Encoding gene of cdo1, encoding gene of tau e and application of overexpression strain thereof in degrading feather

Abstract

The application discloses a coding gene of CDO1, a coding gene of TauE and application of a strain overexpressing the same in degradation of feathers. The application takes Streptomyces sp. SCUT-1 as a starting strain, and overexpresses cysteine dioxygenase CDO1 and a sulfite efflux pump TauE by using a high-efficiency promoter scutP1. The sulfite production and excretion capacity of the recombinant strain are obviously improved compared with the starting strain Streptomyces sp. SCUT-1, and the degradation efficiency of the recombinant strain is obviously enhanced. The recombinant strain can directly utilize waste feathers as the only carbon and nitrogen source for fermentation, and the highest soluble amino acid and polypeptide yield recovered is 2.00 times that of the starting strain. The application has great significance in high-value conversion of waste feathers, and does not need to add a reducing agent additionally, so that the application has important values in reducing production cost and improving yield under mild reaction conditions.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of bioengineering technology, in particular to the application of CDO1 coding gene, TauE coding gene and overexpression strain thereof in degrading feather. BACKGROUND

[0002] About 50 billion chickens are raised globally each year as a source of meat and eggs; in 2022, China's white-feather broiler and yellow-feather broiler output reached 982 million, with a cumulative chicken meat output of 16,608,000 tons. Feathers account for about 5-10% of the weight of poultry and contain more than 90% of keratin, which is one of the main keratin waste. According to statistics, more than 6 million tons of feather by-products are generated annually, but due to the presence of a large number of disulfide bonds and intermolecular interaction forces in feathers, they have high stability and hydrolysis resistance, so it is difficult to be degraded under general conditions, which makes the large-scale industrial application of feather waste very limited. Most of the feathers are burned or discarded in landfills, which not only increases the environmental burden, but also leads to the waste of keratin resources.

[0003] In recent years, with the increasing attention to environmental problems, many researchers have begun to develop and apply feathers, such as using them as animal feed or organic fertilizer. The traditional processing method for feather waste mainly adopts physical and chemical methods. The physical method mainly adopts high temperature and high pressure to break the chemical bonds such as disulfide bond and hydrogen bond, thereby destroying the spatial structure of feather keratin, and obtaining soluble polypeptide or oligopeptide. Although the traditional physical method is mature and has low cost, but due to the action of high temperature and high pressure, some essential amino acids such as lysine, methionine and tryptophan are destroyed, and in most cases only polypeptide mixture and low molecular weight protein can be obtained. The chemical method refers to the use of external chemical reagents to destroy the secondary structure of keratin, so that the insoluble keratin is decomposed into soluble protein. It mainly includes strong acid and alkali hydrolysis and oxidation-reduction treatment. Although the chemical method requires less energy than the physical method, but when recycling waste feathers, it is easy to produce serious wastewater pollution, and the neutralization of acid and alkali produces a large amount of salt, which reduces its performance as feed. In addition, some harmful reagents used in the hydrolysis process are difficult to recycle, which will bring certain environmental pollution. High energy consumption, serious secondary pollution and other problems make it difficult for physical and chemical methods to meet the demand of waste feather recycling, and it is urgent to develop more green and efficient recycling methods. Biological method has mild reaction conditions and less secondary pollution, and is an environmentally friendly feather recycling method. Biological method includes enzymatic hydrolysis and microbial degradation, which refers to using enzymes produced by microorganisms or directly using microorganisms to treat keratin, and degrading keratin-rich materials into soluble polypeptides or amino acids. Enzymatic hydrolysis is a method that uses protease to hydrolyze the protein components in feathers under mild conditions to obtain the final product. Although enzymatic hydrolysis has the advantages of green and sustainable, but the feathers rich in disulfide bonds are difficult to be efficiently hydrolyzed by a single protease, often need to be used in combination with disulfide bond reducing enzymes or reducing agents (such as sodium sulfite), resulting in high cost of enzymatic hydrolysis, which is not conducive to large-scale industrial production. Microbial degradation is to use microorganisms with keratin degradation function to hydrolyze feathers in the fermentation process to obtain hydrolysate. Microbial fermentation method has the advantages of green and environmental protection of enzymatic hydrolysis, and because the living cells of microorganisms can have disulfide bond reduction mechanism, it is not necessary to add additional disulfide bond reducing enzymes or reducing agents in the fermentation process, so it has more advantages than enzymatic hydrolysis. In addition, the large amount of microbial proteins contained in the fermentation products can also improve the problem of imbalance of essential amino acids in feed and increase the digestibility of animals. However, the feather degradation efficiency of the currently screened microorganisms is low, which is difficult to meet the demand of industrial production. Therefore, it is the key to realize efficient and green recycling of feathers to genetically engineer microorganisms to further improve the feather degradation ability of microorganisms. Therefore, it is necessary to obtain new microbial strains that can efficiently degrade and recycle feathers. SUMMARY

[0004] The primary object of the present application is to overcome the shortcomings and deficiencies of the prior art, and provide the application of the coding gene of cysteine dioxygenase CDO1 and the coding gene of sulfite efflux pump TauE.

