Cloning and Application of a Maize Kernel Size Gene SSRP1
By cloning the SSRP1 protein and gene, which are related to maize kernel size, and regulating their expression and activity, the problem of regulating maize kernel size was solved, thus improving maize yield and quality.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
- Filing Date
- 2024-04-07
- Publication Date
- 2026-06-23
AI Technical Summary
Existing technologies make it difficult to deeply understand and regulate the genetic mechanisms of maize kernel size, which affects the improvement of maize yield and quality.
By cloning and utilizing the SSRP1 protein and its encoding gene, which are related to maize kernel size, transgenic plants with altered kernel size were bred by regulating their expression and activity.
This has enabled effective control over the size of corn kernels, improving corn yield and quality and providing valuable resources for agricultural production.
Smart Images

Figure CN119039409B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering and relates to the cloning and application of a corn kernel size gene SSRP1. Background Technology
[0002] Maize (Zea mays) is one of the world's most important food crops, widely cultivated in many countries and regions. The size of maize kernels is a crucial factor influencing yield and quality. With global population growth and increasing food demand, researching and improving the mechanisms of maize kernel size to enhance yield and quality is essential for food security and sustainable agricultural development. Maize seed development begins with double fertilization, ultimately forming a triploid endosperm and a diploid embryo. The endosperm accounts for 83% of the total seed weight (embryo 11%, seed coat 6%), thus playing a key role in kernel size formation. Endosperm development begins in the central cell of the fertilized embryo, subsequently undergoing cellularization and differentiation into four main cell types: the basal transfer layer (BETL), aleurone layer (AL), starchy endosperm (SE), and periembryonic zone (ESR). During endosperm differentiation, mitotic cell proliferation and intranuclear replication occur in the endosperm cells, followed by maturation (cell death, dormancy, and drying). The division and expansion of endosperm cells are considered one of the key steps determining kernel size.
[0003] Maize kernel mutants are broadly classified into the following categories based on the location of the defect: embryo defect mutants, endosperm defect mutants, mutants with abnormal embryos and endosperm, and ear budding mutants. Mutants with abnormal embryos and endosperm include small kernels, defective kernels, and empty percarps. Previous research has shown that maize kernel size is regulated by multiple factors, including genetic and environmental factors. Genetic factors play a crucial role in kernel size formation. Currently cloned genes related to small kernels include Smk1, Smmk2, Smmk3, Smmk4, Smmk6, Smmk7, Smk9, MPPR6, and Ppr78, which are involved in the regulation of post-transcriptional processing of maize plasmid and mitochondrial genes. The genetic regulation of maize kernel size involves a very complex network of mechanisms. Effective gene mapping of maize kernel size traits using molecular genetic techniques plays a significant role in deepening our understanding of the genetic regulatory mechanisms of maize kernel size.
[0004] Research on maize kernel size mutants helps us to better understand the regulatory mechanisms of genes involved in kernel development, improve maize yield and quality, and provide valuable resources for actual seed production. Summary of the Invention
[0005] The purpose of this invention is to provide a protein related to the size of corn kernels, its encoding gene, and its applications.
[0006] This invention first protects the application of the SSRP1 protein, which can be divided into S1) or S2):
[0007] S1) Regulates plant seed size;
[0008] S2) Breed transgenic plants with altered seed size.
[0009] In the above applications, the SSRP1 protein is derived from the genus *Zea mays* L., and is as follows: a1) or a2) or a3) :
[0010] a1) The amino acid sequence is that of the protein shown in SEQ ID NO:3;
[0011] a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3;
[0012] a3) Proteins related to plant seed size obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 3.
[0013] Of these, SEQ ID NO:3 consists of 639 amino acid residues.
[0014] To facilitate the purification of the protein in a1), a tag as shown in Table 1 can be attached to the amino or carboxyl terminus of the protein shown in SEQ ID NO: 3.
[0015] Table 1. Sequence of Labels
[0016] Label residues sequence Poly-Arg 5-6 (usually 5) RRRRR FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL
[0017] The protein in a3) above, wherein the substitution and / or deletion and / or addition of one or more amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.
[0018] The proteins mentioned in a3) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0019] The gene encoding the protein in a3) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in SEQ ID NO:2, and / or by performing a missense mutation of one or more base pairs, and / or by attaching the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.
[0020] This invention also protects the application of nucleic acid molecules encoding the SSRP1 protein, which may be S1) or S2):
[0021] S1) Regulates plant seed size;
[0022] S2) Breed transgenic plants with altered seed size.
