A cultivar of enoki mushroom with a fresh, aromatic fruiting body and its MNP molecular identification method and application.
By using spore mutagenesis and MNP molecular fingerprinting to select and breed the enoki mushroom variety 'Shangyan A130', the key gene scaffold1.g1710 was screened out, which solved the problems of homogenization and poor aroma quality of enoki mushroom products, and achieved rich and efficient molecular identification of the fresh aroma flavor.
Patent Information
- Application Number
- CN202411249299.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-06
- Publication Date
- 2026-01-06
- Estimated Expiration
- 2044-09-06
AI Technical Summary
Existing enoki mushroom products suffer from severe homogenization, deteriorating aroma and quality, insufficient flavor richness, and a lack of consumer-oriented improvement measures.
By conducting spore mutagenesis and self-pollination on the parent 'Shangyan No. 1' enoki mushroom at room temperature and pressure, a 'Shangyan A130' enoki mushroom variety with a fresh aroma was obtained. Its MNP molecular fingerprint was constructed, and the key gene scaffold1.g1710 was screened out. Combined with high-throughput transcriptome sequencing and multiplex PCR amplification technology, a high-throughput, multi-target, and multi-sample molecular identification method was established.
This study has enabled the 'Shangyan A130' enoki mushroom variety to develop a rich, fresh aroma, shortened the breeding cycle of new varieties, improved the accuracy and efficiency of molecular identification, and met the diversified needs of the market.
Smart Images

Figure CN119040144B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of enoki mushroom breeding and strain molecular identification technology, specifically involving an enoki mushroom variety with a fresh, aromatic flavor in its fruiting body and its MNP molecular identification method and application. Background Technology
[0002] Enoki mushrooms are among the most popular and widely cultivated edible fungi in East Asia. The pleasant aroma of edible fungi helps enhance consumer appetite. Molecular breeding targeting aroma-regulating genes in edible fungi is a feasible solution to improve their aroma quality. However, traditional industrial cultivation models are primarily producer-oriented, focusing on enoki mushroom yield and disease resistance, while neglecting characteristics such as taste and aroma quality that consumers value. White enoki mushrooms are widely used in factory cultivation due to their high yield, but overly standardized and homogenized cultivation methods have led to a decline in their aroma quality. Therefore, in a consumer-oriented market context, understanding and improving the aroma of enoki mushrooms is particularly important.
[0003] Volatile compounds are the main source of aroma in enoki mushrooms and play an important regulatory role in their life processes. In recent years, research on the aroma of edible fungi has flourished, laying a theoretical foundation for understanding the regulatory genes and mechanisms of aroma in edible fungi. Many studies have reported regulatory genes for the biosynthesis of important C8 compounds in edible fungi; however, the regulatory mechanisms of these genes on the overall aroma of edible fungi remain unclear. Currently, research on volatile compounds that regulate the aroma quality of edible fungi has not been fully conducted. It is necessary to clarify the aromatic compounds responsible for the fresh, green flavor of enoki mushrooms, as well as their regulatory genes and metabolic pathways. This will provide important references for the breeding of new enoki mushroom varieties and the diversification of processed enoki mushroom products, guided by consumer preferences. Summary of the Invention
[0004] The purpose of this invention is to address the current situation where existing white enoki mushroom products suffer from severe homogenization, deterioration in aroma quality, and insufficient flavor richness, by providing an enoki mushroom variety 'Shangyan A130' with a fresh, green aroma in its fruiting body and constructing its MNP molecular fingerprint spectrum.
[0005] The enoki mushroom variety Flammulina filiformis A130 of this invention was deposited on March 15, 2024, at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences, with accession number GDMCC No: 64422.
[0006] The above-mentioned enoki mushroom variety ‘Shangyan A130’ was obtained by self-pollination and selection from the parent enoki mushroom ‘Shangyan No. 1’ (preservation number GDMCC No: 61490) through spore mutagenesis induced by ambient temperature pressure plasma (ARTP).
[0007] The above-mentioned enoki mushroom variety 'Shangyan A130' has a fresh aroma, and the 2-penten-1-ol content in the fruiting body is 3.4681 mg / kg, with an OAV value greater than 1.
[0008] The fruiting bodies of the above-mentioned enoki mushroom variety 'Shangyan A130' were sampled at different growth stages: primordia stage (5d), fruiting body bud stage I (10d), fruiting body bud stage II (15d), fruiting body maturity stage I (20d), fruiting body maturity stage II (25d), and fruiting body harvesting stage (29d). High-throughput transcriptome sequencing was then performed on samples from each of the six growth stages, and nine differentially expressed genes related to flavor were screened. Among them, the scaffold1.g1710 gene is a key gene regulating the fresh and fragrant flavor characteristics of enoki mushroom.
