Use of siRNA targeting rabies virus G gene and / or L gene in the preparation of a drug for inhibiting rabies

Abstract

The present invention discloses the application of siRNAs targeting and inhibiting the G gene and / or L gene of rabies virus in the preparation of drugs for inhibiting rabies. Based on this, siRNA-G targeting and inhibiting the G gene of rabies virus and siRNA-L targeting and inhibiting the L gene of rabies virus are provided. The nucleotide sequence of the sense strand of siRNA-G is as shown in SEQ ID NO: 1, and the nucleotide sequence of the antisense strand of siRNA-G is as shown in SEQ ID NO: 2; the nucleotide sequence of the sense strand of siRNA-L is as shown in SEQ ID NO: 3, and the nucleotide sequence of the antisense strand of siRNA-L is as shown in SEQ ID NO: 4. The siRNA-G and / or siRNA-L can effectively inhibit the expression of the G gene and L gene of rabies virus, reduce the proliferation of rabies virus, and can be used as effective small nucleic acid drugs in the process of developing anti-rabies virus drugs.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and specifically, to the use of siRNAs that target and inhibit the G gene and / or L gene of rabies virus in the preparation of drugs for inhibiting rabies. Background Art

[0002] Rabies is a zoonotic infectious disease caused by the rabies virus (Rabiesvirus, RABV) infecting humans. Rabies can cause fatal meningitis in mammals, presenting severe neurological symptoms such as spasms and paralysis, and ultimately leading to death. Currently, there is a lack of effective treatment for rabies. Once clinical symptoms appear, the fatality rate is close to 100%.

[0003] RNA interference (RNAi) is a relatively conserved gene regulation method in the process of biological evolution. It uses small fragments to silence the expression of specific mRNAs. During RNA interference, long double-stranded RNA precursors are first cleaved into short interfering RNAs. Subsequently, the RNA-induced silencing complex binds to the siRNA and degrades one of the RNA strands, and the other strand guides the RISC complex to specifically degrade the targeted mRNA sequence.

[0004] The high mutation rate of viruses makes it possible for them to evade the host immune system and the therapeutic effects of antiviral drugs and vaccines. Therefore, it is particularly important to develop new and alternative antiviral therapies. In recent years, researchers have widely applied cellular RNA interference technology to target various viral genes. After siRNAs designed for different viral genes infect cells, they can significantly inhibit the replication ability of the virus, thereby playing a therapeutic role.

[0005] Currently, the design of siRNAs against rabies virus mainly focuses on targeting the N gene and P gene. The research on the targeted genes of rabies virus is particularly important, as it can provide more targets for the prevention and treatment of rabies, thereby achieving the prevention and treatment of rabies virus. Summary of the Invention

[0006] The purpose of the present invention is to overcome the above-mentioned deficiencies of the prior art and provide the use of siRNAs that target and inhibit the G gene and / or L gene of rabies virus in the preparation of drugs for inhibiting rabies.

[0007] The first purpose of the present invention is to provide the use of siRNAs that target and inhibit the G gene and / or L gene of rabies virus in the preparation of drugs for inhibiting rabies.

[0008] The second purpose of the present invention is to provide an siRNA-G that targets and inhibits the G gene of rabies virus.

[0009] The third object of the present invention is to provide an siRNA-L that targets and inhibits the L gene of rabies virus.

[0010] The fourth object of the present invention is to provide the use of the above siRNA-G and / or the above siRNA-L in the preparation of a drug for inhibiting rabies.

[0011] The fifth object of the present invention is to provide a pharmaceutical composition for inhibiting rabies.

[0012] In order to achieve the above objects, the present invention is realized by the following solutions:

[0013] The present invention claims the use of siRNAs that target and inhibit the G gene and / or L gene of rabies virus in the preparation of a drug for inhibiting rabies.

[0014] Preferably, the inhibition of rabies is the inhibition of the expression of the G gene and / or L gene of rabies virus.

[0015] Preferably, the rabies is the CVS-11 strain of rabies virus.

[0016] The present invention also claims an siRNA-G that targets the G gene of rabies virus. The nucleotide sequence of the sense strand of the siRNA-G is as shown in SEQ ID NO: 1, and the nucleotide sequence of the antisense strand of the siRNA-G is as shown in SEQ ID NO: 2.

[0017] The present invention also claims an siRNA-L that targets and inhibits the L gene of rabies virus. The nucleotide sequence of the sense strand of the siRNA-L is as shown in SEQ ID NO: 3, and the nucleotide sequence of the antisense strand of the siRNA-L is as shown in SEQ ID NO: 4.

[0018] The present invention also claims the use of the above siRNA-G and / or the above siRNA-L in the preparation of a drug for inhibiting rabies.

[0019] Preferably, the rabies virus is the CVS-11 strain of rabies.

[0020] Preferably, the inhibition of rabies is the inhibition of the expression of the G gene and / or L gene of rabies.

[0021] The present invention also claims a pharmaceutical composition for inhibiting rabies, which contains the above siRNA-G, the above siRNA-L, and / or any one of the above delivery systems.

[0022] Preferably, the pharmaceutical composition further includes pharmaceutically acceptable excipients.

[0023] More preferably, the administration mode of the pharmaceutical composition is intracranial administration, intramuscular injection and / or intravenous injection.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention provides an application of siRNA targeting and inhibiting rabies virus G gene and / or L gene in the preparation of a drug for inhibiting rabies. Based on this, siRNA-G targeting and inhibiting rabies virus G gene and siRNA-L targeting and inhibiting rabies virus L gene are provided. The nucleotide sequence of the sense strand of siRNA-G is as shown in SEQ ID NO: 1, and the nucleotide sequence of the antisense strand of siRNA-G is as shown in SEQ ID NO: 2; the nucleotide sequence of the sense strand of siRNA-L is as shown in SEQ ID NO: 3, and the nucleotide sequence of the antisense strand of siRNA-L is as shown in SEQ ID NO: 4. The siRNA-G and / or siRNA-L can effectively inhibit the expression of rabies virus G gene and L gene, reduce the proliferation of rabies virus, and can be used as an effective small nucleic acid drug in the development process of anti-rabies virus drugs. Description of the Drawings

[0026] Figure 1 It is a fluorescence microscope observation result diagram of each cell plate in the direct immunofluorescence detection process in Example 2;

