SNP molecular marker related to pig initial estrus age and application thereof

By detecting SNP sites in the promoter region of the PLPP3 gene, the problem of predicting and regulating the onset of puberty in sows was solved, improving reproductive performance and the accuracy of breeding stock selection, and reducing the culling rate of abnormal follicle development.

CN119020499BActive Publication Date: 2026-05-19SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTH CHINA AGRICULTURAL UNIVERSITY
Filing Date
2024-08-16
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

In the current technology, the prediction and regulation of the first estrus period in sows has not been effectively solved, resulting in the failure of gilts to fully realize their reproductive performance, and the culling rate of sows due to abnormal follicle development is relatively high.

Method used

Genotyping was performed by detecting SNP sites in the promoter region of the porcine phospholipase 3 (PLPP3) gene, particularly the g.155798586T>C and g.155798718C>T sites. The association between these sites and puberty was then used to study the expression level of PLPP3 and ferroptosis using RNA-seq technology, and molecular markers were developed for assessing and regulating puberty.

Benefits of technology

It enables accurate prediction and regulation of sow puberty, improves sow reproductive performance, reduces culling rate caused by abnormal follicle development, and provides molecular genetic markers for breeding pig selection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119020499B_ABST
    Figure CN119020499B_ABST
Patent Text Reader

Abstract

The application discloses a SNP molecular marker related to pig initial estrus age and application thereof. The application takes PLPP3 as a research object, and adopts molecular and cell biology methods to study the correlation with initial estrus. It is found that the promoter region g.155798586T>C and g.155798718C>T are extremely significantly related to initial estrus (P<0.01), and further research shows that the TT genotype of the g.155798586 site and the CC genotype of the g.155798718 site promote the expression of PLPP3, and it is confirmed that PLPP3 can promote the ferroptosis of granulosa cells. It can be seen that the mutation of the promoter region of PLPP3 can affect the expression of PLPP3, and PLPP3 delays the initial estrus start by promoting the ferroptosis of pig ovarian granulosa cells. The application has good application value for the research on ovarian follicle development and initial estrus start.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and cell engineering technology, specifically to SNP molecular markers related to the age of pig puberty and their applications. Background Technology

[0002] Pride is the period when a female animal first exhibits estrus or ovulation, marking the beginning of sexual maturity. Producers can improve the lifetime reproductive performance of gilts by identifying those with earlier puberty onset. Studies have found that early puberty increases the likelihood of multiple litters in gilts. Most gilts culled for reproductive reasons exhibit delayed puberty. Slaughter experiments have found that approximately 40%-60% of gilts that do not show estrus have abnormal follicular development. Granulosa cells, the largest cell group within follicles, have been shown to be the main supporting and regulatory cells for follicles. Recent studies have found that iron accumulation in ovarian granulosa cells can trigger ferroptosis, hindering follicular development.

[0003] Promoters are DNA sequences located upstream of a gene that determine the site of transcription initiation. They not only regulate gene transcription levels but also participate in the fine-tuning of gene expression, including responding to intracellular and extracellular signals, maintaining tissue-specific expression patterns, and adjusting gene expression during development. Therefore, promoters play a crucial role in gene expression regulation. Single nucleotide polymorphisms (SNPs) are the most common form of genetic variation, involving changes in a single nucleotide in the DNA sequence. As key indicators of genetic diversity, SNPs provide important molecular tools for studying variety improvement.

[0004] Phospholipid phosphatase type 3 (PLPP3) is a member of the phosphatase family that dephosphorylates glycerophospholipids and sphingomyelin. PLPP3 has been shown to be a key player in regulating lipid homeostasis, dynamically expressed during development, and widely distributed in adult tissues. However, the link between the PLPP3 gene and the onset of puberty in sows remains unreported. Summary of the Invention

[0005] In order to overcome the problems existing in the prior art, one of the objectives of the present invention is to provide SNP molecular markers related to the age of pig puberty.

[0006] The second objective of this invention is to provide the application of the above-mentioned SNP molecular markers related to the age of pig puberty.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] SNP molecular markers associated with the age of puberty in pigs include at least one of the following SNP molecular markers:

[0009] (1) The SNP site corresponding to the g.155798586 site on chromosome 6 of the pig reference genome Sscrofa11.1 (i.e., the -2252bp promoter region of the pig phospholipase 3 (PLPP3) gene) with a T>C mutation;

[0010] (2) SNP site corresponding to the g.155798718 site on chromosome 6 of the pig reference genome Sscrofa11.1 (i.e., the promoter region of the pig phospholipase 3 (PLPP3) gene -2120bp) with C>T mutation.

[0011] The application of the above-mentioned SNP molecular markers related to the age of puberty in pigs includes at least one of the following applications:

[0012] A. Application in assessing the age of puberty in pigs;

[0013] B. Application in determining the onset of primary estrus in pigs;

[0014] C. Application in the selection and breeding of high-yielding pig breeds.

[0015] Furthermore, in application A, the genotype at locus g.155798586 is detected, and individuals with genotype CT have a shorter age at puberty than individuals with TT; and / or, the genotype at locus g.155798718 is detected, and individuals with genotype TT have a shorter age at puberty than individuals with TC, and both are shorter than individuals with CC.

[0016] Furthermore, in application B, the genotype at locus g.155798586 is detected, and pigs with genotype CT start estrus faster than pigs with TT; and / or, the genotype at locus g.155798718 is detected, and pigs with genotype TT start estrus faster than pigs with TC, and both are faster than pigs with CC.

[0017] Furthermore, in the application C, the genotype at the g.155798586 locus is detected, and individuals with the genotype CT are selected as breeding pigs; and / or, the genotype at the g.155798718 locus is detected, and individuals with the genotype TT or CT are selected, preferably individuals with the genotype TT, as breeding pigs.

[0018] Furthermore, the pigs mentioned include any one of Duroc and its synthetic lines.

