A molecular marker related to maize kernel size and weight and its application

Abstract

The present invention discloses a molecular marker related to corn kernel size and weight and an application thereof. The molecular marker exists in the promoter of the ZmKW10 gene of corn exhibiting traits of relatively large kernels and relatively heavy kernels. The present invention develops a molecular marker with a large insertion / deletion fragment based on the promoter variation of the ZmKW10 gene that negatively regulates corn kernel size and kernel weight. When the molecular marker is inserted into the promoter of the ZmKW10 gene, the promoter activity is low, and the corn plant exhibits traits of relatively large kernels and relatively heavy kernel weight. This provides an effective molecular-assisted selection method for the identification or screening of corn kernel traits (kernel size and seed weight), can be applied to the genetic improvement of corn kernel traits and breeding, can effectively shorten the breeding period, accelerate the breeding process, improve breeding efficiency, accelerate the process of screening excellent germplasm resources, and provide a new direction for reducing breeding costs. By pollinating and preserving seeds of individual corn plants containing the molecular marker, it can be used for corn seed production, and has broad prospects.

Claims

1. A primer set for amplifying molecular markers related to corn kernel size and weight, characterized in that: The application is any one of the following 1) and 2): 1) Application in identification or screening of corn kernel size and kernel weight traits; 2) Application in corn breeding or assisted breeding; The nucleotide sequence of the molecular marker related to corn kernel size and kernel weight is represented by the nucleotide sequence shown in SEQ ID NO.1 and the nucleotide sequence shown in SEQ ID NO.20; The molecular marker regulation related to corn kernel size and kernel weight ZmKW10 Gene promoter activity; Under the same genetic background, the molecular markers related to corn kernel size and kernel weight are present in corn with large kernels and heavy kernels. ZmKW10 The gene promoter is not present in the trait showing small grains and small grain weight. ZmKW10 in the promoter of a gene; The primer set includes a first primer pair, a second primer pair and a third primer pair; The nucleotide sequences of the first primer pair are shown in SEQ ID NO.2 and SEQ ID NO.3 respectively: I1F: GAGTGTGGAGGACTGTGGAGAAC SEQ ID NO.2; I1R: CGACATCACGCCAGCAAGGT SEQ ID NO.3; The nucleotide sequences of the second primer pair are shown in SEQ ID NO.4 and SEQ ID NO.5 respectively: I2F: TGAGAAATAGGCGTCTTGAGGGTA SEQ ID NO.4; I2R: GCAGAACGAGGAATGAGAATGACA SEQ ID NO.5; The nucleotide sequences of the third primer pair are shown in SEQ ID NO.6 and SEQ ID NO.7 respectively: I3F: ACTGTGGAGAACGGAGAATCG SEQ ID NO.6; I3R: GAACCAACTCAAATAGGTGAAGGA SEQ ID NO.

7.

2. Application of a kit for detecting molecular markers associated with corn kernel size and kernel weight, characterized in that: The application is any one of the following 1) and 2): 1) Application in identification or screening of corn kernel size and kernel weight traits; 2) Application in corn breeding or assisted breeding; The kit comprises the primer set according to claim 1; The nucleotide sequence of the molecular marker related to corn kernel size and kernel weight is represented by the nucleotide sequence shown in SEQ ID NO.1 and the nucleotide sequence shown in SEQ ID NO.20; The molecular marker regulation related to corn kernel size and kernel weight ZmKW10 Gene promoter activity; Under the same genetic background, the molecular markers related to corn kernel size and kernel weight are present in corn with large kernels and heavy kernels. ZmKW10 The gene promoter is not present in the trait showing small grains and small grain weight. ZmKW10 in the promoter of the gene.

3. A method for identifying or screening corn kernel size and kernel weight traits, characterized in that: It includes the following steps: Extracting the genomic DNA of the corn to be tested, and performing PCR amplification using the primer set according to claim 1; The PCR amplification products are sequenced. When the sequencing results show that the tested corn plant contains molecular markers related to corn kernel size and kernel weight, the traits of the tested corn are larger kernels and heavier kernel weight. When the tested corn plant lacks molecular markers related to corn kernel size and kernel weight, the traits of the tested corn are smaller kernels and smaller kernel weight. The nucleotide sequence of the molecular marker related to corn kernel size and kernel weight is shown by combining the nucleotide sequence shown in SEQ ID NO.1 and the nucleotide sequence shown in SEQ ID NO.

20.

4. A corn breeding method for improving grain size and grain weight traits, characterized in that: The method uses DNA from a single corn plant leaf as a template and performs PCR amplification using the primer set of claim 1 to obtain an amplified product; the amplified product is sequenced and identified; if the identification result contains a molecular marker related to corn kernel size and kernel weight, the corn plant is self-pollinated to obtain an inbred line with stable genetic inheritance of the target gene; The nucleotide sequence of the molecular marker related to corn kernel size and kernel weight is shown by combining the nucleotide sequence shown in SEQ ID NO.1 and the nucleotide sequence shown in SEQ ID NO.20.

Images