[0027] Figure 2 It is a fluorescence quantitative PCR detection result diagram in Example 2; A is the mRNA level diagram of L gene in si-L2157-NA fluorescence amplification product, si-L5055-NA fluorescence amplification product, si-L5773-NA fluorescence amplification product and siNC-NA fluorescence amplification product; B is the mRNA level diagram of L gene in si-L2157-BHK fluorescence amplification product, si-L5055-BHK fluorescence amplification product, si-L5773-BHK fluorescence amplification product and siNC-BHK fluorescence amplification product; C is the mRNA level diagram of G gene in si-G997-NA fluorescence amplification product, si-G193-NA fluorescence amplification product, si-G672-NA fluorescence amplification product and siNC-NA fluorescence amplification product; D is the mRNA level diagram of G gene in si-G997-BHK fluorescence amplification product, si-G193-BHK fluorescence amplification product, si-G672-BHK fluorescence amplification product and siNC-BHK fluorescence amplification product;

[0028] Figure 3 It is for TCID in Example 2 50 Detection result diagram; A is the TCID in NA cells infected with si-G997-NA virus solution 50, TCID in NA cells infected with si-G193-NA virus solution 50 , TCID in NA cells infected with si-G672-NA virus solution 50 and TCID in NA cells infected with siNC-NA virus solution 50 The result graph, B is the TCID in NA cells infected with si-L5055-NA virus solution 50 , TCID in NA cells infected with si-L2157-NA virus solution 50 , TCID in NA cells infected with si-L5773-NA virus solution 50 and TCID in NA cells infected with siNC-NA virus solution 50 The result graph;

[0029] Figure 4 The identification result graph of the expression plasmid in Example 3;

[0030] Figure 5 The identification result graph of the packaging plasmid in Example 3;

[0031] Figure 6 The fluorescence curve graph of pAAV-EGFP with different copy numbers in Example 3;

[0032] Figure 7 The standard curve graph in Example 3;

[0033] Figure 8 The virus titer detection result graph of the cell supernatant at different times after inoculating with the CVS-11 strain and the transcription level detection result graph of each recombinant adeno-associated virus infection group in Example 4; A is the G gene transcription level result of the rAAV-G997 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group; B is the L gene transcription level result of the rAAV-L5055 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group; C is the virus titer detection result graph of the cell supernatant at different times after inoculating with the CVS-11 strain in the rAAV-G997 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group; D is the virus titer detection result graph of the cell supernatant at different times after inoculating with the CVS-11 strain in the rAAV-L5055 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group

[0034] Figure 9 The graph of the body weight change rate of each group of mice 21 days after virus challenge in Example 5;

[0035] Figure 10 The graph of the survival rate change of each group of mice 21 days after virus challenge in Example 5. Detailed implementation manners

[0036] The present invention will be further elaborated in detail below in conjunction with the accompanying drawings of the specification and specific embodiments. The embodiments are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following embodiments are all conventional methods unless otherwise specified; the materials, reagents, etc. used are all reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0037] Example 1 Design and synthesis of siRNA

[0038] I. Experimental method

[0039] Based on the CDS region of the G gene of the rabies CVS-11 strain (accession number: GQ918139.1), sequences starting with "AA", with the percentage content of CG bases being 30% - 55%, the number of consecutive single-base repeats < 4, and a length of 21 bases were screened. The 19 bases after AA were used as the target sequence, and siRNAs targeting the G gene of the rabies CVS-11 strain were designed using an online software (https: / / sidirect2.rnai.jp / ), including si-G997, si-G193, and si-G672.

[0040] Based on the CDS region of the L gene of the rabies CVS-11 strain (accession number: GQ918139.1), sequences starting with "AA", with the percentage content of CG bases being 30% - 55%, the number of consecutive single-base repeats < 4, and a length of 21 bases were screened. The 19 bases after AA were used as the target sequence, and siRNAs targeting the L gene of the rabies CVS-11 strain were designed using an online software (https: / / sidirect2.rnai.jp / ), including si-L5055, si-L2157, and si-L5773.

[0041] Design of siNC: siNC has exactly the same base composition as si-G997, with AA fixed as the starting point, and the remaining 19 bases are randomly arranged. After BLAST alignment, an arrangement with no obvious homology to rabies virus and known genes in the GenBank database was determined as the negative control siNC.

[0042] II. Experimental results

[0043] The sense and antisense strands and nucleotide information of the siRNAs obtained in Step 1 are shown in Table 1.

[0044] Table 1 Sense and antisense strands and nucleotide information of siRNA

[0045]

[0046] Example 2. Influence of siRNA on Rabies virus in cells

[0047] I. Experimental methods

[0048] 1. Construction of experimental group cells

[0049] (1) Construction of NA cell plates

[0050] 1) Inoculate NA cells into cell culture dishes, and culture them in RPMI-1640 medium until the NA cells cover the culture dishes. Discard the culture medium, wash the culture dishes 3 times with PBS, then discard the PBS, add 2 mL of 0.25% (w / w) trypsin to digest the cells for 30 s, discard the trypsin, add complete culture medium to suspend the cells, and obtain a cell suspension with a cell concentration of 200,000 cells / mL. Inoculate the cell suspension into a 12-well cell culture plate at 1 mL / well, and culture it under the conditions of 37 °C and 5% (w / w) CO2 to obtain the NA cell plate to be transfected.

[0051] 2) Label two 1.5 mL EP tubes as tube A and tube B respectively. Add 100 μL of RPMI-1640 medium to tube A and tube B respectively. Then add 2 μL of Lipofectamine TM 3000 transfection reagent to tube A and mix well. Add 4 μL of si-G997 shown in Example 1 with a concentration of 20 μM to tube B and mix well. Then add the liquid in tube B to tube A and mix evenly with the liquid in tube A. Let it stand at 25 °C for 15 min to obtain the si-G997 transfection complex.

[0052] Replace si-G997 shown in Example 1 in tube B with si-G193, si-G672, si-L5055, si-L2157, si-L5773 and siNC shown in Example 1 respectively to obtain the si-G193 transfection complex, si-G672 transfection complex, si-L5055 transfection complex, si-L2157 transfection complex, si-L5773 transfection complex and siNC transfection complex.

[0053] 3) si-G997-NA cell plate: Discard the liquid in the NA cell plate to be transfected obtained in step 1), wash it 2 times with PBS, then add 1640 medium at 500 μL / well, and then add the si-G997 transfection complex obtained in step 2) at 206 μL / well. Culture it under the conditions of 37 °C and 5% (w / w) CO2 for 6 h. After the culture is completed, discard the liquid in the cell plate to obtain the si-G997-NA cell plate.

[0054] si-G193-NA cell plate: Replace the si-G997 transfection complex in the construction process of the si-G997-NA cell plate with the si-G193 transfection complex obtained in step (2), and keep the rest of the treatments the same to obtain the si-G193-NA cell plate.