[0009] The MNP molecular fingerprint of the above-mentioned enoki mushroom variety 'Shangyan A130' includes 6 MNP marker sites: SEQ ID NO: 1-12.
[0010] The amplification primers for the MNP molecular fingerprint of the above-mentioned enoki mushroom variety 'Shangyan A130' are as follows: The primers for SEQ ID NO: 1-2 are: forward primer (5->3)ggaattgctcttgctacaggatttt; reverse primer (5->3)tgaacgtgtatatgggctatgtgta.
[0011] The amplification primers for the MNP molecular fingerprint of the above-mentioned enoki mushroom variety 'Shangyan A130' are as follows: The primers for SEQ ID NO: 3-4 are: forward primer (5->3)tttggtatgtatgcggtcaaagaac; reverse primer (5->3)gttacattgaggcattagcggaag.
[0012] The amplification primers for the MNP molecular fingerprint of the above-mentioned enoki mushroom variety 'Shangyan A130' are as follows: The primers for SEQ ID NO: 5-6 are: forward primer (5->3)tcaagaagaagaaaccattgccttc; reverse primer (5->3)cacaagggtatgtggatgaatatttct.
[0013] The amplification primers for the MNP molecular fingerprint of the above-mentioned enoki mushroom variety 'Shangyan A130' are as follows: The primers for SEQ ID NO: 7-8 are: forward primer (5->3) cagcatattggcacatacgtagttt; reverse primer (5->3) atcgttccaagttttacgtaggtca.
[0014] The amplification primers for the MNP molecular fingerprint of the above-mentioned enoki mushroom variety 'Shangyan A130' are as follows: The primers for SEQ ID NO: 9-10 are: forward primer (5->3)gacctctcgctactctcacatttat; reverse primer (5->3)gcgtctgactacgatgaaatttgta.
[0015] The amplification primers for the MNP molecular fingerprint of the above-mentioned enoki mushroom variety 'Shangyan A130' are as follows: The primers for SEQ ID NO: 11-12 are: forward primer (5->3)attcatcaaagatgtgacacccttg; reverse primer (5->3)taatttcgcaaaagattgtatgcgc.
[0016] The beneficial effects of this invention are as follows: First, the fruiting bodies of the *Flammulina velutipes* variety 'Shangyan A130' possess a rich, fresh aroma, enriching the product's commercial characteristics, meeting diversified market demands, and showing promising application and promotion prospects. Second, the key gene scaffold1.g1710, which regulates the fresh aroma characteristic of *Flammulina velutipes*, has been screened. Applying genetic engineering technology and this gene in the breeding of new *Flammulina velutipes* varieties can, to a certain extent, achieve targeted breeding of suitable varieties for sweet-tasting *Flammulina velutipes*, reducing the blindness in the new variety breeding process and shortening the breeding cycle. Third, the MNP molecular fingerprint of the *Flammulina velutipes* variety 'Shangyan A130' integrates multiplex amplification and sequencing technologies, allowing for simultaneous sequence analysis of all marker sites in multiple samples. Compared with molecular markers such as 1SSR, RAPD, and SSR, and fruiting experiments, it has advantages of high throughput, multiple targets, high sensitivity, and high accuracy. The MNP molecular fingerprint of the *Flammulina velutipes* variety 'Shangyan A130' has specificity and particularity for identifying the *Flammulina velutipes* strain 'Shangyan A130'. This technology can serve as a new method for identifying new germplasm of the 'Fragrant' type of enoki mushroom. Attached Figure Description
[0017] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below, wherein:
[0018] Figure 1 Morphological diagrams of the fruiting bodies of 'Shangyan A130', 'Shangyan No. 1', and the main cultivated varieties;
[0019] Figure 2 A diagram of volatile flavor compounds of the fruiting body of 'Shangyan A130'.
[0020] Figure 3 This is a differential gene expression map of 'Shangyan A130' at different growth stages. Detailed Implementation
[0021] To make the above-mentioned objectives, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to specific examples.