[0005] Another object of the present application is to provide the recombinant bacteria of overexpression of the coding gene of cysteine dioxygenase CDO1 and / or overexpression of the coding gene of sulfite efflux pump TauE and the application thereof.

[0006] The object of the present application is achieved by the following technical solutions:

[0007] The application of overexpression of the coding gene of sulfite efflux pump TauE in improving the tolerance of Streptomyces to sulfite.

[0008] Further, the coding gene of sulfite efflux pump TauE is (also as shown in SEQ ID No. 1):

[0009]

[0010] Further, the Streptomyces comprises Streptomyces SCUT-1.

[0011] The application of overexpression of the gene encoding cysteine dioxygenase CDO1 and / or overexpression of the gene encoding sulfite efflux pump TauE in improving the ability of Streptomyces to degrade feathers.

[0012] Further, the gene encoding sulfite efflux pump TauE is shown as SEQ ID No. 1.

[0013] Further, the gene encoding cysteine dioxygenase CDO1 is (also shown as SEQ ID No. 2):

[0014] ATGACTTCCCCGCCCGAATCACCCGCCGTCGGCCCGCGCACGACCGACCGCCTGGCCGCCCTCGTGGACGACATACGCAAGGCCGTGGAACGCGGCCTCCCCCCGGACGCCACCGCGCACCTGGTCGGCGAGAGACTGGCCCCCCACCTCGGGGCCCCCGACCTGCTCGCGCCCGAGCAGTGCGAGGGCGACGCCGCGCGCTACCGCCAGCACCTGCTGCACGCGGAGGCCGACGGCAGCTTCTCCCTCGTCTCCCTCGTCTGGCTGCCGGGGCAGAGCACCTCCGTGCACGACCACGTCTCCTGGTGCGTCACCGGGGTCCACCGGGGCGAGGAGCACGAGCGCCGCTACCGGCTGGTGCCCGCCTCCGACGGCGCACCGGCGCGGCTGGCCGCCACCGAGGACGCGGTGAACCCCGTGGGCGCGGTGTGCGGCTTCGCCCCGCCCGGCGACATCCACCGCGTGTGGAACGGCTGCTCGCACAAGGCCGTGTCCCTCCACGTCTACGGGGCGGACGTCTCCCGGCTGGGCTCCAGCGTCCGCCGGGTGTACGACCTGCCCGCCGACCACTGA.

[0015] Further, the overexpression is performed in Streptomyces; further, the Streptomyces comprises Streptomyces SCUT-1.

[0016] Further, the degradation of feathers is by using Streptomyces.

[0017] Use of streptomyces with overexpressed gene of sulfite efflux pump TauE in degrading feather.

[0018] Further, the original strain of the streptomyces with overexpressed gene of sulfite efflux pump TauE comprises streptomyces SCUT-1.

[0019] Further, the gene of sulfite efflux pump TauE is as shown in SEQ ID No. 1.

[0020] Use of streptomyces with overexpressed gene of cysteine dioxygenase CDO1 in degrading feather.

[0021] Further, the original strain of the streptomyces with overexpressed gene of cysteine dioxygenase CDO1 comprises streptomyces SCUT-1.

[0022] Further, the gene of cysteine dioxygenase CDO1 is as shown in SEQ ID No. 2.

[0023] Use of streptomyces with overexpressed gene of cysteine dioxygenase CDO1 and overexpressed gene of sulfite efflux pump TauE in degrading feather.

[0024] Further, the original strain of the streptomyces with overexpressed gene of cysteine dioxygenase CDO1 and overexpressed gene of sulfite efflux pump TauE comprises streptomyces SCUT-1.

[0025] Further, the gene of sulfite efflux pump TauE is as shown in SEQ ID No. 1; the gene of cysteine dioxygenase CDO1 is as shown in SEQ ID No. 2.

[0026] Further, the overexpression is performed by using overexpression promoter scutP1, and the nucleic acid sequence of the promoter scutP1 is (also as shown in SEQ ID No. 3):

[0027] CGGCCCCTGAGCACGAAGTAGGCGCCGACGGCCAGCAGCAGCGCCAGCTGCGCCCAGGCCGCCAGGAGCACCAGTCCCCGGTCCGCCATCGTCCGCCCTCCGCCCTTGCCTCCGTGTGGGCGGCCGCCTACCCCGGCCCCCGCGTCCGGATGCGCGCGGCGGCCGGCAGGCACCCGTCCGGGTGTGCGGCCGGGCGGGGGGCCGTCCCGCCGGGCGGGGGCCGTCCCGCCGGGCGGGGCCCGGGTCCTACCACTCCGGGGCGTGGATTTTCGGACGTTTCCCGCCGGGCGAGGGGGTACGGCGCCCGCGGGCCCGGCCCCACCCCTATGCTTCTACATGTCTGTAGAAACAAGCGAGGGCGGTGCGGGCCTCCCCTGCCGTCCTGCGGGACGCGGTCGTCCGGCCCGGCCGGGCCCCGGCCCGCACCTCTCTCTTTCGCATTCGTCCCCGGAAGGACCGTC.