[0055] si-G672-NA cell plate: Replace the si-G997 transfection complex in the construction process of the si-G997-NA cell plate with the si-G672 transfection complex obtained in step (2), and keep the rest of the treatments the same to obtain the si-G672-NA cell plate.

[0056] si-L5055-NA cell plate: Replace the si-G997 transfection complex in the construction process of the si-G997-NA cell plate with the si-L5055 transfection complex obtained in step (2), and keep the rest of the treatments the same to obtain the si-L5055-NA cell plate.

[0057] si-L2157-NA cell plate: Replace the si-G997 transfection complex in the construction process of the si-G997-NA cell plate with the si-L2157 transfection complex obtained in step (2), and keep the rest of the treatments the same to obtain the si-L2157-NA cell plate.

[0058] si-L5773-NA cell plate: Replace the si-G997 transfection complex in the construction process of the si-G997-NA cell plate with the si-L5773 transfection complex obtained in step (2), and keep the rest of the treatments the same to obtain the si-L5773-NA cell plate.

[0059] siNC-NA cell plate: Replace the si-G997 transfection complex in the construction process of the si-G997-NA cell plate with the siNC transfection complex obtained in step (2), and keep the rest of the treatments the same to obtain the siNC-NA cell plate.

[0060] (2) Construction of BHK-21 cell plate

[0061] Replace the NA cells in step (1) with BHK-21 cells and perform the same treatments to obtain the BHK cell plate to be transfected, si-G997-BHK cell plate, si-G193-BHK cell plate, si-G672-BHK cell plate, si-L5055-BHK cell plate, si-L2157-BHK cell plate, si-L5773-BHK cell plate, and siNC-BHK cell plate.

[0062] 2. Direct immunofluorescence detection

[0063] The HA cell plates to be transfected, si-G997-NA cell plates, si-G193-NA cell plates, si-G672-NA cell plates, si-L5055-NA cell plates, si-L2157-NA cell plates, si-L5773-NA cell plates, siNC-NA cell plates, BHK cell plates to be transfected, si-G997-BHK cell plates, si-G193-BHK cell plates, si-G672-BHK cell plates, si-L5055-BHK cell plates, si-L2157-BHK cell plates, si-L5773-BHK cell plates and siNC-BHK cell plates obtained in step 1 were respectively inoculated with the rabies virus CVS-11 strain at an MOI of 0.1, and cultured in RPMI-1640 medium for 48 h, then the liquid was discarded. Each cell plate was washed once with PBS, 80% (v / v) acetone was added to each cell plate at 500 μL / well, and after fixing at -20°C for 30 min, the acetone was discarded. After each cell plate was washed 3 times with PBS, fluorescein isothiocyanate (FITC)-labeled anti-rabies virus N protein fluorescent antibody was added to each cell plate at 400 μL / well, and incubated at 4°C for 16 h. After the incubation, the fluorescein isothiocyanate (FITC)-labeled anti-rabies virus N protein fluorescent antibody was discarded and each cell plate was washed 3 times with PBS. Then PBS was added to each cell plate at 1 mL / well, and each cell plate was respectively placed under a fluorescence microscope for observation.

[0064] 3. Fluorescent quantitative PCR detection

[0065] The si-G997-NA cell plates, si-G193-NA cell plates, si-G672-NA cell plates, si-L5055-NA cell plates, si-L2157-NA cell plates, si-L5773-NA cell plates, siNC-NA cell plates, si-G997-BHK cell plates, si-G193-BHK cell plates, si-G672-BHK cell plates, si-L5055-BHK cell plates, si-L2157-BHK cell plates, si-L5773-BHK cell plates and siNC-BHK cell plates obtained in step 1 were respectively inoculated with the rabies virus CVS-11 strain at an MOI of 0.1, and cultured in RPMI-1640 medium for 48 h. Then, the liquid in each cell plate was discarded. After washing once with PBS, 1 mL / well of Trizol was added to each cell plate. After pipetting the cells, the supernatant in each cell plate was collected to obtain si-G997-NA supernatant, si-G193-NA supernatant, si-G672-NA supernatant, si-L5055-NA supernatant, si-L2157-NA supernatant, si-L5773-NA supernatant, siNC-NA supernatant, si-G997-BHK supernatant, si-G193-BHK supernatant, si-G672-BHK supernatant, si-L5055-BHK supernatant, si-L2157-BHK supernatant, si-L5773-BHK supernatant and siNC-BHK supernatant.

[0066] RNA of si-G997-NA, si-G193-NA, si-G672-NA, si-L5055-NA, si-L2157-NA, si-L5773-NA, siNC-NA, si-G997-BHK, si-G193-BHK, si-G672-BHK, si-L5055-BHK, si-L2157-BHK, si-L5773-BHK and siNC-BHK was obtained by extracting the RNA of si-G997-NA supernatant, si-G193-NA supernatant, si-G672-NA supernatant, si-L5055-NA supernatant, si-L2157-NA supernatant, si-L5773-NA supernatant, siNC-NA supernatant, si-G997-BHK supernatant, si-G193-BHK supernatant, si-G672-BHK supernatant, si-L5055-BHK supernatant, si-L2157-BHK supernatant, si-L5773-BHK supernatant and siNC-BHK supernatant respectively using the HiPure Universal RNAMini Kit (Magen, R4130-02) according to the kit instructions.

[0067] Using the RNAs of si-G997-NA, si-G193-NA, si-G672-NA, si-L5055-NA, si-L2157-NA, si-L5773-NA, siNC-NA, si-G997-BHK, si-G193-BHK, si-G672-BHK, si-L5055-BHK, si-L2157-BHK, si-L5773-BHK, and siNC-BHK as templates, after thoroughly mixing them evenly according to the reverse transcription system shown in Table 2 using the EasyScriptUni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) reverse transcription kit (TransGen Biotech, AU341-02), incubate at 42 °C for 15 min and then heat at 85 °C for 5 s to obtain the cDNAs of si-G997-NA, si-G193-NA, si-G672-NA, si-L5055-NA, si-L2157-NA, si-L5773-NA, siNC-NA, si-G997-BHK, si-G193-BHK, si-G672-BHK, si-L5055-BHK, si-L2157-BHK, si-L5773-BHK, and siNC-BHK.