[0019] The above applications are for non-diagnostic purposes.

[0020] A primer for identifying the above-mentioned SNP molecular markers associated with the age of puberty in pigs, comprising:

[0021] F: 5'-GGGCCCTGACCTTTTGACTA-3'

[0022] R: 5'-TCCAAATCCCTGCCAGTTCG-3'.

[0023] Application of the PLPP3 gene in regulating ferroptosis in porcine ovarian granulosa cells, wherein the application is any one or more of the following:

[0024] I. Application of PLPP3 gene overexpression in promoting ferroptosis in ovarian granulosa cells in vitro;

[0025] II. Application of knocking down the PLPP3 gene to inhibit ferroptosis in ovarian granulosa cells in vitro.

[0026] Furthermore, the overexpression of the PLPP3 gene is achieved by the following method: ligating the nucleic acid molecule encoding the porcine PLPP3 gene to the pcDNA3.1 plasmid to construct an overexpression vector; and then transfecting the overexpression vector containing the PLPP3 gene into granulosa cells of sow ovaries cultured in vitro.

[0027] Furthermore, the knockdown of the PLPP3 gene is achieved by transfecting siRNA, the siRNA sequence of which is as follows: 5′-CTGATGGTCCTCCTTGTAT-3′.

[0028] The promotion or inhibition of ferroptosis is determined by measuring the total iron and malondialdehyde (MDA) content and comparing the mRNA and protein expression levels of pathway marker genes.

[0029] This invention is achieved through the following technical solutions: identifying SNP sites in the PLPP3 promoter region and performing genotyping; statistically analyzing the genotype frequency, gene frequency, and population genetic structure of different sites; analyzing the association between different sites and age at puberty; and determining the effects of different genotypes on promoter activity and PLPP3 expression levels. Differentially expressed genes in porcine ovarian granulosa cells under PLPP3 overexpression and knockdown conditions are detected using RNA-seq, and their involved biological processes are analyzed. In vitro, the PLPP3 gene regulates ferroptosis in porcine ovarian granulosa cells. The verification results of this invention are as follows:

[0030] 1. The PLPP3 promoter region with a length of 2169bp was cloned.

[0031] 2. The PLPP3 promoter region contains four SNP sites: g.155798586T>C, g.155798718C>T, g.155799380A>T, and g.155799135G>C.

[0032] 3. The g.155798586T>C, g.155799380A>T and g.155799135G>C loci have two genotypes, and the g.155798718C>T loci has three genotypes.

[0033] 4. At the T>C locus in g.155798586, the TT genotype frequency was 0.8169, the CT genotype frequency was 0.1831; the C gene frequency was 0.09155, and the T gene frequency was 0.9085. At the C>T locus in g.155798718, the CC genotype frequency was 0.4859, the TC genotype frequency was 0.507, the TT genotype frequency was 0.007042; the T gene frequency was 0.2606, and the C gene frequency was 0.7394.

[0034] At the g.155799380A>T locus, the AA genotype frequency is 0.7119, the TA genotype frequency is 0.2881, the T gene frequency is 0.1441, and the A gene frequency is 0.8559. At the g.155799135G>C locus, the CC genotype frequency is 0.661, the GC genotype frequency is 0.339, the G gene frequency is 0.1695, and the C gene frequency is 0.8305.

[0035] 5. g. 155798586T>C locus, heterozygosity 0.1663, effective allele count 1.200, polymorphism information content 0.1525, Hardy-Weinberg equilibrium P-value 8.011e-19. g. 155798718C>T locus, heterozygosity 0.3853, effective allele count 1.627, polymorphism information content 0.3111, Hardy-Weinberg equilibrium P-value 1.059e-01. g. 155799380A>T locus, heterozygosity 0.2466, effective allele count 1.327, polymorphism information content 0.2162, Hardy-Weinberg equilibrium P-value 1.394e-06. The g.155799135G>C site has a heterozygosity of 0.2815, an effective allele count of 1.392, a polymorphism information content of 0.2419, and a Hardy-Weinberg equilibrium P-value of 1.727e-04.

[0036] 6. The PLPP3 promoter regions g.155798586T>C and g.155798718C>T were significantly correlated with puberty (P<0.01).

[0037] 7. The promoter activity of the TT genotype at the 155798586T>C site was significantly higher than that of the CC genotype (P<0.01). The promoter activity of the CC genotype at the 155798718C>T site was significantly higher than that of the TT genotype.

[0038] 8. At the 155798586T>C site, the TT genotype significantly promoted the expression levels of PLPP3 mRNA and protein compared to the CC genotype (P<0.01). At the 155798718C>T site, the CC genotype significantly promoted the expression levels of PLPP3 mRNA and protein compared to the TT genotype (P<0.05).

[0039] 9. Compared with the OE-NC (control) group, the OE-PLPP3 (PLPP3 overexpression) group upregulated PLPP3 mRNA and protein expression levels. Compared with the KD-NC (control) group, the KD-PLPP3 (PLPP3 knockdown) group downregulated PLPP3 mRNA and protein expression levels.

[0040] 10. Based on volcano plot analysis, compared with the OE-NC group, the OE-PLPP3 group showed 214 differentially upregulated genes and 484 differentially downregulated genes. GO enrichment analysis of the differentially expressed genes revealed that they are mainly involved in biological processes such as cell migration, signal transduction, and iron ion homeostasis.

[0041] 11. Compared with the OE-NC group, the intracellular Fe content in the OE-PLPP3 group was increased, but the difference was not significant. Compared with the KD-NC2 group, the intracellular Fe content in the KD-PLPP3 group was significantly decreased (P<0.01).

[0042] 12. Compared with the OE-NC group, the concentration of MDA in the OE-PLPP3 group was significantly increased (P<0.05). Compared with the KD-NC group, the concentration of MDA in the KD-PLPP3 group was significantly decreased (P<0.05).