[0028] A recombinant Streptomyces bacterium comprising a recombinant vector; the recombinant vector comprising a promoter scutP1; the recombinant vector further comprising a coding gene of cysteine dioxygenase CDO1 and / or a coding gene of sulfite efflux pump TauE.

[0029] Further, the coding gene of sulfite efflux pump TauE is shown in SEQ ID No. 1;

[0030] Further, the coding gene of cysteine dioxygenase CDO1 is shown in SEQ ID No. 2;

[0031] Further, the nucleic acid sequence of promoter scutP1 is shown in SEQ ID No. 3.

[0032] Further, in the recombinant vector, the nucleic acid sequence of promoter scutP1 is connected to the coding gene of cysteine dioxygenase CDO1, or the nucleic acid sequence of promoter scutP1 is connected to the coding gene of sulfite efflux pump TauE, or the nucleic acid sequence of promoter scutP1, the coding gene of cysteine dioxygenase CDO1 and the coding gene of sulfite efflux pump TauE are connected in sequence.

[0033] Further, the original strain of the recombinant Streptomyces bacterium comprises Streptomyces SCUT-1.

[0034] The application of the above-mentioned Streptomyces recombinant bacteria in degrading feather.

[0035] The application in degrading feather comprises the following steps:

[0036] The above-mentioned bacteria are inoculated into a fermentation medium for fermentation.

[0037] The fermentation medium uses feather as the only carbon source and nitrogen source.

[0038] Further, the fermentation medium comprises the following components: 50 g / L dry feather, 0.5 g / L sodium chloride, 0.4 g / L potassium dihydrogen phosphate and 0.3 g / L dipotassium hydrogen phosphate, and the pH is adjusted to 10.0 by sodium hydroxide. Further, the fermentation medium further comprises water.

[0039] Further, the fermentation conditions are as follows: 30-45℃, 150-250 rpm, and the culture time is 24-72 h. Preferably, the temperature is 40℃, the rpm is 220, and the culture time is 48 h.

[0040] Further, the bacteria are subjected to seed liquid culture, that is, inoculated into a seed culture medium to obtain a seed liquid.

[0041] Further, the seed culture medium comprises the following components: 10.0 g / L tryptone, 10.0 g / L sodium chloride and 5.0 g / L yeast extract.

[0042] Further, the inoculation amount of the seed liquid is 1% of the volume of the fermentation medium.

[0043] The present application has the following advantages and effects relative to the prior art:

[0044] (1) The present application uses the endogenous high-efficiency promoter scutP1 of the starting strain Streptomyces SCUT-1, and constructs a Streptomyces recombinant bacteria with single overexpression and co-overexpression of cysteine dioxygenase CDO1 and sulfite efflux pump TauE through genetic engineering technology. Compared with the starting strain, the recombinant bacteria significantly improve the production and excretion of reducing power-sulfite;

[0045] (2) The present application uses waste feather as the only carbon and nitrogen source to prepare the fermentation medium, and degrades the feather by microbial degradation method to recover soluble amino acids and polypeptides. It has the advantages of green and efficient, and realizes the high-value conversion of cheap waste feather.

[0046] (3) The present application does not need to use complex pretreatment process, does not need to prepare enzyme preparation process separately, does not need to use reducing agent, acid, alkali or other toxic chemical reagents, and has the advantages of mild reaction conditions, simple process, low cost and green environmental protection.

[0047] (4) The fermented feather powder prepared by this invention can be used as a high-quality raw material for animal feed, plant organic fertilizer and other products, and can be applied in agricultural production. Attached Figure Description

[0048] Figure 1 This is a diagram of the recombinant vector pSET152-scutP1-cdo1.

[0049] Figure 2 This is a diagram of the recombinant vector pSET152-scutP1-tauE.

[0050] Figure 3 This is a diagram of the recombinant vector pSET152-scutP1-cdo1-tauE.

[0051] Figure 4 This is a comparison of the supernatant sulfite content measured in LB medium by the starting strain Streptomyces SCUT-1 and recombinant strains SCUT-cdo1, SCUT-tauE, and SCUT-cdo1-tauE.

[0052] Figure 5 This is a comparison of sulfite tolerance of the starting strain Streptomyces SCUT-1 and recombinant strains SCUT-cdo1, SCUT-tauE, and SCUT-cdo1-tauE on solid Gao Shi No. 1 medium plates.