[0068] Table 2 Reverse transcription system

[0069] Component Dosage Template (RNA) 1 μg 5×EasyScript All-in-One SuperMix for qPCR 4 μL gDNA Remover 1 μL RNase-free Water Make up to 20 μL Total volume 20 μL

[0070] Using the cDNA of si-G997-NA, si-G193-NA, si-G672-NA, si-L5055-NA, si-L2157-NA, si-L5773-NA, siNC-NA, si-G997-BHK, si-G193-BHK, si-G672-BHK, si-L5055-BHK, si-L2157-BHK, si-L5773-BHK and siNC-BHK as templates respectively, qPCR fluorescence amplification was carried out using the PerfectStart Green qPCR SuperMix fluorescence quantitative kit (TransGen Biotech, AQ601-01-V2) according to the kit instructions to obtain the si-G997-NA fluorescence amplification product (corresponding to the G gene of CVS-11), si-G193-NA fluorescence amplification product (corresponding to the G gene of CVS-11), si-G672-NA fluorescence amplification product (corresponding to the G gene of CVS-11), si-L5055-NA fluorescence amplification product (corresponding to the L gene of CVS-11), si-L2157-NA fluorescence amplification product (corresponding to the L gene of CVS-11), si-L5773-NA fluorescence amplification product (corresponding to the L gene of CVS-11), siNC-NA fluorescence amplification product, si-G997-BHK fluorescence amplification product (corresponding to the G gene of CVS-11), si-G193-BHK fluorescence amplification product (corresponding to the G gene of CVS-11), si-G672-BHK fluorescence amplification product (corresponding to the G gene of CVS-11), si-L5055-BHK fluorescence amplification product (corresponding to the L gene of CVS-11), si-L2157-BHK fluorescence amplification product (corresponding to the L gene of CVS-11), si-L5773-BHK fluorescence amplification product (corresponding to the L gene of CVS-11) and siNC-BHK fluorescence amplification product. The Ct values of each fluorescence amplification product were observed using a fluorescence inverted microscope, and the transcriptional levels (i.e., mRNA levels) of the G gene or L gene of each fluorescence product were calculated according to the 2-ΔΔCt method.

[0071] When using the cDNA of si-G997-NA, the cDNA of si-G193-NA, the cDNA of si-G672-NA, the cDNA of si-G997-BHK, the cDNA of si-G193-BHK or the cDNA of si-G672-BHK as a template, the nucleotide sequence of the forward primer CVS-G-F in the qPCR fluorescence quantification process is as shown in SEQ ID NO: 15, and the nucleotide sequence of the reverse primer CVS-G-R is as shown in SEQ ID NO: 16; when using the cDNA of si-L5055-NA, the cDNA of si-L2157-NA, the cDNA of si-L5773-NA, the cDNA of si-L5055-BHK, the cDNA of si-L2157-BHK or the cDNA of si-L5773-BHK as a template, the nucleotide sequence of the forward primer CVS-L-F in the qPCR fluorescence quantification process is as shown in SEQ ID NO: 17, and the nucleotide sequence of the reverse primer CVS-L-R is as shown in SEQ ID NO: 18; when using the cDNA of siNC-NA or the cDNA of siNC-BHK as a template, the nucleotide sequence of the forward primer GAPDH-F in the qPCR fluorescence quantification process is as shown in SEQ ID NO: 19, and the nucleotide sequence of the reverse primer GAPDH-R is as shown in SEQ ID NO: 20; the primer information used in the qPCR fluorescence quantification process is shown in Table 3.

[0072] Table 3 Primer information used in the qPCR fluorescence quantification process

[0073] Name Nucleotide information (5’-3’) CVS-G-F (SEQ ID NO: 15) TCCCTGGAGCCCTATTGACA CVS-G-R (SEQ ID NO: 16) ACCCGTTCACTTTGATGGCT CVS-L-F (SEQ ID NO: 17) TCTCTCAAAGTGGGCGGAAC CVS-L-R (SEQ ID NO: 18) ACATCTCCGGCTCCTGTTTG GAPDH-F (SEQ ID NO: 19) CGTCCCGTAGACAAAATGGT GAPDH-R (SEQ ID NO: 20) TTGATGGCAACAATCTCCAC

[0074] 4. TCID 50 Detection

[0075] Respectively inoculate the rabies virus CVS-11 strain onto the si-G997-NA cell plate, si-G193-NA cell plate, si-G672-NA cell plate, si-L5055-NA cell plate, si-L2157-NA cell plate, si-L5773-NA cell plate and siNC-NA cell plate obtained in step 1 according to MOI = 0.1, and collect the supernatants of each cell plate after culturing with RPMI-1640 medium for 48 h to obtain si-G997-NA virus solution, si-G193-NA virus solution, si-G672-NA virus solution, si-L5055-NA virus solution, si-L2157-NA virus solution, si-L5773-NA virus solution, siNC-NA virus solution.

[0076] The NA cells in good growth condition were passaged into 96-well plates and cultured in a constant temperature incubator at 37°C and 5% (w / w) CO2 to obtain 96-well plates of NA cells with a cell density of 10,000 cells / well.

[0077] Then, the si-G997-NA virus solution was serially diluted 10-fold (dilution factor from 10 -1 to 10 -8 ) using RPMI1640 medium. Each diluted si-G997-NA virus solution was inoculated into the 96-well plate of NA cells at 100 μL / well (4 replicates for each dilution), and cultured in a constant temperature incubator at 37°C and 5% (w / w) CO2 using RPMI-1640 medium containing 5% (v / v) serum for 48 h. The medium was discarded, and the cells were washed with PBS at 100 μL / well, then the PBS was discarded. Then, 80% (v / v) acetone was added at 100 μL / well and fixed at -20°C for 30 min. After discarding the acetone, the cells were washed 3 times with PBS. Then, a dilution solution of anti-rabies virus N protein fluorescent antibody (Fujirebio Diagnostic, catalog number 800-092) (the fluorescent antibody was mixed with PBS at a volume ratio of 1:400) was added at 50 μL / well in the dark, and incubated at 4°C for 16 h. The supernatant was discarded, and the cells were washed 3 times with PBS. Then, PBS was added at 100 μL / well, and the fluorescence was observed under a fluorescence microscope. The wells with detected fluorescence were recorded as positive wells, and the virus titer (TCID 50 ) in the NA cells infected with the si-G997-NA virus solution was calculated according to the Karber method.

[0078] The si-G997-NA virus solution was replaced with si-G193-NA virus solution, si-G672-NA virus solution, si-L5055-NA virus solution, si-L2157-NA virus solution, si-L5773-NA virus solution, and siNC-NA virus solution respectively. According to the above method, the virus titers in the NA cells infected with si-G193-NA virus solution, si-G672-NA virus solution, si-L5055-NA virus solution, si-L2157-NA virus solution, si-L5773-NA virus solution, and siNC-NA virus solution were calculated respectively.