[0043] 13. Compared with the control group, overexpression of PLPP3 significantly downregulated the mRNA levels of GPX4, SLC7A11, FTH1, CS, and CBS (P<0.01), significantly downregulated the mRNA level of FSP1 (P<0.05), and significantly upregulated the mRNA levels of NOX1 and NOX2. It also downregulated the protein expression levels of FSP1, FTH1, and SLC7A11. Knockdown of PLPP3 significantly upregulated the mRNA level of CBS (P<0.05), significantly upregulated the mRNA levels of GPX4, SLC7A11, FTH1, CS, and FSP1 (P<0.01), and significantly downregulated the mRNA levels of NOX1 and NOX2 (P<0.01). It also upregulated the protein expression levels of FSP1, FTH1, and SLC7A11.

[0044] The present invention has the following advantages and effects compared with the prior art:

[0045] 1. The experimental samples collected in this invention were ear samples from Duroc and local black pig hybrids. The nucleotide sequence of the PLPP3 promoter region of each pig was cloned by PCR technology and Sanger sequencing was performed on individual samples, and a total of 4 SNPs were found.

[0046] 2. Furthermore, this invention performs correlation analysis between loci and puberty, identifies key loci affecting the initiation of puberty in sows, and provides molecular genetic markers for breeding by detecting the effects of different genotypes on PLPP3 expression levels.

[0047] 3. Furthermore, this invention utilizes RNA-seq to discover that PLPP3 mainly regulates biological processes such as cell migration, signal transduction, and iron ion homeostasis, and that PLPP3 can promote ferroptosis in granulosa cells of the sow ovary.

[0048] 4. In summary, this invention focuses on PLPP3 and employs molecular and cell biology methods to investigate its correlation with puberty. It was found that the promoter regions g.155798586T>C and g.155798718C>T were significantly correlated with puberty (P<0.01). Further research showed that the TT genotype at g.155798586 and the CC genotype at g.155798718 promoted PLPP3 expression, and it was confirmed that PLPP3 can promote ferroptosis in granulosa cells. Therefore, mutations in the PLPP3 promoter region affect PLPP3 expression, and PLPP3 delays the onset of puberty by promoting ferroptosis in porcine ovarian granulosa cells. This invention has significant application value for studying ovarian follicular development and the onset of puberty.

[0049] 5. The technical solution of this invention is well-designed and the results are reliable. Attached Figure Description

[0050] Figure 1 The image shows the electrophoresis results of the PCR amplification products of the PLPP3 promoter region; where M is the DNAMaker of DL10000.

[0051] Figure 2 Genotyping diagrams for the loci g.155798586T>C, g.155798718C>T, g.155799380A>T, and g.155799135G>C.

[0052] Figure 3 The diagram shows the promoter activity of different genotypes at SNP sites; the relative luciferase activities of the TT and CC genotypes at Ag155798586 site and the relative luciferase activities of the CC and TT genotypes at Bg155798718 site are shown; ** indicates P < 0.01.

[0053] Figure 4 The graph shows the effect of different genotypes at loci g.155798586 and g.155798718 on PLPP3 expression levels. Specifically, the graph shows the effect of TT and CC genotypes at locus Ag155798586 on PLPP3 mRNA levels; the effect of CC and TT genotypes at locus B155798718 on PLPP3 mRNA levels; the effect of TT and CC genotypes at locus C155798586 on PLPP3 protein levels; and the effect of CC and TT genotypes at locus D155798718 on PLPP3 protein levels. ns represents P>0.05, and ** represents P<0.01.

[0054] Figure 5 The graph shows the efficiency of PLPP3 overexpression or interference; where A.PLPP3 mRNA level overexpression efficiency is represented.

[0055] B. PLPP3 protein overexpression efficiency; C. PLPP3 mRNA knockdown efficiency; D. PLPP3 protein knockdown efficiency; * represents P<0.05, ** represents P<0.01.

[0056] Figure 6 Transcriptome diagram of PLPP3 affecting porcine ovarian granulosa cells; A. Statistical diagram of differentially expressed genes in the OE-NC group and OE-PLPP3 group; B. Volcano plot of differentially expressed genes; C. GO enrichment classification bar chart of differentially expressed genes.

[0057] Figure 7 The graph shows the effect of PLPP3 on the intracellular Fe content of porcine ovarian granulosa cells.

[0058] Figure 8 The figure shows the effect of PLPP3 on the level of MDA in porcine ovarian granulosa cells.

[0059] Figure 9 The figure shows the effect of PLPP3 on the expression levels of ferroptosis-related genes in porcine ovarian granulosa cells; where A. the effect of overexpression on the mRNA level of ferroptosis-related genes; B. the effect of overexpression on the protein level of ferroptosis-related genes; C. the effect of knockdown on the mRNA level of ferroptosis-related genes; and D. the effect of knockdown on the overexpression efficiency of ferroptosis-related gene protein levels. Detailed Implementation

[0060] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions. Unless otherwise stated, the reagents and raw materials used in the present invention are commercially available.

[0061] The test samples collected in the following examples were ear samples from Duroc and local black pigs (referred to as Duroc-Black pigs). The sampling location was at the Niujiaowan R&D Farm of Guangdong Yihao Food Co., Ltd., and all pigs were fed and managed according to the same standards.

[0062] Example 1: Extraction, concentration, and quality determination of DNA from pig ear samples

[0063] (1) Refer to the Tissue DNA Kit instruction manual for specific experimental steps of DNA extraction.

[0064] ① Cut 30 mg of pig ear sample into a 1.5 mL centrifuge tube, and then cut it into small pieces with scissors. Add 200 mL of TL Buffer and 25 μL of OB Protease Solution to each centrifuge tube, vortex to mix the sample and solution thoroughly, and then incubate in a 55 °C water bath for 12 h.