[0053] Figure 6 This is a comparison chart of amino acid recovery from fermented feathers by the starting strain Streptomyces SCUT-1 and recombinant strains SCUT-cdo1, SCUT-tauE, and SCUT-cdo1-tauE.

[0054] Figure 7 This is a comparison chart of the soluble polypeptide recovery rates of the starting strain Streptomyces SCUT-1 and recombinant strains SCUT-cdo1, SCUT-tauE, and SCUT-cdo1-tauE fermented feathers. Detailed Implementation

[0055] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field. Unless otherwise specified, the reagents and raw materials used in the present invention are all commercially available.

[0056] Example 1

[0057] Construction of recombinant Streptomyces strains overexpressing the cysteine ​​dioxygenase gene CDO1 and / or the sulfite efflux pump gene TauE

[0058] 1. Cultivation of Streptomyces sp. SCUT-1

[0059] Streptomyces sp. SCUT-1 was inoculated on a solid Gause’s No. 1 medium plate (consisting of soluble starch 20 g, potassium nitrate 1 g, potassium phosphate dibasic 0.5 g, magnesium sulfate heptahydrate 0.5 g, sodium chloride 0.5 g, ferrous sulfate heptahydrate 0.01 g, agar powder 20 g, and distilled water 1 L) at 37 °C for 5-7 days to produce gray-green spores. The Streptomyces sp. SCUT-1, with the accession number GDMCC No: 60612, was deposited at the Guangdong Microbial Culture Collection Center, located at No. 59, Building 100, Martyrs’ Road, Guangzhou, on March 20, 2019, and has been disclosed in Chinese patent application CN201910491700.8.

[0060] 2. Extraction of genomic DNA of Streptomyces sp. SCUT-1

[0061] (1) The spores of Streptomyces sp. SCUT-1 obtained in step 1 were inoculated into a seed liquid medium (consisting of tryptone 10 g, sodium chloride 10 g, yeast extract 5 g, and distilled water 1 L) using an inoculation loop, and cultured at 37 °C with shaking at 220 rpm for 24 h to obtain a seed liquid of Streptomyces sp. SCUT-1.

[0062] (2) 1 mL of the seed liquid of Streptomyces sp. SCUT-1 was taken, and genomic DNA was extracted using a soil genomic DNA rapid extraction kit (purchased from Shengong Bioengineering Co., Ltd.) according to the standard procedure in the kit instructions.

[0063] 3. Preparation of spore preservation solution of Streptomyces sp. SCUT-1

[0064] The spores of Streptomyces sp. SCUT-1 obtained in step 1 were inoculated into a spore preservation medium (consisting of tryptone 16 g, yeast extract 10 g, sodium chloride 5 g, and distilled water 1 L) using an inoculation loop, and stored at 4 °C for 5-7 days to obtain a spore preservation solution of SCUT-1.

[0065] 4. Construction of recombinant vectors pSET152-scutP1-cdo1, pSET152-scutP1-tauE, and pSET152-scutP1-cdo1-tauE

[0066] The pSET152-scutP1 plasmid (the construction of pSET152-scutP1 has been disclosed in the patent "A promoter for overexpressing protease, streptomyces recombinant bacteria and construction method and application thereof, publication number: CN115927332A") is treated with NdeI restriction endonuclease and purified and recovered to obtain a pSET152-scutP1 linearized vector.

[0067] The streptomyces SCUT-1 genome is used as a template to design primers cdo1-Fw

[0068] (5’- cggaaggaccgtcca ATGACTTCCCCGCCCGAATC-3’) (the underlined part represents a homologous fragment required for seamless cloning connection) and cdo1-Rv (5’- ctagaggatccccaacatatg TCAGTGGTCGGCGGGCA-3’) (the underlined part represents a homologous fragment required for seamless cloning connection), to obtain a cdo1 fragment by PCR amplification and purification recovery.

[0069] The streptomyces SCUT-1 genome is used as a template to design primers tauE-Fw

[0070] (5’- cggaaggaccgtcca ATGGGCCGACTCCGGCAGT-3’) (the underlined part represents a homologous fragment required for seamless cloning connection) and tauE-Rv (5’- ctagaggatccccaaca TCAGGCGACCAGGAGCA-3’) (the underlined part represents a homologous fragment required for seamless cloning connection), to obtain a tauE fragment by PCR amplification and purification recovery.

[0071] The streptomyces SCUT-1 genome is used as a template to design primers cdo1-tauE-Fw

[0072] (5’- cggaaggaccgtcca ATGACTTCCCCGCCCGAATC-3’) (the underlined part represents a homologous fragment required for seamless cloning connection) and cdo1-tauE-Rv (5’- ctagaggatccccaaca TCAGGCGACCAGGAGCA-3’) (the underlined part represents a homologous fragment required for seamless cloning connection), to obtain a cdo1-tauE fragment by PCR amplification and purification recovery.