[0022] Example 1:
[0023] Breeding and flavor compound determination of enoki mushroom variety 'Shangyan A130':
[0024] From October 2020, spores of 'Shangyan No. 1' were collected. The spores were prepared into a spore suspension and subjected to ARTP mutagenesis. The mutagenized spore suspension was spread on plates, and germinating colonies were picked and examined under a microscope for the presence or absence of clamp connections. Colonies with clamp connections were considered successfully self-crossed strains. In February 2021, preliminary screening of the hybrid progeny was conducted in the laboratory based on colony morphology, growth rate, and mycelial morphology in shake flasks, yielding offspring with excellent performance. In March 2021, small-scale fruiting trials were conducted on the pre-screened strains, selecting strains with faster fruiting rates and higher yields. In June 2021, pilot-scale testing was conducted at Shandong Xuerong Biotechnology Co., Ltd., examining indicators such as yield, production cycle, budding rate, fruiting body morphology, and shelf life. Strain 'A130' exhibited superior and stable characteristics in the cultivation trials. Since 2021, multiple cultivation replication experiments and demonstrations have been conducted on strain 'A130'. Its cultivation characteristics are stable, and it was finally named 'Shangyan A130'.
[0025] The fruiting bodies of the 'Shangyan A130' enoki mushroom variety were pulverized into powder. 5g of the sample was placed in a 20mL headspace vial with a PTFE septum. 10μL of 1,2-o-dichlorobenzene (100mg / L, solvent: acetone) and 3mL of saturated sodium chloride solution were added to the headspace vial. The extraction head was inserted into the headspace vial, and after equilibration at 55℃ for 3min, extraction was performed for 50min. After extraction, the extraction head was desorbed for 5min in splitless mode at an inlet temperature of 250℃. 30g of the sample was then added to 300μL of 1,2-o-dichlorobenzene, followed by 300mL of dichloromethane. Extraction was repeated three times at room temperature using a magnetic stirrer, each time for 1h. The organic phases from the three extractions were filtered and collected. The filtrate was concentrated to 100mL using a rotary evaporator at a water bath temperature of 40℃. Volatile compounds were extracted using a SAFE apparatus at 40℃ and a vacuum pressure of 5×10⁻⁶. 15mbar. Anhydrous sodium sulfate was added to the distillate for dehydration and drying, followed by filtration. The solution was then concentrated to 5 mL by rotary evaporation. Finally, the extract was concentrated to 0.5 mL by nitrogen blowing, sealed, and stored at -20°C.
[0026] Gas chromatography (GC) conditions: HP-in-Nanowax column (60m × 0.25mm × 0.25μm); carrier gas: high-purity helium (99.999%), flow rate: 1.0mL / min; injection port temperature: 250℃, splitless mode; temperature program: initial oven temperature 40℃, hold for 3 min; increase to 100℃ at 5℃ / min, hold for 5 min; finally increase to 210℃ at 3℃ / min, hold for 5 min. Mass spectrometry (MS) conditions: EI ion source mode, voltage: 70eV, ion source temperature: 230℃; full scan mode, scan range: m / z = 30–450, solvent delay: 5 min.
[0027] Compounds were identified by searching the NIST20.L, NIST11.L, and Wiley7n.L spectral libraries. Retention times of C7-C30 n-alkanes were collected, and the retention index (RI) of volatiles was calculated. The RI was compared with that of columns of the same type and parameters in the reference for qualitative identification.
[0028] Fifteen volatile compounds were identified in the fruiting bodies of the 'Shangyan A130' enoki mushroom variety, including: 2-ethylhexanol, 3,7-dimethyl-1-octanol, 3-octanol, 1-octen-3-ol, 2-pentanol, 2,4-decadienol, octanol, 2-penten-1-ol, octanal, 2-undecenal, 4-decenal, 3-octanone, ethyl acetate, isoamyl isobutyrate, and ethyl oleate. Among these, 2-penten-1-ol, the most abundant volatile compound in 'Shangyan A130', had an odor threshold of 3.4681 mg / kg and an OAV value of 4817, significantly greater than 1. It is a key aroma compound unique to 'Shangyan A130', contributing a prominent fresh, green aroma and serving as a potential characteristic aroma marker.