[0023] In the above applications, the nucleic acid molecule encoding the SSRP1 protein can be a DNA molecule as shown in b1), b2), b3), b4), or b5):
[0024] b1) The coding region is the DNA molecule shown in SEQ ID NO: 2;
[0025] b2) The nucleotide sequence is the DNA molecule shown in SEQ ID NO: 2;
[0026] b3) The nucleotide sequence is the DNA molecule shown in SEQ ID NO: 1;
[0027] b4) has 75% or more identity with the nucleotide sequence defined by b1) or b2) or b3) and is a DNA molecule encoding the SSRP1 protein;
[0028] b5) hybridizes under stringent conditions to the nucleotide sequence defined by b1) or b2) or b3) and to the DNA molecule encoding the SSRP1 protein.
[0029] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.
[0030] Of these, SEQ ID NO:2 consists of 1920 nucleotides, and the nucleotides of SEQ ID NO:2 encode the amino acid sequence shown in SEQ ID NO:3.
[0031] Those skilled in the art can readily mutate the nucleotide sequence encoding the SSRP1 protein of this invention using known methods, such as directed evolution and point mutation. Any artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of the SSRP1 protein isolated according to this invention, as long as they encode the SSRP1 protein, are derived from and equivalent to the nucleotide sequence of this invention.
[0032] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or higher, 80% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 3 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0033] In any of the above-described applications, the regulation of plant seed size can be achieved by increasing or decreasing seed size.
[0034] In any of the above-described applications, the cultivation of transgenic plants with altered seed size can be either the cultivation of transgenic plants with increased seed size or the cultivation of transgenic plants with decreased seed size.
[0035] The present invention also protects a method for cultivating transgenic plants, which may include the following steps: reducing the expression level and / or activity of the SSRP1 protein in the starting plant to obtain a transgenic plant; the transgenic plant has smaller seeds compared to the starting plant.
[0036] In the above method, the "reduction of the expression level and / or activity of the SSRP1 protein in the starting plant" can be achieved by methods well known in the art, such as RNA interference, homologous recombination, and site-directed gene editing, to reduce the expression level and / or activity of the SSRP1 protein in the starting plant.
[0037] In the above method, the "reduction of the expression level and / or activity of the SSRP1 protein in the starting plant" can be specifically achieved by introducing a plant genome editing vector into the starting plant;
[0038] The vector for plant genome editing contains an sgRNA-encoding gene;
[0039] The target DNA recognized by the sgRNA in plants is a DNA fragment encoding the SSRP1 protein.
[0040] In the above method, the vector for plant genome editing may also contain the gene encoding the Cas9 protein. Attached Figure Description
[0041] Figure 1Phenotypic comparison of the maize mutant ssrp1 and the wild type. A shows the phenotype of mature ears from the F2 generation of ssrp1 × B73. Red arrows indicate the kernels of the ssrp1 mutant, Bar = 1 cm. B shows the kernel width phenotype of wild-type (WT) and mutant (ssrp1) from the same F2 segregating ear. Bar = 1 cm. C shows the kernel length phenotype of wild-type (WT) and mutant (ssrp1) from the same F2 segregating ear. Bar = 1 cm. D shows the 100-kernel weight of mature kernels from wild-type (WT) and mutant (ssrp1) randomly selected from the same F2 segregating ear. Results are from three biological replicates. Significance analysis was performed using Student's test; ***, P < 0.001. E shows the statistical analysis of mature kernel length from wild-type (WT) and mutant (ssrp1) randomly selected from the same F2 segregating ear. Results are from three biological replicates. Significance analysis was performed using Student's t-test; ***, P < 0.001. F represents the statistical analysis of mature kernel width from wild-type (WT) and mutant (ssrp1) ears randomly selected from the same F2 segregating group. Results were obtained from three biological replicates. Significance analysis was performed using Student's t-test; ***, P < 0.001.
[0042] Figure 2 This is a map-based cloning diagram of the ssrp1 gene.
[0043] Figure 3 This is a schematic diagram of the mutation sites of SSRP1 in the maize mutant ssrp1. Detailed Implementation
[0044] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0045] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0046] The maize mutant ssrp1 was collected and preserved in our laboratory. Maize genome sequencing information was obtained from the MaizeGDB database, which can be found at: http: / / www.maizegdb.org / .