[0079] II. Experimental Results

[0080] 1. Results of direct immunofluorescence assay

[0081] During the direct immunofluorescence assay, the results of fluorescence microscope observation of each cell plate are shown asFigure 1 As shown, the results show that: whether in NA cells or in BHK-21 cells, compared with the negative control (siNC, that is, the cell plate transfected with siNC) and the virus control (viral control, that is, the cell plate to be transfected), the fluorescence spots in the cell plates transfected with si-G997, si-G193, si-G672 and si-L5055 were significantly reduced, indicating that the transfected cells could significantly inhibit the proliferation of rabies virus (CVS-11 strain);

[0082] 2. Results of fluorescence quantitative PCR detection

[0083] The results of fluorescence quantitative PCR detection are shown as Figure 2 follows; A is the mRNA level map of the L gene in the fluorescence amplification products of si-L2157-NA, si-L5055-NA, si-L5773-NA and siNC-NA; B is the mRNA level map of the L gene in the fluorescence amplification products of si-L2157-BHK, si-L5055-BHK, si-L5773-BHK and siNC-BHK; C is the mRNA level map of the G gene in the fluorescence amplification products of si-G997-NA, si-G193-NA, si-G672-NA and siNC-NA; D is the mRNA level map of the G gene in the fluorescence amplification products of si-G997-BHK, si-G193-BHK, si-G672-BHK and siNC-BHK.

[0084] The results show that: compared with the negative control (siNC), the mRNA levels of the rabies virus L gene in NA cells and BHK-21 cells transfected with si-L5055 decreased significantly, while the mRNA levels of the rabies virus L gene in NA cells and BHK-21 cells transfected with si-L2157 or si-L5773 did not decrease or even increased;

[0085] Compared with the negative control (siNC), the mRNA levels of the rabies virus G gene in NA cells and BHK-21 cells transfected with si-G193, si-G672 and si-G997 decreased significantly.

[0086] Results description: Both si-G997 and si-L5055 can effectively interfere with the transcriptional expression of the rabies virus gene in cells. Among them, si-G997 can significantly inhibit the transcriptional expression of the G gene of the rabies virus (CVS-11 strain), and si-L5055 can significantly inhibit the transcriptional expression of the L gene of the rabies virus (CVS-11 strain).

[0087] 3. TCID 50 Test results

[0088] TCID 50 The test result diagram is as Figure 3 shown. A is the TCID 50 in NA cells infected with si-G997-NA virus solution, the TCID 50 in NA cells infected with si-G193-NA virus solution, the TCID 50 in NA cells infected with si-G672-NA virus solution, and the TCID 50 in NA cells infected with siNC-NA virus solution. B is the TCID 50 in NA cells infected with si-L5055-NA virus solution, the TCID 50 in NA cells infected with si-L2157-NA virus solution, the TCID 50 in NA cells infected with si-L5773-NA virus solution, and the TCID 50 in NA cells infected with siNC-NA virus solution.

[0089] The results show that compared with the negative control (i.e., the TCID 50 ) in NA cells infected with siNC-NA virus solution, the virus titers in NA cells infected with si-G997-NA virus solution and si-L5055-NA virus solution both decreased significantly; while the virus titers in NA cells infected with other virus solutions did not show obvious changes.

[0090] Results description: Both si-G997 and si-L5055 can significantly inhibit the replication of the rabies virus (CVS-11 strain); while si-G193, si-G672, si-L2157 and si-L5775 cannot inhibit the replication of the rabies virus.

[0091] Example 3 Construction of lentivirus packaging siRNA

[0092] I. Experimental method

[0093] 1. Construction of lentivirus rAAV-G997 packaging si-G997 (siRNA-G)

[0094] (1) Construction of expression plasmid:

[0095] 1) Using the Xba I and Kpn I restriction sites of the pEU6 vector as the insertion sites, synthesize si-G997-F with the nucleotide sequence shown in SEQ ID NO: 21 and si-G997-R with the nucleotide sequence shown in SEQ ID NO: 22; wherein the total amount of si-G997-F or si-G997-R is greater than or equal to 2 OD.

[0096] The structure of si-G997-F is: 5'-Xba I sticky end + sense + loop + antisense + transcription termination site + Kpn I sticky end-3';

[0097] The structure of si-G997-R is: 5'-Kpn I sticky end + complementary sequence of transcription termination site + sense + loop + antisense + Xba I complementary sticky end-3'.

[0098] 2) Place the annealing system shown in Table 4 in a PCR tube, pipette and mix well, and then perform annealing to obtain double-stranded DNA.

[0099] Table 4 Annealing system

[0100] Component Volume si-G997-F (SEQ ID NO: 21, 100 μM) 5 μL si-G997-R (SEQ ID NO: 22, 100 μM) 5 μL T4 DNA Ligase 10× Buffer 5 μL Deionized water 35 μL Total volume 50 μL

[0101] Annealing program: 95°C, 2 min; 95°C, 20 s, 70 cycles, decreasing 1°C per cycle.

[0102] Digest the pEU6 vector with Xba I endonuclease and Kpn I endonuclease to obtain a linearized pEU6 vector, and perform ligation according to the ligation system shown in Table 5 to obtain a recombinant pEU6 vector.

[0103] Table 5 Ligation system

[0104] Component Volume Linearized pEU6 vector 125 ng Double-stranded DNA (10 μM) 5 μL T4 DNA Ligase 2.5 μL T4 DNA Ligase 10× Buffer 5 μL Deionized water 35 μL Total volume 50 μL

[0105] Ligation program: 22°C, 30 min; 65°C, 10 min.

[0106] (3) Transform 10 μL of the recombinant pEU6 vector obtained in step (2) into competent Escherichia coli cells DH5α and culture them. Select 5 single colonies of Escherichia coli DH5α transformed with the recombinant pEU6 vector and identify them respectively using the U6 upstream identification primer with the nucleotide sequence shown in SEQ ID NO: 23 and the U6 downstream identification primer with the nucleotide sequence shown in SEQ ID NO: 24 (the amplified fragment length is 666 bp), and record the electrophoresis bands. The correctly identified recombinant pEU6 vector is the expression plasmid pEU6-si-G997.

[0107] (2) Construction of packaging plasmid

[0108] (1) Insert the EGFP fluorescent protein at the Xba I site of the pAAV-CMVVerctor vector (Takara, catalog number 6230) to obtain the pAAV-EGFP vector.

[0109] Using the Hind III restriction site of the pAAV-EGFP vector as the insertion site, synthesize the CMV-U6-G997-F with the nucleotide sequence shown in SEQ ID NO: 25 and the CMV-U6-G997-R with the nucleotide sequence shown in SEQ ID NO: 26.