[0065] ② Centrifuge the centrifuge tube at 13000×g for 5 minutes. Transfer the supernatant to a new 1.5mL centrifuge tube. If there is any precipitate floating, centrifuge again and then transfer the supernatant to the centrifuge tube.

[0066] ③ Add 220 μL of BL Buffer, vortex thoroughly, and incubate in a 70°C water bath for 10 min. Add 220 μL of anhydrous ethanol and vortex thoroughly.

[0067] ④ Place the pillar ( Place the DNA Mini Column into a 2 mL collection tube. Transfer all the sample from the centrifuge tube to the column, centrifuge at 13000×g for 1 min, and discard the filtrate.

[0068] ⑤ Add 500 μL of HBC Buffer diluted with isopropanol to the column, centrifuge at 13000×g for 1 min, and discard the filtrate and collection tube.

[0069] ⑥ Place the column into a new 2mL collection tube, add 700μL of DNA Wash Buffer diluted with anhydrous ethanol, centrifuge at 13000×g for 1 min, and discard the filtrate. Repeat once to wash the DNA again.

[0070] ⑦ Centrifuge the empty column at 13000×g for 2 min and dry for 3 min. Transfer the column to a 1.5 mL centrifuge tube containing no nucleic acid. Add 100 μL of preheated 70℃ Elution Buffer to the column. Incubate at room temperature for 2 min, then centrifuge at 13000×g for 1 min to elute the DNA.

[0071] (2) DNA concentration and mass determination

[0072] The purity and integrity of the DNA were detected using a UV spectrophotometer, and the high-quality gDNA obtained was stored at -20℃ for later use.

[0073] Example 2: Cloning, identification, and testing of the PLPP3 promoter region

[0074] (1) The PLPP3 gene sequence (accession number: NC_010448.4, ID: 100512419) was searched using NCBI online data, and the 3000bp upstream and 500bp downstream of the 5'UTR end were screened out. Primers were designed using the Pick Primers module. The primer sequences are as follows: F: 5'-GGGCCCTGACCTTTTGACTA-3'; R: 5'-TCCAAATCCCTGCCAG TTCG-3'.

[0075] (2) Using extracted Dujani pig ear-like gDNA as a template, the PLPP3 promoter region was amplified using Taq polymerase. The reaction system and reaction procedure are shown in Table 1 and Table 2.

[0076] Table 1 PCR reaction system

[0077]

[0078] Table 2 PCR reaction procedures

[0079]

[0080]

[0081] (3) Weigh 0.6g of agarose and add it to a 40mL Erlenmeyer flask containing 1×TAE. Microwave for 1 minute. Observe that the agarose is completely dissolved, then place the Erlenmeyer flask in cold water. When it cools to room temperature, add 2μL of nucleic acid dye, gently shake, pour into the gel tank, and insert the comb. Let it stand at room temperature for 30 minutes until the liquid solidifies. Remove it and place it in an electrophoresis apparatus for sample loading. Select an appropriate DNA marker according to the size of the target fragment. Set the voltage to 150V and the timer to 20-25 minutes. After electrophoresis, observe the band positions using a fully automated chemiluminescence imaging analysis system. If the bands match the expected product size, send the amplified product to Sanger sequencing at Sangon Biotech (Shanghai) Co., Ltd.

[0082] Example 3: Sequencing Result Analysis

[0083] The sequencing results were assembled and SNP genotypes were analyzed using SnapGene 4.2.4 software. Excel was used to calculate the genotype frequency, heterozygosity, effective allele count, polymorphism information content, and whether the locus was in Hardy-Weinberg equilibrium for each site.

[0084] The genetic association between SNPs and puberty was analyzed using R language (v4.03) and a generalized linear model (GLM). The model is as follows:

[0085] Yij=L+Gj

[0086] Where Yij is the observed age of puberty in the i-th animal, L is the mean age of puberty, and Gj represents the genotype effect. Statistical data are expressed as mean ± standard deviation.

[0087] Example 4: Isolation of porcine ovarian granulosa cells

[0088] Ovaries from commercial sows collected from Kongwangji slaughterhouse were washed twice with phosphate-buffered saline (PBS) containing 1% penicillin-streptomycin and then immersed in PBS to maintain a low-temperature environment before being transported back to the laboratory. In the laboratory, the ovaries were placed in cleaned beakers and washed with PBS containing 1% penicillin-streptomycin until no blood remained. Then, 75% alcohol was added and soaked for 30 seconds, after which the alcohol was discarded. The ovaries were then washed several times with PBS containing 1% penicillin-streptomycin before being sealed and placed in the cell transfer window of the cell culture room.

[0089] Using a 1mL disposable sterile syringe, aspirate 1-2mL of follicular fluid from follicles approximately 3-5mm in diameter and transfer it to a 15mL centrifuge tube containing 4mL of complete culture medium. Centrifuge at 1000rpm for 5min at room temperature. Discard the supernatant, add 3mL of PBS containing 1% penicillin-streptomycin, gently pipette to resuspend the cells, centrifuge, discard the supernatant, and repeat once. Add 3mL of complete culture medium to resuspend the cells, then seed the cells into cell culture flasks, gently shake in a cross-hatching pattern to mix, and incubate statically at 37℃ with 5% CO2. After 48h, change the medium and observe cell adhesion and growth status, then continue culturing.

[0090] Example 5: Culture of porcine ovarian granulosa cells

[0091] When the confluence of porcine GCs reaches approximately 80%, discard the culture medium in the flask and wash twice with PBS containing 1% penicillin-streptomycin, then discard the PBS. Add 3 mL of trypsin to the flask, place it in a cell culture incubator for 5 minutes of digestion, and observe cell adhesion under a microscope. When most cells appear round and float with the liquid, digestion is complete. Add 4 mL of complete culture medium to stop digestion. After agitating the culture flask wall with a pipette tip, transfer the mixture in the flask to a 15 mL centrifuge tube and centrifuge at 1000 rpm for 5 minutes at room temperature. Discard the supernatant, wash twice with PBS containing 1% penicillin-streptomycin, then discard the supernatant. Add 3 mL of complete culture medium to resuspend the cells and seed them into cell culture plates. Gently shake in a cross pattern to mix, then incubate statically in a 37°C, 5% CO2 incubator. After 24 hours, observe cell adhesion and growth. When the confluence of GCs reaches 70-80%, discard the complete culture medium, wash twice with PBS, and add incomplete culture medium.