[0073] The linearized vector pSET152-scutP1 was ligated with cdo1 fragment, tauE fragment and cdo1-tauE fragment respectively by seamless cloning, and the ligation reagent was TSINGKE TSV-S1 TreliefSoSoo Cloning Kit (purchased from Beijing Genki Biotechnology Co., Ltd.), and the ligation reaction system was shown in Table 1:

[0074] Table 1. Ligation reaction system

[0075]

[0076] The ligation products were transformed into E. coli DH5α, single colonies were picked on LB plates containing apramycin (LB plates containing apramycin were composed of the following components: tryptone 10 g, sodium chloride 10 g, yeast extract 5 g, apramycin 50 mg, agar powder 20 g and distilled water 1 L), plasmids were extracted and sequenced to verify, and recombinant vectors pSET152-scutP1-cdo1, pSET152-scutP1-tauE and pSET152-scutP1-cdo1-tauE were obtained. (The schematic diagram of the recombinant vector was shown in Figures 1 to 3 )

[0077] 5. Construction of recombinant Streptomyces

[0078] The recombinant vectors pSET152-scutP1-cdo1, pSET152-scutP1-tauE and

[0079] pSET152-scutP1-cdo1-tauE were electrotransformed into the E. coli ET12567 / pUZ8002 host, respectively, to obtain the E. coli transformant strains ET / pSET152-scutP1-cdo1, ET / pSET152-scutP1-tauE and ET / pSET152-scutP1-cdo1-tauE. The above E. coli were inoculated into LB medium containing Apramycin, Chloramphenicol and Kanamycin (the LB medium containing Apramycin, Chloramphenicol and Kanamycin consists of the following components: tryptone 10 g, sodium chloride 10 g, yeast extract 5 g, Apramycin 50 mg, Chloramphenicol 25 mg, Kanamycin 50 mg and distilled water 1 L) and cultured at 37°C, 220 rpm for 16 h. 4 mL of the culture of ET / pSET152-scutP1-cdo1, ET / pSET152-scutP1-tauE and ET / pSET152-scutP1-cdo1-tauE were centrifuged at 6000 x g for 2 min, and the supernatant was removed. The bacterial cells were resuspended with 2 mL of fresh LB medium, centrifuged at 6000 x g for 2 min, and the supernatant was removed to remove antibiotics in the culture.

[0080] 100 μL of the spore stock of Streptomyces SCUT-1 prepared in step 3, which was stored at 4°C, was incubated at 50°C for 10 min, mixed with the collected E. coli transformant strains ET / pSET152-scutP1-cdo1, ET / pSET152-scutP1-tauE and ET / pSET152-scutP1-cdo1-tauE, respectively, and then spread on solid MS medium plates (the solid MS medium consists of the following components: mannitol 20 g, soybean flour 20 g, magnesium chloride to a final concentration of 10 mM, agar powder 20 g and distilled water 1 L), and cultured at 30°C for 16 h.

[0081] The MS culture medium plate after culture was taken out. Another 1 mL of aqueous solution containing apramycin and nalidixic acid (the aqueous solution containing apramycin and nalidixic acid consists of the following components: apramycin 1 mg, nalidixic acid 0.5 mg and sterile water 1 mL) was uniformly covered on the MS culture medium plate. After the plate was fully air-dried, it was placed in a 37°C environment for 3-5 days of culture. After obvious single colonies grew on the MS culture medium plate, single colonies were picked up with an inoculation needle into seed liquid culture medium containing apramycin and nalidixic acid (the seed culture medium containing apramycin and nalidixic acid consists of the following components: tryptone 10 g, sodium chloride 10 g, yeast extract 5 g, apramycin 50 mg, nalidixic acid 25 mg and distilled water 1 L), and was cultured at 37°C, 220 rpm for 48 h. 1 mL of the obtained bacterial liquid culture was taken, and genomic DNA was extracted using a soil genomic DNA rapid extraction kit (purchased from Shengong Bioengineering Co., Ltd.). The extraction steps were performed according to the standard procedures of the kit instructions. Universal primers

[0082] M13-47 (5'-CGCCAGGGTTTTCCCAGTCACGAC-3') and

[0083] M13-48 (5'-AGCGGATAACAATTTCACACAGGA-3'),

[0084] The extracted genomic DNA was used as a template for PCR verification, and streptomyces recombinant bacteria were obtained, designated as SCUT-Ocdo1, SCUT-OtauE and SCUT-Ocdo1-tauE. SCUT-Ocdo1, SCUT-OtauE and SCUT-Ocdo1-tauE were respectively E. coli transformed strain ET / pSET152-scutP1-cdo1, ET / pSET152-scutP1-tauE and ET / pSET152-scutP1-cdo1-tauE and SCUT-1 conjugation.

