A basic xylanase mutant

Abstract

The present application relates to the field of genetic engineering and protein modification technology, and particularly relates to a novel basic xylanase mutant. The present application is based on wild-type xylanase H1, and provides a mutant containing at least one of the following mutation sites: Q24P, S38V / K / W / H / T / I, G40M / R / K / F / H, D41P, N56L / I / P / K, A57E / D / Y, A59K / R / I / M / H, H61F / Y, A75S, T80M, T103I, T107E, T114Y, D129L, Q132R / M, D135M, N143D, K144R, T149L, Q151N / Y, C154N, D157E, A160E, N165D, V166I, N167S / W, T177V, D192E. The tolerance of the mutant to high temperature and alkaline environment is significantly improved, which is beneficial to its wide application in the field of papermaking.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and protein engineering technology, specifically to a basic xylanase mutant. Background Technology

[0002] The papermaking industry has always been a heavily polluting sector. In recent years, with my country's increasing emphasis on environmental protection and strengthened pollution control efforts, the requirements for pulp and paper processes have become increasingly stringent. Both production process improvements and the addition of papermaking additives are moving towards green and environmentally friendly directions. The application of bio-enzymes in the pulp and paper industry is becoming increasingly widespread, appearing at various stages of the process, such as cooking, bleaching, beating, waste paper deinking, and adhesive control. Research on the application of bio-enzymes in pulp bleaching has been a hot topic in papermaking in recent years. Adding bio-enzymes during the bleaching process can reduce the amount of chemical bleaching agents used, improve the brightness of the bleached pulp, reduce the content of ionic waste in bleaching waste liquor, and improve the white water recycling rate. Commonly used enzyme preparations in pulp bleaching include xylanase and laccase.

[0003] In a broad sense, xylanase refers to a complex enzyme system capable of degrading hemicellulose xylan, which is abundant in nature, especially in plant fibers. This includes β-1,4-endoxylanase, β-xylosidase, and α-L-arabinosidase. In a narrower sense, xylanase primarily refers to β-1,4-endoxylanase. β-1,4-endoxylanase mainly acts on the β-1,4-glycosidic bonds in the xylan molecule, cleaving these bonds to degrade xylan into smaller molecules such as xylooligosaccharides, xylobiose, and trace amounts of xylose and arabinose. β-xylosidase and α-L-arabinosidase further degrade xylooligosaccharides into monosaccharides, thus completely degrading xylan into monosaccharides.

[0004] Xylanase has a wide range of sources; it can be produced by animals, plants, and microorganisms in nature. Microorganisms are the most widespread source of xylanase, and current screening studies for xylanase mostly focus on microorganisms, primarily bacteria and fungi. Studies have shown that bacteria secrete both acidic and alkaline xylanases, while fungi secrete only alkaline xylanases. Therefore, strains can be screened based on the specific application requirements of xylanase. Currently, xylanase production is mainly achieved through fermentation of bacteria and fungi.

[0005] Xylanase is currently widely used in the pulp and paper industry, most notably as a bleaching aid in the bleaching stage. Numerous studies have found that xylanase pretreatment can improve pulp bleaching performance and increase the brightness of the bleached pulp. Garg et al. treated pulp with xylanase derived from Bacillus stearothermophilus SDX at 60°C for 120 min, finding a 4.75% increase in pulp brightness. Furthermore, many pulp mills both domestically and internationally have found that adding xylanase before the bleaching stage can reduce chemical pulp bleaching costs while achieving the desired brightness, decreasing the bleaching load by approximately 5% to 20%.

[0006] However, since the pulp bleaching environment in actual production is mostly high-temperature and alkaline, ordinary xylanases are difficult to survive and function effectively. Therefore, it is necessary to develop xylanases with temperature and alkali resistance. This invention uses protein engineering to prepare xylanases with temperature and alkali resistance, which can be widely used in the papermaking industry. Summary of the Invention

[0007] The purpose of this invention is to provide a novel alkaline xylanase mutant. The mutant exhibits significantly improved heat resistance, which is beneficial for its widespread application in the papermaking industry.

[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0009] This invention relates to a xylanase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:1, and comprising, compared with SEQ ID NO:1, an amino acid substitution at at least one position selected from the group consisting of: 24, 38, 40, 41, 56, 57, 59, 61, 75, 80, 103, 107, 114, 129, 132, 135, 143, 144, 149, 151, 154, 157, 160, 165, 166, 167, 177, 192.

[0010] In some embodiments of the present invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:1.