[0092] Preparation of solution A: Opti-MEM and Lipofectamine TM Mix thoroughly with 3000. Prepare solution B: Mix Opti-MEM, overexpression plasmid, and P3000, or Opti-MEM and small RNA fragment, and gently mix. Add solution A to solution B, gently pipette to mix, and incubate at room temperature in the dark for 15 min.

[0093] Add the AB solution mixture to the cell culture plate, gently shake in a cross shape to thoroughly mix the mixture with the culture medium, and then place the culture plate in a 5% CO2 incubator for 24 hours of transfection. Conduct subsequent experiments according to the experimental design.

[0094] Example 6: RNA sampling and quality control

[0095] (1) Total RNA from cells was extracted according to the instructions of the RNAfast200 Total RNA Extraction Kit. ① Discard the cell culture medium, wash the cells twice with PBS, and digest with trypsin at 37°C for 5 min. Terminate the digestion with complete culture medium. Transfer the cells to a centrifuge tube, centrifuge at 10,000 rpm for 5 min, collect the cells, wash twice with PBS, and centrifuge to collect the cell pellet. ② Add 100 μL of PBS to the cell pellet, resuspend the cells, and transfer them to a 1.5 mL centrifuge tube. ③ Add 500 μL of RA2, invert 5-10 times until the lysate is clear, and let stand for 1 min. ④ Transfer all the lysate to a column fitted with a collection tube, and centrifuge at 12,000 rpm for 1 min. ⑤ Discard the liquid in the collection tube, add 500 μL of washing buffer diluted with anhydrous ethanol to the column, centrifuge for 1 min, discard the filtrate, and repeat this step once. ⑥ Centrifuge for 1 min without adding washing buffer. ⑦ Transfer the column to a new 1.5 mL centrifuge tube, add 30 μL of elution buffer to the center of the membrane. ⑧ Let stand at room temperature for 1 min, then centrifuge for 1 min to obtain total RNA.

[0096] (2) The purity and integrity of total RNA were detected by ultraviolet spectrophotometer, and the obtained high-quality RNA was stored in a -80℃ refrigerator for later use.

[0097] Example 7: RNA reverse transcription

[0098] Reaction system: 2 μL of 5×PrimeScript RT premix, total RNA ≤500 ng, adjust the system to 10 μL with RNase-free H2O.

[0099] Reaction procedure: 37℃ for 15 min, 85℃ for 5 s.

[0100] The cDNA obtained by reverse transcription was stored in a -20°C freezer.

[0101] Example 8: qPCR detection of gene mRNA expression levels

[0102] The target gene's CDS region sequence was located in the NCBI database, and quantitative primers were designed using the Primer Blast module within the NCBI database. Table 6 lists all the primers used for qPCR.

[0103] use The relative mRNA levels of the gene were quantified using qPCR SYBR Green Master Mix (2×) and the CFX96Touch Real-Time PCR system. GAPDH was selected as an endogenous control, and the 2-ΔΔct method was used for analysis. The total reaction volume for each sample was 20 μL, including 10 μL of SYBR Green Master Mix, 0.3 μL of forward primer, 0.3 μL of reverse primer, 1 μL of diluted cDNA template, and 7.8 μL of RNA-free water. The cycling conditions were as follows: 95℃ pre-denaturation for 10 min, 1 cycle; 95℃ denaturation for 15 s, 40 cycles; 60℃ annealing / extension for 1 min, 40 cycles.

[0104] Table 3 List of qPCR primers

[0105]

[0106]

[0107] Note: All of the above primer species are pigs.

[0108] Example 9: Protein extraction, concentration determination and denaturation

[0109] (1) Protein extraction: 24 h after cell transfection, discard the culture medium in the six-well plate and wash twice with 1×PBS. Add 100 μL of RIPA lysis buffer containing 1% protease inhibitor to each well, incubate on ice for 15 min, repeatedly pipette the cells in the well to ensure complete lysis, then transfer to a 2 mL centrifuge tube, centrifuge at 12000 rpm and 4℃ for 10 min, and collect the supernatant. (2) Protein concentration determination: Follow the instructions of the BCA protein assay kit, plot a standard curve based on the results, and calculate the corresponding protein sample concentration. (3) Protein denaturation: Add 5× protein loading buffer (containing DTT) and ddH2O to quantify the protein concentration to 1000 ng / μL, denature at 99℃ for 10 min, and store at -20℃ for later use.

[0110] Example 10: Western Blot

[0111] (1) Load 12 μL of protein sample onto a 10% protein prepreg gel and electrophoresis at 130V for 50 min. (2) Accurately and quickly cut the gel strip containing the target protein according to the protein marker and transfer it to a polyvinylidene fluoride (PVDF) membrane, ensuring that there are no air bubbles between the gel strip and the PVDF membrane. (3) Use eBlot. TMThe L1 membrane converter transfers the protein from the strip to the PVDF membrane. After the transfer, wash the PVDF membrane three times with TBST, 5-10 min each time. (4) Place the PVDF membrane in 5% skim milk powder and block it at room temperature with low speed for 2 hours. (5) Discard the milk powder and wash the membrane three times with TBST, 5-10 min each time. (6) Incubate the membrane in primary antibody dilution solution at 4°C overnight. (7) Wash the membrane three times with TBST, 5-10 min each time. (8) Place the PVDF membrane in secondary antibody dilution solution and incubate it on a shaker at room temperature for 1.5-2 hours. (9) Wash the membrane three times with TBST, 5-10 min each time. (10) Add ECL developing solution and develop the membrane using a fully automated chemiluminescence imaging analysis system.