[0029] Example 2:
[0030] Screening of key genes related to the fresh aroma flavor in the enoki mushroom cultivar 'Shangyan A130':
[0031] Six different growth stages of the enoki mushroom variety 'Shangyan A130' were sampled: primordia stage (5 days), fruiting body bud stage I (10 days), fruiting body bud stage II (15 days), fruiting body maturity stage I (20 days), fruiting body maturity stage II (25 days), and fruiting body harvesting stage (29 days). Samples were then flash-frozen in liquid nitrogen and stored at -80℃. [The text then abruptly shifts to a different topic:] ...using... Total RNA was extracted using reagents, and DNase I was used to remove interference from genomic DNA. 1 μg of total RNA was used to construct libraries using the Trussq™ RNA Sample Preparation Kit. After quality control, the libraries were quantified using a TBS380 microfluorometer and then subjected to paired-end sequencing (150 bp * 2) using a NovaSeq 6000 sequencing platform. The raw sequencing data was filtered after sequencing to obtain high-quality sequencing data. Differential expression analysis was performed using edgeR software with R statistical package 3.6.3, and GO functional enrichment and KEGG pathway analysis were performed using Goatools software to screen for the key gene scaffold1.g1710 associated with the green aroma flavor.
[0032] Example 3:
[0033] Construction of the MNP molecular fingerprint of the enoki mushroom variety 'Shangyan A130':
[0034] (1) Mycelial culture: The *Flammulina velutipes* strain 'Shangyan A130' was transferred to potato dextrose agar (PDA) medium and cultured at 19°C for 7 days. Mycelia were then collected.
[0035] (2) Genomic DNA extraction: Genomic DNA was extracted from the hyphae using a kit. The purity of the DNA in the sample was determined using a spectrophotometer. 1 μL of DNA from the sample was taken and the concentration was determined using a Qubit fluorescence quantitative analyzer. The concentration of the sample DNA was adjusted to be between 30 ng / μL and 50 ng / μL.
[0036] (3) Multiplex polymerase chain reaction (PCR): The MNP marker sites of the extracted 'Shangyan A130' sample of 'Flammulina velutipes' were amplified by multiplex PCR to obtain multiplex PCR amplification products.
[0037] The PCR amplification system consisted of a total volume of 30 μL, including: 4 μL primer set (0.2 μM concentration per primer), 4 μL (20 ng / μL to 30 ng / μL) of sample DNA to be tested, 10 μL of GenoPlexs 3×T Master Mix (manufacturer: Shijiazhuang Borui Biotechnology Co., Ltd.), and 12 μL of ddH2O. The mixture was shaken and mixed to obtain the solution for multiplex PCR amplification.
[0038] PCR amplification reaction program: 95℃ for 3 min; (95℃ for 20 s, 60℃ for 4 min) × 15 cycles; 72℃ for 4 min; store at 10℃. The multiplex PCR amplification products were purified.
[0039] (4) Construction of high-throughput sequencing libraries and sequencing: Perform high-throughput sequencing on the high-throughput sequencing libraries obtained from multiplex PCR amplification according to the operating instructions of the high-throughput sequencing kit and high-throughput sequencer. The average coverage of the high-throughput sequencing was set to be greater than 700-fold, and the sequencing length was not less than 300 bp.
[0040] Add 10 μL GenoPlexs 3×T Master Mix, 2 μL 5 μM P5 primer, 2 μL 5 μM P7 barcode primer (the primers contain the sample barcode) and 16 μL ddH2O to the multiplex PCR amplification product, vortex to mix and centrifuge briefly.
[0041] PCR amplification program: 95℃ for 3 min; (95℃ for 15 s, 58℃ for 15 s, 70℃ for 30 s) × 8 cycles; 72℃ for 5 min; store at 10℃. The sequencing library was then purified.
[0042] High-throughput sequencing was performed using an Illumina Next Seq550 sequencer to sequence the library and obtain sequencing data for the sample to be tested. For detailed sequencing steps, please refer to the instruction manual of the sequencer.
[0043] (5) Data alignment: The sequencing data of *Flammulina velutipes* strain 'Shangyan A130' were homologously aligned to the DNA sequences of MNP marker sites on the *Flammulina velutipes* reference genome, and the average coverage fold of the detected marker sites was statistically analyzed. The genotypes of the detected MNP marker sites were recorded as all detected alleles of that site. Among them, the detected alleles refer to the detected DNA fragment consisting of the first to the last base of the marker, and different detected alleles are separated by " / ".
[0044] Using Bowtie2 (version 2.1.0) software, the sequencing data of the samples to be tested were aligned to the reference genome of *Flammulina velutipes* to obtain the DNA sequence of the MNP marker for each sample. The alignment results were saved in SAM (The Sequence Alignment / Map format).
[0045] Table 1. List of 14 MNP marker sites and primer information for the 'Shangyan A130' enoki mushroom variety.