[0085] Example 2

[0086] Evaluation of the sulfite production capacity of streptomyces recombinant bacteria SCUT-Ocdo1, SCUT-OtauE and SCUT-Ocdo1-tauE

[0087] (1) The starting strain Streptomyces SCUT-1, the recombinant bacteria SCUT-Ocdo1, SCUT-OtauE and SCUT-Ocdo1-tauE obtained in Example 1 were inoculated into seed liquid medium (the seed liquid medium was composed of the following components: 10 g of tryptone, 10 g of sodium chloride, 5 g of yeast extract and 1 L of distilled water) respectively, and cultured at 37°C, 220 rpm for 24 h to obtain Streptomyces SCUT-1 seed liquid, recombinant bacteria SCUT-Ocdo1 seed liquid, recombinant bacteria SCUT-OtauE seed liquid and recombinant bacteria SCUT-Ocdo1-tauE seed liquid.

[0088] (2) Streptomyces SCUT-1 seed liquid, recombinant bacteria SCUT-Ocdo1 seed liquid, recombinant bacteria SCUT-OtauE seed liquid and recombinant bacteria SCUT-Ocdo1-tauE seed liquid were inoculated into fermentation medium (the fermentation medium was composed of the following components: 10 g of tryptone, 10 g of sodium chloride, 5 g of yeast extract and 1 L of distilled water) at a volume of 1% of the fermentation medium, and cultured at 40°C, 220 rpm for 12 h. The culture was centrifuged at 12000 x g, 4°C for 5 min, and the supernatant fermentation broth was collected for sulfite content determination.

[0089] (3) The determination of sulfite content was carried out according to the following steps:

[0090] The determination was carried out using an R-Biopharm (purchased from Damstadt Company in Germany) kit, and the determination steps were carried out according to the standard procedure of the kit instruction manual.

[0091] The yields of sulfite produced by the starting strain SCUT-1, the recombinant bacteria SCUT-Ocdo1, the recombinant bacteria SCUT-OtauE and the recombinant bacteria SCUT-Ocdo1-tauE are shown in Table 1. Figure 4 The determination results show that the yield of sulfite produced by Streptomyces SCUT-1 is 2.54 mg / L; the yield of sulfite produced by the recombinant bacteria SCUT-Ocdo1 is 4.61 mg / L, which is 1.81 times that of the starting strain; the yield of sulfite produced by the recombinant bacteria SCUT-OtauE is 6.53 mg / L, which is 2.57 times that of the starting strain; the yield of sulfite produced by the recombinant bacteria SCUT-Ocdo1-tauE is 7.54 mg / L, which is 2.97 times that of the starting strain.

[0092] Example 3

[0093] Evaluation of the sulfite resistance ability of the recombinant bacteria SCUT-Ocdo1, SCUT-OtauE and SCUT-Ocdo1-tauE of Streptomyces

[0094] (1) The starting strain Streptomyces SCUT-1, the recombinant bacteria SCUT-Ocdo1, SCUT-OtauE and SCUT-Ocdo1-tauE obtained in Example 1 were inoculated into seed liquid medium (the seed liquid medium was composed of the following components: 10 g of tryptone, 10 g of sodium chloride, 5 g of yeast extract and 1 L of distilled water), and cultured at 37 °C, 220 rpm for 24 h to obtain Streptomyces SCUT-1 seed liquid, recombinant bacteria SCUT-Ocdo1 seed liquid, recombinant bacteria SCUT-OtauE seed liquid and recombinant bacteria SCUT-Ocdo1-tauE seed liquid.

[0095] (2) Streptomyces SCUT-1 seed liquid, recombinant bacteria SCUT-Ocdo1 seed liquid, recombinant bacteria SCUT-OtauE seed liquid and recombinant bacteria SCUT-Ocdo1-tauE seed liquid were streaked on solid Gause No. 1 medium plates covered with 1 mL of solid Gause No. 1 medium without sodium sulfite or containing 1 M sodium sulfite (the solid Gause No. 1 medium was composed of the following components: 20 g of soluble starch, 1 g of potassium nitrate, 0.5 g of potassium phosphate dibasic, 0.5 g of magnesium sulfate heptahydrate, 0.5 g of sodium chloride, 0.01 g of ferrous sulfate heptahydrate, 20 g of agar powder and 1 L of distilled water), and cultured at 37 °C for 3 days.

[0096] The results of the sulfite plate resistance of the starting strain SCUT-1, the recombinant bacteria SCUT-Ocdo1, the recombinant bacteria SCUT-OtauE and the recombinant bacteria SCUT-Ocdo1-tauE on the third day are shown in Table 1. Figure 5 As shown in Table 1, on the solid Gause No. 1 medium plates without sodium sulfite, the growth states of the recombinant bacteria SCUT-Ocdo1, the recombinant bacteria SCUT-OtauE and the recombinant bacteria SCUT-Ocdo1-tauE were consistent with those of the starting strain SCUT-1. On the solid Gause No. 1 medium plates containing 1 M sodium sulfite, the starting strain SCUT-1 and the recombinant bacteria SCUT-Ocdo1 were highly sensitive to sulfite, and their growth on the plates containing sulfite was inhibited; however, the growth of the recombinant bacteria SCUT-OtauE and the recombinant bacteria SCUT-Ocdo1-tauE was not affected.