[0112] Example 11: Determination of total iron content

[0113] The total iron content in the cells was extracted according to the instructions of the total iron colorimetric assay kit.

[0114] (1) Sample preparation: ① Discard the cell culture medium, wash the cells twice with PBS, and collect the cells in 1.5 mL centrifuge tubes using trypsin digestion. ② Add 200 μL of reagent I to each tube, mix well by pipetting, and place on ice for lysis for 10 min. ③ Centrifuge at 15000×g for 10 min at room temperature, transfer the supernatant to a new 1.5 mL centrifuge tube, and store at 4℃ for later use.

[0115] (2) Operating steps: ① Prepare iron standards of different concentrations according to the instructions (prepare fresh before use). ② Add 80 μL of the different concentrations of standard to the corresponding wells of the ELISA plate as standard wells, and add 80 μL of the sample to be tested as assay wells. ③ Add 80 μL of reagent II to the standard wells and assay wells. ④ Gently shake the ELISA plate to mix the solutions thoroughly, and incubate at 37℃ for 40 min in an incubator. ⑤ Measure the OD value of each well at 593 nm using an ELISA reader.

[0116] (3) Calculation results

[0117] Fitting curve for standard sample: y = ax + b

[0118] Cell samples:

[0119] Note: y: OD value of standard - OD value of blank (OD value when the concentration of standard is 0); x: concentration of standard; a: slope of standard curve; b: intercept of standard curve; ΔA: absolute OD value of sample (OD value of assay well - OD value of blank well); N: number of cell samples used for lysis / 10⁶; V: amount of reagent added during cell sample processing (mL); f: dilution factor of sample before being added to the detection system.

[0120] Example 12: Determination of Malondialdehyde (MDA) Content

[0121] Malondialdehyde (MDA) content in cells was extracted according to the instructions of the MDA colorimetric assay kit.

[0122] (1) Sample preparation: Discard the cell culture medium, wash the cells twice with PBS, scrape the cells off with a cell scraper, transfer the cells to a centrifuge tube with a pipette, add 500 μL of reagent five extraction solution, place on a vertical mixer and shake for 2 min to make the extraction solution and cells fully mixed, then use an ultrasonic disruptor to disrupt the cells and prepare a suspension, and store in a 4℃ refrigerator for later use.

[0123] (2) Operating steps: ① Prepare several 1.5 mL centrifuge tubes and divide them into 3 groups, including the following: blank tubes: add 100 μL of anhydrous ethanol; standard tubes: add 100 μL of 10 nmol / mL standard; sample tubes: add 100 μL of the sample to be tested. ② Add 1 mL of working solution to each tube. ③ Invert the centrifuge tubes to mix the solution thoroughly, cover the caps of the centrifuge tubes with plastic wrap, make a small hole in the plastic wrap, and place them in a water bath at 100℃ for 40 min. ④ Cool them to room temperature with running water and centrifuge at 1078×g for 10 min. ⑤ Carefully aspirate 250 μL of the supernatant into a 96-well microplate. ⑥ Measure the OD value of each well at 532 nm using a microplate reader.

[0124] (3) Calculation results

[0125] Formula for calculating malondialdehyde (MDA) content in cells:

[0126] Note: ΔA1: OD value of test tube - OD value of blank tube; ΔA2: OD value of standard tube - OD value of blank tube; C: concentration of standard (10 nmol / mL); f: dilution factor of sample before addition to the detection system; Cpr: protein concentration of the sample to be tested (mgprot / mL).

[0127] Example 13: Transfection of recombinant plasmids and detection of dual fluorescence activity

[0128] (1) Transfection

[0129] ① Primary cells are unstable during dual luciferase assays, which may lead to false positives, while the human ovarian granulosa cell line (KGN) is stable (KGN cell line was obtained from the cell bank of the Guangdong Provincial Key Laboratory of Agricultural Animal Genomics and Molecular Breeding, and the culture method is the same as that for porcine ovarian granulosa cells). KGN cells were seeded into 6-well plates. When the cell confluence reached 70-80%, the complete culture medium was discarded, the cells were washed twice with PBS, and then incomplete culture medium was added.

[0130] ② Prepare the transfection mixture. Prepare solution A: Opti-MEM and Lipofectamine TM Mix thoroughly with P3000. Prepare solution B: Gently mix Opti-MEM, recombinant pGL-3 plasmid, pGL-TK plasmid, and P3000. Add solution A to solution B, gently mix by pipetting, incubate at room temperature in the dark for 15 min, and then transfer to a cell culture plate. Note that the mass ratio of recombinant pGL-3 plasmid to pGL-TK plasmid is 39:1.

[0131] The pRL-TK plasmid was a commercially available plasmid, obtained from the Guangdong Provincial Key Laboratory of Agricultural Animal Genomics and Molecular Breeding; the recombinant pGL-3 plasmid included four plasmids corresponding to different genotypes, all synthesized by Wuhan Jinkairui Biotechnology Co., Ltd., using the pGL3-basic basic plasmid, with KpnI and XhoI cloning sites, and the target sequences are as follows:

[0132] g.155798586T Target sequence: GGTACCTTTTAAATCAAGTTTGTTCCATTGCATTTTACTTGC TAGTTAGACTGTTCAATTTTAGGATTTAAAGCAAAGAGGCCTTCAGATGTATGCATCCTGGGAGGCTGTTTTATTTCCTTTTGTCTAAAGAATGATAGTGACACTGTATTATGACTTGTTCAAGTCAATTTTAATGAATATCTGTAGTGTTCTGTTCCCTTGCTCGAG