[0011] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:1.

[0012] In some embodiments of the present invention, the mutant comprises a substitution of at least one amino acid from the following group: Q24P, S38V / K / W / H / T / I, G40M / R / K / F / H, D41P, N56L / I / P / K, A57E / D / Y, A59K / R / I / M / H, H61F / Y, A75S, T80M, T103I, T107E, T114Y, D129L, Q132R / M, D135M, N143D, K144R, T149L, Q151N / Y, C154N, D157E, A160E, N165D, V166I, N167S / W, T177V, D192E.

[0013] The present invention also relates to DNA molecules encoding the above-mentioned xylanase mutants.

[0014] The present invention also relates to recombinant expression vectors comprising the above-described DNA molecules.

[0015] The present invention also relates to a host cell comprising the above-described recombinant expression vector.

[0016] When the above plasmids were transferred into host cells, the heat resistance and alkali resistance of the recombinant xylanase mutant were significantly improved.

[0017] In some embodiments of the present invention, the host cell is Pichia pastoris (Pichia pastoris). Pichia pastoris ).

[0018] In some embodiments of the present invention, the host cell is *Trichoderma reesei* (…). Trichoderma reesei ).

[0019] The present invention also provides the application of the above-mentioned xylanase mutant in the field of papermaking.

[0020] Based on wild-type xylanase H1, this invention provides mutants containing at least one mutation site among Q24P, S38V / K / W / H / T / I, G40M / R / K / F / H, D41P, N56L / I / P / K, A57E / D / Y, A59K / R / I / M / H, H61F / Y, A75S, T80M, T103I, T107E, T114Y, D129L, Q132R / M, D135M, N143D, K144R, T149L, Q151N / Y, C154N, D157E, A160E, N165D, V166I, N167S / W, T177V, and D192E. Compared with wild-type xylanase H1, the single-point mutants provided by this invention generally exhibit a 12.2%-71.4% increase in relative enzyme activity at 75°C. Among them, the mutants containing single points S38T, S38W, D41P, and T177V all show relative enzyme activities exceeding 80% at 75°C, far surpassing wild-type xylanase H1, achieving unexpected technical results.

[0021] After treatment at pH 9.0-11.0 for 2 hours, the residual enzyme activity of wild-type xylanase H1 and its single-point mutant was generally higher than 91%, with almost no loss of enzyme activity.

[0022] After treatment at pH 12.0 for 2 hours, the residual enzyme activity of wild-type xylanase H1 was only 45.06%, while the residual enzyme activity of single-point mutants of xylanase was as high as 61.51-93.29%, especially the residual enzyme activity of mutants containing single points S38T, S38W, D41P, and T177V, which were as high as 90.6%, 92.33%, 93.11%, and 93.29%, respectively. This demonstrates that the single-point mutants provided by this invention have significantly improved tolerance to alkaline environments, achieving unexpected technical effects.

[0023] In summary, the xylanase mutant provided by this invention exhibits significantly improved tolerance to high temperature and alkaline environments, thereby facilitating the widespread application of xylanase in the papermaking industry. Detailed Implementation

[0024] This invention discloses a xylanase mutant, its preparation method and application, the DNA molecule encoding the xylanase mutant, the vector, and the host cell. Those skilled in the art can refer to the content herein and appropriately modify the process parameters to achieve the desired result. The method and application of this invention have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0025] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECULAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENTPROTOCOLS IN MOLECULAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can use other conventional methods, experimental protocols, and reagents based on the technical solutions described in this invention, without being limited to the specific embodiments of this invention. For example, the following experimental materials and reagents may be used in this invention:

[0026] Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vector pPIC9k, Amp, and G418 were all purchased from Invitrogen.

[0027] Enzymes and kits: PCR enzymes and ligases were purchased from Takara, restriction endonucleases from Fermentas, plasmid extraction kits and gel purification and recovery kits from Omega, and GeneMorph II random mutagenesis kits from Beijing Bomais Biotechnology Co., Ltd.

[0028] Culture medium formulation:

[0029] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;

[0030] Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

[0031] Yeast selection medium (MD medium): 2% peptone, 2% agarose;

[0032] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10⁻⁶ -5 1% Biotin, 1% Glycerin;

[0033] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10⁻⁶ -5 % Biotin, 0.5% Methanol;

[0034] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;

[0035] LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0;

[0036] Upper culture medium: 0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose;

[0037] Lower culture medium plates: 2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, 1.5% agar.