[0097] Example 4

[0098] Evaluation of the ability of the Streptomyces recombinant bacteria SCUT-Ocdo1, SCUT-OtauE and SCUT-Ocdo1-tauE to degrade feathers in liquid fermentation

[0099] (1) The starting strain Streptomyces SCUT-1, the recombinant bacteria SCUT-Ocdo1, SCUT-OtauE and SCUT-Ocdo1-tauE obtained in Example 1 were inoculated into seed liquid medium (the seed liquid medium was composed of the following components: 10 g of tryptone, 10 g of sodium chloride, 5 g of yeast extract and 1 L of distilled water) respectively, and cultured at 37°C, 220 rpm for 24 h to obtain Streptomyces SCUT-1 seed liquid, recombinant bacteria SCUT-Ocdo1 seed liquid, recombinant bacteria SCUT-OtauE seed liquid and recombinant bacteria SCUT-Ocdo1-tauE seed liquid.

[0100] (2) The Streptomyces SCUT-1 seed liquid, the recombinant bacteria SCUT-Ocdo1 seed liquid, the recombinant bacteria SCUT-OtauE seed liquid and the recombinant bacteria SCUT-Ocdo1-tauE seed liquid were inoculated into fermentation medium (the fermentation medium was composed of the following components: 50 g of dry feather, 0.5 g of sodium chloride, 0.4 g of potassium dihydrogen phosphate, 0.3 g of dipotassium hydrogen phosphate and 1 L of distilled water, and the pH was adjusted to 10.0 with sodium hydroxide) at an inoculation amount of 1% of the volume of the fermentation medium, and cultured at 40°C, 220 rpm for 48 h. The culture was centrifuged at 12000 x g, 4°C for 5 min, and the supernatant fermentation broth was collected for determination of the content of amino acids and soluble polypeptides.

[0101] (3) The determination of the content of amino acids was carried out according to the following steps:

[0102] 200 μL of the supernatant fermentation broth was taken into a centrifuge tube, 50 μL of A liquid was added, and then 50 μL of B liquid was added. After mixing, the mixture was reacted at 90°C for 30 min. After the reaction, the mixture was cooled in a water bath at 25°C, and then 950 μL of distilled water was added. After mixing, the mixture was allowed to stand for 5 min. Then 200 μL was taken and used to determine the absorbance at 570 nm using a 96-well enzyme-labeled plate and an enzyme-labeled instrument. 570 The OD value was substituted into the standard curve to calculate the content of amino acids. The standard curve was constructed by dissolving isoleucine powder in distilled water to prepare standard solutions at concentrations of 0, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350 μg / mL, and using the same determination method as the sample to be determined.

[0103] The preparation steps of A liquid were as follows: 0.0907 g of potassium dihydrogen phosphate trihydrate and 4.5364 g of disodium hydrogen phosphate dodecahydrate were weighed and added to a 200 mL volumetric flask, and distilled water was added to make up to 200 mL.

[0104] The preparation steps of B solution are as follows: 1 g of hydantoin is weighed into a beaker containing 70 mL of hot water to dissolve, 80 mg of stannous chloride is added, filtered, the filtrate is taken to a 100 mL volumetric flask and distilled water is added to constant volume to 100 mL.

[0105] (4) The determination of the content of soluble polypeptide, the specific steps are as follows:

[0106] The determination is performed using TaKaRa BCA Protein Assay Kit (purchased from Baorai Medical Biotechnology Co., Ltd.) kit, and the determination steps are performed according to the standard procedure of the kit instruction manual.

[0107] The amino acid recovery amount of feather liquid fermented by the starting strain SCUT-1, the recombinant strain SCUT-Ocdo1, the recombinant strain SCUT-OtauE and the recombinant strain SCUT-Ocdo1-tauE is shown in Table 1, and the polypeptide recovery amount is shown in Table 2. Figure 6 Figure 7 The determination results show that the amino acid recovery amount of the starting strain SCUT-1 is 0.03 g / g, the soluble polypeptide recovery amount is 0.05 g / g, and the total recovery amount of amino acid and soluble polypeptide is 0.08 g / g; the amino acid recovery amount of the recombinant strain SCUT-Ocdo1 is 0.08 g / g, the soluble polypeptide recovery amount is 0.7 g / g, and the total recovery amount of amino acid and soluble polypeptide is 0.15 g / g, which is 1.88 times of the starting strain SCUT-1; the amino acid recovery amount of the recombinant strain SCUT-OtauE is 0.07 g / g, the soluble polypeptide recovery amount is 0.07 g / g, and the total recovery amount of amino acid and soluble polypeptide is 0.14 g / g, which is 1.75 times of the starting strain SCUT-1; the amino acid recovery amount of the recombinant strain SCUT-Ocdo1-tauE is 0.8 g / g, the soluble polypeptide recovery amount is 0.08 g / g, and the total recovery amount of amino acid and soluble polypeptide is 0.16 g / g, which is 2.00 times of the starting strain SCUT-1.