[0133] g.155798586C Target sequence: GGTACCTTTTAAATCAAGTTTGTTCCATTGCATTTTACTTGC TAGTTAGACTGTTCAATTTTAGGATTTAAAGCAAAGAGGCCTTCAGATGTATGCATCCTGGGAGGCTGTTTCATTTCCTTGTCTAAAGAATGATAGTGACACTGTATTATGACTTGTTCAAGTCAATTTTAATGAATATCTGTAGTGTTCTGTTCCCTTGCTCGAG

[0134] g.155798718C Target sequence: GGTACCACTGTATTATGACTTGTTCAAGTCAATTTTAATGAA TATCTGTAGTGTTCTGTTCCCTTGAAGAGTTATCCAAATGTAATAGTTGTTTGCATCCAACTACACGCATCAATTAACACCGTGATCTTTTTGTTATGAGAAAAATAGTCCACGGAGCCTTGTAAATGGGAATATAAAGCTCTTATTTAAACATCCATTTATCTCGAG

[0135] g.155798718T target sequence: GGTACCACTGTATTATGACTTGTTCAAGTCAATTTTAATGAA TATCTGTAGTGTTCTGTTCCCTTGAAGAGTTATCCAAATGTAATAGTTGTTTGCATCCAAC TACATGCATCAATTAACACCGTGATCTTTTTGTTATGAGAAAAATAGTCCACGGAGCCTT GTAAATGGGAATATAAAGCTCTTATTTAAACATCCATTTATCTCGAG.

[0136] (2) Dual fluorescence activity detection

[0137] The promoter region activity was detected according to the instructions of the Dual Luciferase Reporter Gene Detection Kit. ① Discard the culture medium, add cell culture lysis buffer, and gently rotate the culture plate to completely cover the cells with the lysis buffer. ② Incubate on ice for 5 min to fully lyse the cells. ③ Centrifuge at 10000-16000 rpm for 1 min and collect the supernatant. ④ Take 20 μL of lysis buffer and add it to a 96-well culture plate, with 3 replicates per group. Add 100 μL of firefly luciferase reaction solution and detect the luminescence value of firefly luciferase; add 100 μL of Renilla luciferase reaction solution and detect the activity of Renilla luciferase. ⑤ Calculate: Relative activity = luminescence value of firefly luciferase / luminescence value of Renilla luciferase.

[0138] Example 14: RNA-Seq

[0139] (1) Sample processing: There were 4 treatment groups, with 3 replicates in each group. pcDNA3.1, pcDNA3.1-PLPP3, siRNA-NC, and siRNA-PLPP3 were transfected into GCs and treated for 24 h. Cells were digested and collected, washed twice with PBS, and Trizol was added. Cells were named according to the treatment and RNA-Seq was performed by BGI Genomics. The basic plasmid used to construct pcDNA 3.1-PLPP3 was pcDNA3.1, with cloning sites of KpnI and Xbal. The transcript was the PLPP3 mRNA sequence with NCBI accession number XM005665388.3. The primer sequences used were: F: 5′-ATGCTGATGGTCCTCCTT GTATC-3′, R: 5′-CTACACCATGTTGTGGTGATTGTT-3′.

[0140] The sequence of siRNA-PLPP3 is: 5′-CTGATGGTCCTCCTTGTAT-3′.

[0141] (2) Data Analysis: After correcting for sequencing depth and gene or transcript length, the FPKM values ​​of the genes were obtained, followed by subsequent analysis. Using the FPKM values ​​of each gene, significantly differentially expressed genes between the comparison groups were detected, and volcano plot analysis was performed. Differentially expressed genes were mapped to various terms in the GO database, and the number of differentially expressed genes in each term was calculated, thus obtaining a list of differentially expressed genes with specific GO functions and their statistical counts. The hypergeometric test was then used to compare with background genes to identify GO entries that were significantly enriched in the differentially expressed genes.

[0142] Results analysis:

[0143] 1. Cloning the PLPP3 boot sector

[0144] Primers for the PLPP3 promoter were used, and extracted Duchenne hog DNA was used as a template to amplify the PLPP3 promoter region by PCR. The PCR products were then subjected to agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, a specific band of the expected size was obtained, followed by extensive PCR amplification. Figure 1 The PCR products were sent to Sanger sequencing at Sangon Biotech.

[0145] 2. SNP mutations in the PLPP3 promoter region

[0146] The sequencing peak diagram was viewed using Snapgene 4.2.4 software and compared with the PLPP3 gene sequence of pigs in NCBI to screen SNP sites and perform genotyping. A total of 4 SNP sites were found in the PLPP3 promoter region: g.155798586T>C, g.155798718C>T, g.155799380A>T, and g.155799135G>C. Three of these sites showed two genotypes, and one site showed three genotypes. Figure 2 ).

[0147] 3. Genotype and allele frequencies of SNPs in the PLPP3 promoter region

[0148] Based on the peak plot, the genotype results were statistically analyzed, and the genotype frequencies and allele frequencies of SNPs were calculated. Table 4 shows that the dominant genotypes are: TT at the g.155798586T>C site, TC at the g.155798718C>T site, AA at the g.155799380A>T site, and CC at the g.155799135G>C site.

[0149] 4. Population genetic structure analysis of SNP sites in the promoter region of the PLPP3 gene

[0150] The results are shown in Table 5. Only the g.155798718C>T site was in Hardy-Weinberg equilibrium (P>0.05).

[0151] 5. Correlation between different genotypes of SNP sites in the PLPP3 gene promoter region and puberty.

[0152] As shown in Table 6, the PLPP3 promoter regions g.155798586T>C and g.155798718C>T were significantly correlated with puberty (P<0.01).

[0153] 6. Effects of different genotypes at SNP sites in the PLPP3 gene promoter region on promoter activity and gene expression levels.