[0047] Example 1: Map-based cloning of the maize kernel size gene SSRP1
[0048] I. Phenotypic characteristics of the maize mutant ssrp1
[0049] Compared to normal maize kernels, the kernels of the maize mutant ssrp1 are significantly smaller. Figure 1 (A to C), and the weight of 100 seeds is only 74% of that of the wild type. Figure 1D), the average grain length and width were 74.40% and 74.96% of the wild type, respectively. Figure 1 (E and F). This phenomenon was observed to be consistent in phenotype in Beijing and Hainan for four consecutive years, with stable grain size reduction characteristics. Moreover, under field conditions, the harvested ears of self-pollinated mutant plants could be visually distinguished as having smaller grains.
[0050] II. Construction of Genetic Mapping Populations
[0051] The classic maize kernel mutant, small kernel (smk), was obtained using EMS mutagenesis. The ssrp1 mutant was crossed with the inbred line Mo17 to obtain the F1 generation. Self-pollination of the F1 plants yielded segregating ears of the F2 generation carrying the kernel mutation. Statistical analysis of the ratio of wild-type kernels (WT) to mutant kernels (mu) in the F2 segregating population showed a ratio of 3:1 (Table 1). This result indicates that ssrp1 is a single-gene recessive mutant. It also indicates that the heterozygous mutant kernels exhibit normal characteristics, identical to the wild type.
[0052] Table 1. Segregation ratio of F2 generation ears of ssrp1×Mo17
[0053]
[0054] Note: The separation ratio results were verified using the chi-square test.
[0055] III. Location of the SSRP1 gene
[0056] First, as previously analyzed, the ssrpl mutant is a single-gene recessive mutant. From F2 segregated ears, 15 wild-type kernels (WT) and 134 mutant kernels (Mu) were selected as materials, yielding a total of 149 DNA samples for preliminary localization experiments. Cluster segregation analysis was used for initial localization of the ssrp1 mutant. Twenty mutant DNA samples were selected, with 10 μl of each sample mixed to form a 200 μl mutant pool. Simultaneously, ten wild-type DNA samples were selected, with 20 μl of each sample mixed to form a 200 μl control pool. PCR amplification was performed using over 100 pairs of Indel markers evenly distributed across the 10 maize chromosomes. Each primer pair amplified DNA from both the mutant and control pools, and electrophoresis was performed. Analysis of the electrophoresis results revealed that two pairs of markers, M1 and M19, on the maize chr8 chromosome exhibited biased segregation (both biased towards the mutant background). Next, these two markers were used to examine the segregation of 134 population DNA samples, revealing that the ssrp1 mutant did indeed exhibit partial segregation at chr8. This preliminarily located the mutation site at Chr8.
[0057] To further narrow down the mutation region, we collected 103 more mutants and developed more polymorphic molecular markers, resulting in the following markers: M3, M4, M5, M16, and M18. Statistical results showed two exchanger monoclonal sites at M5 and 12 at M16, thus locating the mutation site within the 2.94-Mb interval between markers M5 and M16. Within this interval, markers M6, M7, M8, M12, and M13 were developed, further narrowing the region to the interval between M12 and M13, a physical distance of 23.89 kb. The results showed only one exchanger monoclonal site at both M12 and M13, and since M12 and M13 are highly linked to the mutation site, the final region was determined to be within the 23.89-kb physical interval between M12 and M13. The fine-tuning results are as follows: Figure 2 As shown.
[0058] Table 2. Molecular marker primer sequences used for gene localization
[0059]
[0060] IV. Cloning of the SSRP1 gene
[0061] Based on maize genome sequencing information, three genes were identified within the 23.89-kb region. Using genomic DNA from normal-sized and smaller kernels as templates, these three genes were amplified and their sequence differences were compared. Only the gene Zm00001d015960 showed a DNA sequence difference between normal-sized and smaller kernels. Compared to normal-sized kernels (AA), smaller kernels (aa) had a small mutation (G to A) at the end of the twelfth intron of the Zm00001d008847 gene. Figure 3 Therefore, it is speculated that the candidate gene Zm00001d015960 is the SSRP1 gene to be cloned.