[0046]
[0047] (6) Calculation of genetic similarity: Based on the principle that different strains of *Flammulina velutipes* are considered to have a difference if there is at least one SNP difference in the alleles of the same MNP marker locus, the number of differentially expressed MNP markers in pairwise comparisons of different *Flammulina velutipes* strains was counted, and marker loci that can significantly distinguish any *Flammulina velutipes* strain were screened based on the differentially expressed MNP marker loci. When the genetic similarity (GS) between the test sample and the control sample is less than 96%, it is determined to be "different strains".
[0048] Genetic similarity GS = n / N × 100%, where N is the number of MNP loci jointly amplified by the test strain and the 'Shangyan A130' variety, and n is the number of MNP loci with the same genotype among the MNP loci jointly amplified by the test strain and the 'Shangyan A130' variety.
[0049] Table 2. Genetic similarity (GS) between the *Flammulina velutipes* cultivar 'Shangyan A130' and other *Flammulina velutipes* strains.
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061] As shown in Table 2, the genetic similarity between the 'Shangyan A130' 'Flammulina velutipes' strain and 227 other 'Flammulina velutipes' strains ranged from 94.50% to 0%, indicating that the genetic differences between the 'Shangyan A130' 'Flammulina velutipes' strain and other 'Flammulina velutipes' strains are relatively large. The 'Shangyan A130' 'Flammulina velutipes' strain can be effectively identified by this MNP marker locus.
[0062] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. A type of enoki mushroom with a fresh, fragrant flavor in its fruiting body. Flammulina filiformis The strain is characterized by: The enoki mushroom ( Flammulina filiformis The strain has the accession number GDMCC No: 64422 and was deposited at the Guangdong Provincial Center for Microbial Culture Collection on March 15, 2024.
2. The fruiting body of claim 1 having a green, earthy flavor of a mushroom (Flammulina velutipes) strain, characterized by: Flammulina filiformis The enoki mushroom ( Flammulina filiformis The fruiting body of the strain contains 3.4681 mg / kg of 2-penten-1-ol and has an OAV value greater than 1. The 2-penten-1-ol has a green aroma. 3. The enoki mushroom with a fresh, fragrant flavor as described in claim 1. Flammulina filiformis Application of strains in food processing.
4. The fruiting body of claim 1 having a green flavor of the mushroom (Flammulina velutipes) strain of claim Flammulina filiformis ) MNP molecule identification method, characterized by: The MNP molecular identification is performed by using 6 pairs of MNP marker primers shown in SEQ ID NO: 1-12.
5. The fruiting body of claim 4 having a green flavor of the mushroom (Flammulina velutipes) Flammulina filiformis ) MNP molecule identification method of the strain, characterized by: When the fungal species to be identified is similar to the enoki mushroom described in claim 1 ( Flammulina filiformis When the genetic similarity (GS) between strains is greater than or equal to 96%, they are identified as the same strain.
6. The fruiting body of claim 5 having a green flavor of the mushroom (Flammulina velutipes) Flammulina filiformis ) strain having a MNP molecule, characterized by: The MNP molecular identification comprises performing PCR amplification on the to-be-tested Flammulina velutipes strains by using 6 pairs of MNP marker primers shown in SEQ ID NO: 1-12, and performing sequencing on the amplification products.
7. The fruiting body of claim 6 having a green flavor of the mushroom (Flammulina velutipes) Flammulina filiformis ) strain having a MNP molecule identified by the method, characterized by: Genetic similarity GS = n / N x 100%, wherein N is the number of MNP sites amplified from the strain of claim 1 and the strain of Flammulina velutipes to be tested, and n is the number of MNP sites with the same genotype among the MNP sites amplified from the strain of claim 1 and the strain of Flammulina velutipes to be tested. Flammulina filiformis Genetic similarity GS = n / N x 100%, wherein N is the number of MNP sites amplified from the strain of claim 1 and the strain of Flammulina velutipes to be tested, and n is the number of MNP sites with the same genotype among the MNP sites amplified from the strain of claim 1 and the strain of Flammulina velutipes to be tested. Flammulina filiformis Genetic similarity GS = n / N x 100%, wherein N is the number of MNP sites amplified from the strain 8. Application of the MNP molecular identification method according to claim 5 in Flammulina velutipes strain identification.
Citation Information
Patent Citations
Flammulina velutipes SSR molecular marker and corresponding primers and application thereof
CN105316329A
Flammulina velutipes Shangyan No.2 strain as well as identification method, construction method and application of SSR marker fingerprint spectrum thereof
CN112760238A