[0154] The pGL-3 recombinant plasmid was constructed and co-transfected with the pGL-TK plasmid at a mass ratio of 39:1 into porcine ovarian granulosa cells. The dual fluorescence activity was detected using a dual-luciferase reporter gene assay kit. It was found that the fluorescence activity of the TT genotype at the g.155798586T>C site was higher than that of the CC genotype (P<0.01), indicating stronger promoter activity and promoting the expression of PLPP3 mRNA and protein. Similarly, the fluorescence activity of the CC genotype at the g.155798718C>T site was higher than that of the TT genotype, indicating stronger promoter activity and promoting the expression of PLPP3 mRNA and protein (P<0.05). Figure 4 ).

[0155] 7. Detection of PLPP3 overexpression or knockdown efficiency

[0156] The empty vector pcDNA3.1 (hereinafter referred to as OE-NC) at a concentration of 1 ng / μL, the overexpression plasmid pcDNA3.1-PLPP3 (hereinafter referred to as OE-PLPP3), and 50 nM siRNA-NC (hereinafter referred to as KD-NC) and siRNA-PLPP3 (hereinafter referred to as KD-PLPP3) were transfected into porcine GCs. It was found that the upregulation and downregulation of PLPP3 mRNA and protein expression levels were successfully achieved. Figure 5 ).

[0157] 8. PLPP3 affects the transcriptome of porcine ovarian granulosa cells.

[0158] To investigate the biological role of the PLPP3 gene in porcine ovarian granulosa cells, transcriptome sequencing was performed after transfection. The study revealed that differentially expressed genes are mainly involved in biological processes such as cell migration, signal transduction, and iron homeostasis.

[0159] 9. PLPP3 promotes ferroptosis in porcine ovarian granulosa cells.

[0160] Overexpression of PLPP3 promotes the accumulation of intracellular Fe content. Figure 7 ), increase the concentration of MDA ( Figure 8 The expression levels of GPX4, SLC7A11, FTH1, CS, and CBS were significantly downregulated (P<0.01), the mRNA level of FSP1 was significantly downregulated (P<0.05), the mRNA levels of NOX1 and NOX2 were significantly upregulated, and the protein expression levels of FSP1, FTH1, and SLC7A11 were downregulated. Figure 9 ).

[0161] Knocking down PLPP3 inhibited the accumulation of intracellular Fe. Figure 7 ), reduce the concentration of MDA ( Figure 8 It significantly upregulated the mRNA level of CBS (P<0.05), and extremely significantly upregulated the mRNA levels of GPX4, SLC7A11, FTH1, CS, and FSP1 (P<0.01), while extremely significantly downregulating the mRNA levels of NOX1 and NOX2 (P<0.01). Simultaneously, it upregulated the protein expression levels of FSP1, FTH1, and SLC7A11. Figure 9 ).

[0162] Table 4. Genotype and allele frequencies of SNPs in the PLPP3 gene promoter region

[0163]

[0164] Table 5. Population genetic structure analysis of SNP sites in the promoter region of the PLPP3 gene.

[0165] site heterozygosity Effective number of alleles Polymorphic information content Hardy-Weinberg equilibrium (P-value) g.155798586T>C 0.1663 1.200 0.1525 8.011e-19 g.155798718C>T 0.3853 1.627 0.3111 1.059e-01 g.155799380A>T 0.2466 1.327 0.2162 1.394e-06 g.155799135G>C 0.2815 1.392 0.2419 1.727e-04

[0166] Table 6. Correlation between different genotypes of SNP sites in the PLPP3 gene promoter region and puberty.

[0167]

[0168] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a SNP molecular marker related to the age of puberty in pigs, characterized in that: The SNP molecular marker mentioned is selected from one of the following SNP molecular markers: (1) The SNP site corresponding to the T>C mutation at the g.155798586 site on chromosome 6 of the pig reference genome Sscrofa11.1; (2) The SNP site corresponding to the C>T mutation at the g.155798718 site on chromosome 6 of the pig reference genome Sscrofa11.1; The application is selected from at least one of the following applications: A. Application in assessing the age of puberty in pigs: Detecting the genotype at locus g.155798586, individuals with genotype CT have a shorter age of puberty than individuals with TT; or, detecting the genotype at locus g.155798718, individuals with genotype TT have a shorter age of puberty than individuals with TC, and both are shorter than individuals with CC. B. Application in determining the onset of estrus in pigs: Detecting the genotype at locus g.155798586, pigs with the genotype CT showed onset of estrus faster than those with the TT genotype; or, detecting the genotype at locus g.155798718, pigs with the genotype TT showed onset of estrus faster than those with the TC genotype, and both were faster than those with the CC genotype. The pigs mentioned are a two-way cross between Duroc and country black pigs.

2. An application of a primer, characterized in that: The primers include: F: 5'-GGGCCCTGACCTTTTGACTA-3' R: 5'-TCCAAATCCCTGCCAGTTCG-3'; The primers are used to identify SNP molecular markers associated with the age of puberty in pigs; the SNP molecular markers are selected from one of the following SNP molecular markers: (1) The SNP site corresponding to the T>C mutation at the g.155798586 site on chromosome 6 of the pig reference genome Sscrofa11.1; (2) The SNP site corresponding to the C>T mutation at the g.155798718 site on chromosome 6 of the pig reference genome Sscrofa11.1; The application is selected from at least one of the following applications: A. Application in assessing the age of puberty in pigs: Detecting the genotype at locus g.155798586, individuals with genotype CT have a shorter age of puberty than individuals with TT; or, detecting the genotype at locus g.155798718, individuals with genotype TT have a shorter age of puberty than individuals with TC, and both are shorter than individuals with CC. B. Application in determining the onset of estrus in pigs: Detecting the genotype at locus g.155798586, pigs with the genotype CT showed onset of estrus faster than those with the TT genotype; or, detecting the genotype at locus g.155798718, pigs with the genotype TT showed onset of estrus faster than those with the TC genotype, and both were faster than those with the CC genotype. The pigs mentioned are a two-way cross between Duroc and country black pigs.