[0110] (2) Use the Thermo Fisher Hind III Fast Restriction Enzyme to digest the pAAV-EGFP vector to obtain the linearized pAAV-EGFP vector.

[0111] Using the pEU6-si-G997 plasmid obtained in step (1) as a template, use the high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase (Novoprotein) to amplify the G997 siRNA expression cassette according to its instructions in combination with the CMV-U6-G997-F with the nucleotide sequence shown in SEQ ID NO: 25 and the CMV-U6-G997-R with the nucleotide sequence shown in SEQ ID NO: 26.

[0112] Ligate the G997 siRNA expression cassette and the linearized pAAV-EGFP vector using T4 DNA ligase to obtain the recombinant pAAV-EGFP vector.

[0113] (3) The recombinant pAAV-EGFP vector obtained in step (2) (10 μL) was transformed into competent Escherichia coli DH5α cells for culture. Eight monoclonal colonies of Escherichia coli DH5α transformed with recombinant pAAV-EGFP were selected and identified respectively using the upstream CMV-U6-siRNA identification primer with the nucleotide sequence shown in SEQ ID NO: 27 and the downstream CMV-U6-siRNA identification primer with the nucleotide sequence shown in SEQ ID NO: 28 (the amplified fragment length is 934 bp). The correctly identified recombinant pAAC-EGFP vector is the packaging plasmid pAAV-si-G997.

[0114] (3) Construction of recombinant adeno-associated virus rAAV-G997

[0115] (1) After culturing the monoclonal colonies of Escherichia coli DH5α transformed with recombinant pAAV-EGFP in LB medium at 37 °C for 16 h, a bacterial solution was obtained. Then, the bacterial solution was inoculated into 200 mL of ampicillin-resistant LB medium at a volume ratio of 1:100 and cultured in a shaker at 37 °C for 16 h. The cultured bacterial solution was used to extract the plasmid using a plasmid large extraction kit (OMEGA) according to the instructions, and 300 μg of pAAV-si-G997 plasmid was obtained.

[0116] (2) Two 50-mL centrifuge tubes were prepared and labeled as tube A and tube B. 120 μg of the pAAV-si-G997 obtained in step (2), 120 μg of pHelper, and 120 μg of pRC2-mi342 were added to tube A, and the volume of the liquid in tube A was made up to 15 mL with high-glucose DMEM and mixed evenly.

[0117] 720 μL of the transfection reagent lipo293TM was added to tube B, and the volume of the liquid in tube B was made up to 15 mL with high-glucose DMEM and mixed evenly.

[0118] The liquid in tube B was poured into tube A. After mixing evenly, it was left standing at 25 °C for 15 min to obtain 30 mL of transfection complex. Then, the transfection complex was added to 10 15-mm culture dishes inoculated with HEK-293T cells (cell density ≥ 90%) at 3 mL / dish and cultured in an incubator at 37 °C and 5% (v / v) CO2 for 72 h. After the culture, the culture medium in each culture dish was collected into different 50-mL centrifuge tubes. After digesting the adherent cells at the bottom of each culture dish with trypsin, the trypsin was discarded, and the adherent cells in each culture dish were blown off with a pipette and mixed evenly with the culture medium in each culture dish. The mixture was centrifuged at 800 r / min for 5 min, the supernatant was discarded, and the precipitate was used The Purification Kit (AAV2) (from TAKARA) was used to purify and collect according to its instruction manual, and the recombinant adeno-associated virus rAAV-G997 was obtained.

[0119] (4) Virus titer test of the recombinant adeno-associated virus rAAV-G997

[0120] Mix 1 μL of rAAV-G997 obtained in step (3) with 6 μL of deionized water, then add 1 μL of DNase and 1 μL of RNase. After mixing evenly, incubate at 37 °C for 30 min. After digestion, denature at 100 °C for 10 min. Then add 1 μL of proteinase K and digest at 56 °C for 1 h. Then centrifuge at 10000 r / min for 10 min, and collect the supernatant as the rAAV-G997 nucleic acid sample.

[0121] Using the pAAV-EGFP plasmid as a standard, dilute the copy numbers of the pAAV-EGFP plasmid to 10 8 copies / μL, 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL and 10 4 copies / μL to obtain pAAV-EGFP plasmids with different copy numbers.

[0122] Using pAAV-EGFP plasmids with different copy numbers as templates respectively, perform fluorescence quantitative PCR amplification according to the fluorescence quantitative PCR amplification system shown in Table 6 using AAV titer-EGFP-F with the nucleotide sequence shown in SEQ ID NO: 29 and AAV titer-EGFP-R with the nucleotide sequence shown in SEQ ID NO: 30 to obtain fluorescence quantitative PCR products of pAAV-EGFP plasmids with different copy numbers, and detect the Ct values of the fluorescence quantitative PCR products of pAAV-EGFP plasmids with different copy numbers. Using the Ct values of the fluorescence quantitative PCR products of pAAV-EGFP plasmids with different copy numbers as the ordinate and the copy numbers as the abscissa, draw a standard curve and calculate the standard curve equation.

[0123] Table 6 Fluorescence quantitative PCR amplification system

[0124] Component Volume Template 1 μL AAV titer-EGFP-F (SEQ ID NO: 29, 10 μM) 1 μL AAV titer-EGFP-R (SEQ ID NO: 30, 10 μM) 1 μL 2× PerfectStart Green qPCR SuperMix 10 μL Nuclease-free Water 7 μL Total volume 20 μL

[0125] Amplification program: 94 °C, 30 s; 94 °C, 5 s, 60 °C, 30 s, 40 cycles; 95 °C, 10 s; 65 - 95 °C, heating rate is 0.5 °C / 0.05 s, melting curve.

[0126] Using the rAAV-G997 nucleic acid sample as the template for the fluorescence quantitative PCR amplification system described in Table 6, perform fluorescence quantitative PCR amplification to obtain the fluorescence quantitative PCR amplification product of the rAAV-G997 nucleic acid sample, detect the Ct value of the fluorescence quantitative PCR amplification product of the rAAV-G997 nucleic acid sample, and calculate the copy number (vg / mL) of the rAAV-G997 nucleic acid sample in combination with the standard curve.

[0127] 2. Construction of recombinant adeno-associated virus rAAV-L5055 packaging si-L5055 (siRNA-L)

[0128] Replace si-G997-F with nucleotide sequence as shown in SEQ ID NO: 31 and si-G997-R with nucleotide sequence as shown in SEQ ID NO: 32 in step 1(1), and prepare pEU6-si-L5055 according to the method shown in step 1(1).

