evenly spread on the surface of three pre-prepared PDA solid culture medium plates with high chloramphenicol concentration (initial concentration 50 μg / mL), and a PDA solid culture medium plate with high chloramphenicol concentration but no strain was inoculated was set as a blank control. The plates were incubated in a biological incubator at a constant temperature of 30°C and protected from light. The culture medium with strain MD9F was collected 1 d, 2 d, and 7 d after inoculation, and the culture medium with strain and blank control culture medium were cut into 1 cm small cubes with a scalpel. The small cubes were fully homogenized with the help of a grinder. Two volumes of methanol solution were added in a 1:2 ratio, mixed and ultrasonically treated for 30 min, and the methanol extract was fully extracted and filtered to collect the methanol extract. Methanol was added to the residue again and the extraction process was repeated once. The methanol extracts before and after were combined, concentrated by a rotary evaporator, and then redissolved in 1 mL of methanol to obtain the MD9F fermentation broth extract sample for detecting chloramphenicol residues at different treatment time periods.

[0069] 2. Identification of chloramphenicol degradation products and detection of degradation efficiency.

[0070] (1) Centrifuge the methanol extract at 12,000 rpm for 10 min, take 30 μL of the supernatant and carefully add it to the liner of the HPLC sample vial.

[0071] (2) Perform high performance liquid chromatography (HPLC) to detect the chloramphenicol content at different degradation times according to the conditions and elution procedures shown in Table 1. According to the retention time and ultraviolet absorption characteristics of the chloramphenicol standard in the HPLC test, the HPLC spectra of the endophytic fungus MD9F test sample and the blank control sample were compared ( Figure 3in A), and determine the chemical structure of chloramphenicol degradation product 1 based on mass spectrometry and nuclear magnetic data information.

[0072] Liquid chromatography column: C18; pore size: 1.7 μm; column specification: 3.0 × 100 mm.

[0073] Table 1 HPLC detection procedure for chloramphenicol degradation products

[0074] Time (min) Mobile phase A (0.5% formic acid, %vol) Mobile phase B (acetonitrile, % / vol) Flow rate (mL / min) 0.00 90.0 10.0 1.0 5.00 80.0 20.0 1.0 35.00 30.0 70.0 1.0 45.00 10.0 90.0 1.0 46.00 0.0 100.0 1.0 70.00 0.0 100.0 1.0

[0075] According to the signal intensity of the ultraviolet absorption peak of chloramphenicol remaining in the crude extract sample of the fermentation broth of endophytic fungus MD9F, compared with the signal intensity of the ultraviolet absorption peak of chloramphenicol in the blank control sample, calculate the relative degradation efficiency of chloramphenicol at different times. As Figure 3 shown in the result of B in, under the condition of the initial concentration of chloramphenicol being 50 μg / mL, there is a relative degradation rate of 25% of chloramphenicol 1 day after inoculation with endophytic fungus MD9F, a degradation rate of 47% after 2 days of inoculation, and the relative degradation rate of chloramphenicol is about 98.5% when cultured for 7 days.

[0076] (3) At the same time, the appearance of a new chromatographic peak (2) (retention time: about 9.2 min) can be observed from the HPLC chromatogram of the above fermentation broth extract, and its content is positively correlated with the culture time. To further confirm that it is a chloramphenicol degradation product, we enriched this chromatographic peak from a large amount of fermentation products and determined its structure as N-[(1R,2R)-2-hydroxy-1-(hydroxymethyl)-2-(4-nitrophenyl)ethyl]acetamide, the dechlorinated product of chloramphenicol, by high-resolution mass spectrometry (HRMS) and nuclear magnetic resonance (NMR), see Figure 4 .

[0077] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all belong to the protection scope of the present invention.

Claims

1. An endophytic fungus Mycoleptodiscus sp. MD9F, characterized in that This strain is deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms, with the deposit number of CGMCC No. 3.28116.

2. A bacterial agent, characterized in that, It contains the endophytic fungus MD9F described in claim 1.

3. A degrading agent for chloramphenicol, characterized in that, It contains the endophytic fungus MD9F described in claim 1 or the microbial agent described in claim 2.

4. The degrading agent according to claim 3, wherein It further includes the materials for culturing the endophytic fungus MD9F; the materials for culturing the endophytic fungus MD9F include PDA medium.

5. Application of the endophytic fungus MD9F described in claim 1, the microbial agent described in claim 2, or the degrading agent described in claim 3 or 4 in degrading chloramphenicol.

6. A method for degrading chloramphenicol, characterized in that, It includes the following steps: Inoculate or apply the degrading agent described in claim 3 or 4 to the material to be degraded containing chloramphenicol for degradation; the material to be degraded containing chloramphenicol includes PDA solid medium containing chloramphenicol.

7. The method according to claim 6, wherein The mass concentration of chloramphenicol in the material to be degraded is ≤50 μg / mL.

8. The method according to claim 6, characterized in that, The degradation is carried out under light-proof conditions; the temperature of the degradation is 30°C.

Citation Information

Patent Citations

  • Mycoleptodiscin type indole sesquiterpene compound as well as biosynthesis method and application thereof

    CN114350524A

  • Chlorella-based production of extracellular vesicle-embedded small RNA for biological prevention and treatment

    CN116887680A