[0108] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited by the above examples, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application are equivalent replacement methods and are included in the protection scope of the present application.​

Claims

1. The application of overexpression of the gene encoding the sulfite efflux pump TauE in improving the tolerance of Streptomyces to sulfite, characterized in that, The gene encoding the sulfite efflux pump TauE is shown in SEQ ID No. 1; The Streptomyces mentioned is Streptomyces SCUT-1, with the preservation number GDMCC No: 60612.

2. The application of overexpression of the gene encoding the sulfite efflux pump TauE in enhancing the ability of Streptomyces to degrade feathers, characterized in that... The gene encoding the sulfite efflux pump TauE is shown in SEQ ID No. 1; The Streptomyces mentioned is Streptomyces SCUT-1, with the preservation number GDMCC No: 60612.

3. The application of overexpression of the gene encoding cysteine ​​dioxygenase CDO1 and the gene encoding the gene encoding sulfite efflux pump TauE in enhancing the ability of Streptomyces to degrade feathers, characterized in that... The gene encoding the sulfite efflux pump TauE is shown in SEQ ID No. 1; The gene encoding the cysteine ​​dioxygenase CDO1 is shown in SEQ ID No. 2; The Streptomyces mentioned is Streptomyces SCUT-1, with the preservation number GDMCC No: 60612.

4. The application of *Streptomyces* strains overexpressing the gene encoding the sulfite efflux pump TauE, or *Streptomyces* strains overexpressing both the gene encoding cysteine ​​dioxygenase CDO1 and the gene encoding the sulfite efflux pump TauE, in the degradation of feathers, characterized in that... The gene encoding the sulfite efflux pump TauE is shown in SEQ ID No. 1; The gene encoding the cysteine ​​dioxygenase CDO1 is shown in SEQ ID No. 2; The original strain of Streptomyces overexpressing the gene encoding the sulfite efflux pump TauE was Streptomyces SCUT-1, with accession number GDMCC No: 60612; The original strain of Streptomyces that overexpressed the gene encoding cysteine ​​dioxygenase CDO1 and the gene encoding sulfite efflux pump TauE was Streptomyces SCUT-1, with accession number GDMCC No: 60612.

5. The application according to claim 4, characterized in that, Includes the following steps: Inoculate the fermentation medium with bacteria and allow fermentation; The fermentation medium described above uses feathers as the sole carbon and nitrogen source. The bacteria mentioned are Streptomyces that overexpress the gene encoding the sulfite efflux pump TauE, or Streptomyces that overexpress both the gene encoding the cysteine ​​dioxygenase CDO1 and the gene encoding the sulfite efflux pump TauE.

6. The application according to claim 5, characterized in that, The fermentation medium comprises the following components: 50 g / L dry feathers, 0.5 g / L sodium chloride, 0.4 g / L potassium dihydrogen phosphate and 0.3 g / L dipotassium hydrogen phosphate, with the pH adjusted to 10.0 using sodium hydroxide; The fermentation conditions are: 30–45℃, 150–250 rpm, and culture time of 24–72 h.

7. The application according to any one of claims 1 to 6, characterized in that, The overexpression is performed using the overexpression promoter scutP1, the nucleic acid sequence of which is shown in SEQ ID No.

3.

8. A recombinant Streptomyces strain, characterized in that, It contains a recombinant vector; the recombinant vector contains the promoter scutP1; the recombinant vector also contains the gene encoding the sulfite efflux pump TauE; The gene encoding the sulfite efflux pump TauE is shown in SEQ ID No. 1; The nucleic acid sequence of the promoter scutP1 is shown in SEQ ID No. 3; In the recombinant vector, the nucleic acid sequence of the promoter scutP1 is linked to the gene encoding the sulfite efflux pump TauE; The original strain of the recombinant Streptomyces strain is Streptomyces SCUT-1, with the preservation number GDMCC No: 60612.

9. The recombinant bacteria according to claim 8, characterized in that, The recombinant vector also contains the gene encoding cysteine ​​dioxygenase CDO1; The gene encoding the cysteine ​​dioxygenase CDO1 is shown in SEQ ID No.

2.

10. The recombinant bacteria according to claim 9, characterized in that, In the recombinant vector, the nucleic acid sequence of the promoter scutP1, the gene encoding cysteine ​​dioxygenase CDO1, and the gene encoding sulfite efflux pump TauE are sequentially linked.

Images