[0062] Using genomic DNA from the maize inbred line B73 as a template, PCR amplification was performed using primer pair F1 / R1. The sequence of the obtained PCR product is sequence 2 in the sequence listing, which is the sequence of the SSRP1 gene in the maize genome. Total RNA was extracted from the maize inbred line B73, reverse transcribed into cDNA, and amplified by PCR using primer pair F2 / R2. The sequence of the obtained PCR product is sequence 3 in the sequence listing, which is the cDNA sequence of the IPE2 gene. Both sequences 2 and 3 encode the SSRP1 protein shown in sequence 1 of the sequence listing.
[0063] F1: 5'-TCCGTTGTCATCTTAGCTCG-3';
[0064] R1: 5'-CATGCTACTGCACACCGAGG-3'.
[0065] F2: 5'-ATGACGGACGGTCACCACTT-3';
[0066] R2: 5'-CTAGTCAGACTCGTTCCCAG-3'.
[0067] Example 2: Functional verification of the maize kernel size gene SSRP1
[0068] We obtained an independent EMS mutant (EMS4-225ddd) of the Zm00001d008847 gene with a B73 background from the maize EMS-induced mutant library (MEMD: https: / / elabcaas.cn / memd / public / index.html# / ). This mutant is sold by the mutant library MEMD and is publicly available. According to the MEMD website, the EMS4-225ddd mutation site is located on exon 6, 697 bp downstream of ATG, with a C-to-T mutation causing premature termination of translation of the encoded protein, resulting in loss of gene function. This EMS mutant was backcrossed with B73 for three generations and then self-crossed to obtain the BC2F2 mutant material. Statistical analysis of the kernel size phenotype showed that, compared with the wild type, the EMS4-225ddd mutant resulted in a reduction of more than 95% in kernel size. The phenotypic results of the mutant indicate that Zm00001d008847 plays an important role in controlling maize kernel size.
[0069] The specific steps are as follows:
[0070] 1) Identification of SSRP1 mutants
[0071] The SSRP1 mutant genotype was identified using the left primer SSRP1-EMS-F and the right primer SSRP1-EMS-R. A 515 bp band was amplified using SSRP1-EMS-F and SSRP1-EMS-R, and Sanger sequencing was performed. If the sequencing result showed that the base at the mutation site remained unchanged (C), then the single plant was a homozygous wild-type material (AA).
[0072] (SSRP1 wild-type plant); if the sequencing results of the amplified bands of SSRP1-EMS-F and SSRP1-EMS-R show that the mutation site has a base of T, then the plant is a homozygous mutant material aa (SSRP1 homozygous mutant plant); if the sequencing results of the amplified bands of SSRP1-EMS-F and SSRP1-EMS-R show that the mutation site has both G and A, then the plant is a heterozygous mutant material Aa (SSRP1 heterozygous mutant plant).
[0073] Genotype identification primers for mutants:
[0074] SSRP1-EMS-F:AGCTTACTCAATAAGCACTG
[0075] SSRP1-EMS-R:TCCACCAATCCGTAAAAGGAC
[0076] Based on the research results of the above embodiments, it can be seen that: through map-based cloning and other experiments, the SSRP1 gene cloned by the present invention is a gene that controls the size of maize kernels. Its mutation can lead to smaller maize kernels, which can be utilized in the process of maize seed production.
Claims
1. The application of SSRP1 protein, characterized by: To reduce the expression level of SSRP1 protein in the starting plant, thereby reducing the size of the plant seeds; the plant is maize; the SSRP1 protein is a1) or a2): a1) the amino acid sequence of the protein shown in SEQ ID NO: 3; a2) a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO:
3.
2. The application of a nucleic acid molecule encoding the SSRP1 protein of claim 1, characterized in that: The purpose was to reduce the expression level of SSRP1 protein in the starting plant, thereby reducing the size of the plant seeds; the plant in question was maize.
3. The application as described in claim 2, characterized in that: The nucleic acid molecule encoding the SSRP1 protein is a DNA molecule as shown in b1), b2), or b3) below: b1) the coding region is the DNA molecule shown in SEQ ID NO: 2; b2) the nucleotide sequence is the DNA molecule shown in SEQ ID NO: 2; b3) the nucleotide sequence is the DNA molecule shown in SEQ ID NO:
1.
4. A method for cultivating transgenic plants, comprising the following steps: reducing the expression level of the SSRP1 protein as described in claim 1 in a starting plant to obtain a transgenic plant; the transgenic plant has smaller grain size compared to the starting plant; the plant is corn.
5. A plant breeding method, comprising the following steps: reducing the expression level of the SSRP1 protein as described in claim 1 in the starting plant, thereby reducing the grain size; wherein the plant is maize.