[0129] Replace CMV-U6-G997-F with nucleotide sequence as shown in SEQ ID NO: 33 and CMV-U6-G997-R with nucleotide sequence as shown in SEQ ID NO: 34 in step 1(2), and replace pEU6-si-G997 with pEU6-si-L5055. Then prepare pAAV-si-L5055 according to the method shown in step 1(2).

[0130] Replace pAAV-si-G997 in step 1(3) with pAAV-si-L5055, and prepare recombinant adeno-associated virus rAAV-L5055 according to the method shown in step 1(3).

[0131] Obtain the virus titer of recombinant adeno-associated virus rAAV-L5055 according to the method shown in step 1(4).

[0132] 3. Construction of recombinant adeno-associated virus rAAV-NC packaging si-NC (siNC)

[0133] Replace si-G997-F with nucleotide sequence as shown in SEQ ID NO: 35 and si-G997-R with nucleotide sequence as shown in SEQ ID NO: 36 in step 1(1), and prepare pEU6-si-NC according to the method shown in step 1(1).

[0134] Replace the CMV-U6-G997-F with the nucleotide sequence shown in SEQ ID NO: 37 and CMV-U6-G997-R with the nucleotide sequence shown in SEQ ID NO: 38 in step 1(2), and replace pEU6-si-G997 with pEU6-si-NC. According to the method shown in step 1(2), pAAV-si-NC was prepared.

[0135] Replace pAAV-si-G997 in step 1(3) with pAAV-si-NC. According to the method shown in step 1(3), the recombinant adeno-associated virus rAAV-NC was prepared.

[0136] According to the method shown in step 1(4), the virus titer of the recombinant adeno-associated virus rAAV-NC was obtained.

[0137] II. Experimental Results

[0138] The identification result diagram of the expression plasmid is as Figure 4 shown. Lanes 1-5 are the identification results of pEU-si-L5055, lanes 6-10 are the identification results of pEU6-si-G997, and lanes 11-15 are the identification results of pEU6-si-NC.

[0139] The results showed that: in the electrophoretic identification results of the expression plasmids pEU6-si-G997, pEU6-si-5055, and pEU6-si-NC, an electrophoretic band of 666 bp appeared, which was the same size as the amplified fragment of the U6 upstream identification primer (SEQ ID NO: 23) and the U6 downstream identification primer (SEQ ID NO: 24), indicating that pEU6-si-G997, pEU6-si-5055, and pEU6-si-NC were successfully constructed.

[0140] The identification result diagram of the packaging plasmid is as Figure 5 shown. Lanes 1-8 are the identification results of pAAV-si-G997, lanes 9-16 are the identification results of pAAV-si-L5055, and lanes 17-24 are the identification results of pAAV-si-NC.

[0141] The results showed that an electrophoretic band of 934 bp appeared in the electrophoretic identification results of packaging plasmids pAAV-si-G997, pAAV-si-L5055, and pAAV-si-NC, which was the same size as the amplification fragment of the upstream identification primer of CMV-U6-siRNA (SEQ ID NO: 27) and CMV-U6-siRNA (SEQ ID NO: 28), indicating that pAAV-si-G997, pAAV-si-L5055, and pAAV-si-NC were successfully constructed.

[0142] The fluorescence curves of pAAV-EGFP with different copy numbers are as Figure 6 shown; the standard curve is as Figure 7 shown.

[0143] The results showed that the standard curve was as shown in Formula I;

[0144] Formula I: y = -0.3223x + 11.338; x is the ct value, and the copy number is 10 y copies / μL.

[0145] The results showed that the copy number of recombinant adeno-associated virus rAAV-G997 was 4.9×10 11 vg / mL, the copy number of recombinant adeno-associated virus rAAV-L5055 was 2.5×10 11 vg / mL, and the copy number of recombinant adeno-associated virus rAAV-NC was 4×10 10 vg / mL.

[0146] Example 4 Testing the Effect of Lentivirus on the Replication Ability of RABV

[0147] I. Experimental Method

[0148] rAAV-G997 recombinant adeno-associated virus infection group: NA cells were cultured in a 12-well plate until the cell density in each well reached 80% - 90%. After discarding the liquid in the well plate, serum-free RPMI-1640 medium was added at 500 μL / well. Then, rAAV-G997 prepared in Example 3 was added at MOI = 1000 (100 vg / cell). After adsorption in an incubator at 37°C and 5% (v / v) CO2 for 2 h, the complete medium was replaced and the cells were further cultured for 24 h. Then, the liquid was discarded, 500 μL of serum-free medium was added, and the CVS-11 strain was inoculated into the medium at MOI = 0.1. After adsorption in an incubator at 37°C and 5% (v / v) CO2 for 1 h, the complete medium was replaced and the cells were continuously cultured to obtain NA cells in the rAAV-G997 recombinant adeno-associated virus infection group.

[0149] rAAV-L5055 Recombinant Adeno-Associated Virus Infection Group: Replace rAAV-G997 in the rAAV-L5055 recombinant adeno-associated virus infection group with rAAV-L5055 prepared in Example 3, and keep the rest of the treatments exactly the same to obtain rAAV-L5055 recombinant adeno-associated virus-infected NA cells.

[0150] rAAV-NC Recombinant Adeno-Associated Virus Infection Group: Replace rAAV-G997 in the rAAV-NC recombinant adeno-associated virus infection group with rAAV-NC prepared in Example 3, and keep the rest of the treatments exactly the same to obtain rAAV-NC recombinant adeno-associated virus-infected NA cells.

[0151] Respectively collect the cell supernatants in the culture media of the rAAV-G997 recombinant adeno-associated virus infection group, rAAV-L5055 recombinant adeno-associated virus infection group, and rAAV-NC recombinant adeno-associated virus infection group at 24 h, 48 h, 72 h, and 96 h after inoculation with the CVS-11 strain. According to the "TCID 50 detection" method shown in Step 1 of Example 1, respectively detect the virus titers of the cell supernatants at different times after inoculation with the CVS-11 strain.

[0152] Respectively collect the NA cells in the culture media of the rAAV-G997 recombinant adeno-associated virus infection group, rAAV-L5055 recombinant adeno-associated virus infection group, and rAAV-NC recombinant adeno-associated virus infection group at 24 h, 48 h, 72 h, and 96 h after inoculation with the CVS-11 strain. According to the "fluorescent quantitative PCR detection" method shown in Step 1 of Example 1, detect the transcription levels of each recombinant adeno-associated virus infection group, including the transcription level of the G gene in the rAAV-G997 recombinant adeno-associated virus infection group, the transcription level of the L gene in the rAAV-L5055 recombinant adeno-associated virus infection group, and the transcription levels of the G gene and L gene in the rAAV-NC recombinant adeno-associated virus infection group.

[0153] II. Experimental Results

[0154] The graphs of the detection results of the virus titers of the cell supernatants at different times after inoculation with the CVS-11 strain and the graphs of the detection results of the transcription levels of each recombinant adeno-associated virus infection group are as Figure 8As shown in the figure; A shows the results of the transcriptional level of the G gene in the rAAV-G997 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group; B shows the results of the transcriptional level of the L gene in the rAAV-L5055 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group; C shows the results of the virus titer detection of the cell supernatants at different times after inoculating the CVS-11 strain in the rAAV-G997 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group; D shows the results of the virus titer detection of the cell supernatants at different times after inoculating the CVS-11 strain in the rAAV-L5055 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group.

[0155] The results showed that: (1) At each time point after inoculating the CVS-11 strain, the virus titers in the NA cells of the rAAV-G997 recombinant adeno-associated virus infection group and the rAAV-L5055 recombinant adeno-associated virus infection group were significantly lower than those in the rAAV-MC recombinant adeno-associated virus infection group.

[0156] (2) The transcriptional level (mRNA level) of the G gene of rabies CVS-11 in the NA cells of the rAAC-G997 recombinant adeno-associated virus infection group was significantly lower than that in the NA cells of the rAAC-NC recombinant adeno-associated virus infection group; the transcriptional level (mRNA level) of the L gene of rabies CVS-11 in the NA cells of the rAAC-L5055 recombinant adeno-associated virus infection group was significantly lower than that in the NA cells of the rAAC-NC recombinant adeno-associated virus infection group.

[0157] It shows that both the recombinant adeno-associated virus rAAV-G997 and the recombinant adeno-associated virus rAAV-L5055 can significantly inhibit the replication of rabies virus and reduce the virus titer.

[0158] The NA cells in the rAAV-G997 recombinant adeno-associated virus infection group were not infected by rabies virus or the replication of rabies virus in the cells was significantly inhibited; the NA cells in the rAAV-G997 recombinant adeno-associated virus infection group were not infected by rabies virus or the replication of rabies virus in the cells was significantly inhibited.

[0159] Example 5 Protection Test of Recombinant Adeno-Associated Virus Against Mouse Infection with RABV

[0160] I. Experimental Method

[0161] Thirty SPF-grade Kunming mice weighing 20 g were randomly divided into the rAAV-G997 group, the rAAV-L5055 group, and the rAAV-NC group, with 10 mice in each group; a control group was also set up, which contained 10 SPF-grade Kunming mice weighing 20 g.

[0162] rAAV-G997 group: The recombinant adeno-associated virus rAAV-G997 prepared in Example 3 was injected into SPF-grade Kunming mice by intracranial injection at 2×10 11 vg / kg. 48 h after injection, the SPF-grade Kunming mice were challenged with the rabies virus CVS-11 strain by intramuscular injection at an MOI of 0.1.

[0163] rAAV-L5055 group: The recombinant adeno-associated virus rAAV-G997 in the rAAV-G997 group was replaced with rAAV-L5055 prepared in Example 3, and the remaining treatments were the same.

[0164] rAAV-NC group: The recombinant adeno-associated virus rAAV-G997 in the rAAV-G997 group was replaced with rAAV-NC prepared in Example 3, and the remaining treatments were the same.

[0165] Control group: The SPF-grade Kunming mice were challenged with the rabies virus CVS-11 strain by intramuscular injection at an MOI of 0.1.

[0166] After challenging the SPF-grade Kunming mice in each group, the average body weight and the number of deaths of the mice in each group were recorded daily for 21 consecutive days, and the body weight change rate and survival rate of the mice in each group were calculated.

[0167] II. Experimental results

[0168] The body weight change rate graphs of the mice in each group 21 days after challenge are as Figure 9 shown. The results show that the onset time of the SPF-grade Kunming mice in the rAAV-G997 group was the 9th day after challenge, the onset time of the SPF-grade Kunming mice in the rAAV-L5055 group was the 9th day after challenge, and the onset time of the SPF-grade Kunming mice in the rAAV-NC group was the 8th day after challenge;

[0169] For the SPF-grade Kunming mice in the rAAV-G997 group and the rAAV-L5055 group, as time increased, the body weight of the mice increased steadily without significant fluctuations; while the body weight of the SPF-grade Kunming mice in the rAAV-NC group and the control group fluctuated significantly within 21 days, and the body weight of the mice was significantly lower than that of the SPF-grade Kunming mice in the rAAV-G997 group and the rAAV-L5055 group.

[0170] Results description: After infecting mice with recombinant adeno-associated virus rAAV-G997 packaged with si-G997 (siRNA-G) and recombinant adeno-associated virus rAAV-L5055 packaged with si-L5055 (siRNA-L), the body weights of the mice can steadily increase without significant fluctuations after being infected with the rabies virus CVS-11 strain.

[0171] The survival rate change graph of each group of mice 21 days after virus challenge is as Figure 10 shown. The results show that 21 days after virus challenge, the survival rate of mice in the rAAV-G997 group is 90%, the survival rate of mice in the rAAV-L5055 group is 90%, the survival rate of mice in the rAAV-NC group is 50%, and the survival rate of mice in the control group is 60%.

[0172] Results description: Recombinant adeno-associated virus rAAV-G997 packaged with si-G997 (siRNA-G) and recombinant adeno-associated virus rAAV-L5055 packaged with si-L5055 (siRNA-L) can protect mice from the harm of rabies virus CVS-11 strain.

[0173] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description and ideas. It is not necessary and impossible to list all implementation manners here. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the claims of the present invention.

Claims

1. A siRNA-G that targets and inhibits the G gene of rabies virus, characterized in that, The nucleotide sequence of the sense strand of the siRNA-G is shown in SEQ ID NO: 1, and the nucleotide sequence of the antisense strand of the siRNA-G is shown in SEQ ID NO:

2.

2. Use of the siRNA-G according to claim 1 in the preparation of a drug for inhibiting rabies.

3. The application according to claim 2, wherein The rabies is rabies caused by the rabies virus CVS-11 strain.

4. The application according to claim 2, wherein The inhibition of rabies is the inhibition of the expression of the rabies virus G gene.

5. A pharmaceutical composition for inhibiting rabies, characterized in that, Contains the siRNA-G shown in claim 1.

6. The pharmaceutical composition according to claim 5, wherein It also includes pharmaceutically acceptable excipients.

7. The pharmaceutical composition according to claim 6, characterized in that, The administration method of the pharmaceutical composition is intracranial administration, intramuscular injection and / or intravenous injection.

Images