[0038] The present invention will be further illustrated below with reference to the embodiments:

[0039] Example 1 Construction of recombinant plasmid

[0040] The source of Paecilomyces ( Paecilomyces. sp The xylanase gene (GeneBank ACS26244.1) of *Pichia pastoris* was optimized based on codon bias, with the addition of 6 bases GAATTC (EcoRI cleavage site) before the start codon ATG and GCGGCCGC (Not I cleavage site) after the stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Biotechnology Co., Ltd. This xylanase was named H1, with its amino acid sequence SEQ ID NO: 1 and encoding nucleotide sequence SEQ ID NO: 2.

[0041] The xylanase gene was digested with restriction endonucleases EcoRI and Not I (Fermentas); simultaneously, the plasmid pPIC9K was digested with the same restriction endonucleases. The digestion products were purified using a gel purification kit, and the two digestion products were ligated using T4 DNA ligase (Fermentas). The ligation products were transformed into DH5α *E. coli* (Invitrogen) and selected using ampicillin. To ensure accuracy, several clones were sequenced.

[0042] The plasmid was purified from the correctly sequenced E. coli clone using the Plasmid Mini-Preparation Kit (Omega) to obtain one recombinant plasmid, which was named pPIC9K-H1.

[0043] Example 2: Screening of high-temperature and alkali-resistant mutants

[0044] To further improve the tolerance of xylanase H1 to high temperature and alkaline conditions, the applicant conducted protein structure analysis. This protein belongs to the GH11 family of xylanases, with a β-jelly roll structure. Both the protein surface and the active site are exposed to the external environment. Therefore, it is believed that changes in the external environment, especially high temperature or strong acid / alkaline environments, can directly affect both the stability of the enzyme's surface structure and the stability of its active site. Thus, to improve the enzyme's tolerance to the environment, it is necessary to increase the overall rigidity of the protein and stabilize its overall structure. Without disrupting the protein's secondary structure and active site, the gene was further mutated.

[0045] 1.1 Design of PCR primers H1-F1 and H1-R1:

[0046] H1-F1: GGC GAATTC ATGATGATTGGTATCACTTCTTTTGC (The underlined part is the EcoRI restriction enzyme recognition site).

[0047] H1-R1: ATA GCGGCCGC TTAACCGACGTCTGCAACGGTAATTC (The underlined part is the NotI restriction enzyme recognition site).

[0048] Using the H1 gene (SEQ ID NO: 1) as a template, PCR amplification was performed using the above primers with the GeneMorph II random mutagenesis PCR kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and then ligated into the pET21a vector digested with the same enzymes. The ligation product was then transformed into Escherichia coli BL21(DE3), plated on LB+Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one into a 96-well plate with a toothpick. 150 μL of LB+Amp medium containing 0.1 mM IPTG was added to each well. The plate was incubated at 37°C and 220 rpm for about 6 h. After centrifugation, the supernatant was discarded, and the cells were resuspended in buffer. The cells were repeatedly frozen and thawed to break up the cell walls and obtain E. coli cell lysate containing xylanase.

[0049] Three lysis buffers were prepared and treated as follows: the first and second lysis buffers were diluted with pH 8.0 buffer; the third lysis buffer was treated with preheated pH 10.0 0.05M borax-0.2M sodium hydroxide buffer at 37°C for 2 hours, and then diluted with buffer. 30 μL of each of the above-treated lysis buffers were placed in three new 96-well plates, and 30 μL of substrate prepared with the corresponding buffer was added to each well. The first and third lysis buffers were incubated at 50°C for 30 min, and the second lysis buffer was incubated at 75°C for 30 min. The reducing sugars produced were then measured using the DNS method. The enzyme activity levels of different mutants were calculated.

[0050] Experimental results showed that different mutants retained different activities. Some mutations still exhibited high enzyme activity under high-temperature reaction conditions and strong alkaline treatment conditions, while others even worsened their tolerance. Additionally, some mutations, although improving xylanase tolerance, significantly altered its enzymatic properties, which did not meet the requirements. Ultimately, the applicant screened and obtained mutation sites that could significantly improve xylanase tolerance without significantly affecting its enzyme activity and original enzymatic properties: Q24P, S38V, S38K, S38W, S38H, S38T, S38I, G40M, G40R, G40K, G40F, G40H, D41P, N56L, N56I, N56P, N56K, A57E, A57D, A57Y, A59K, A59R, A5 9I, A59M, A59H, H61F, H61Y, A75S, T80M, T103I, T107E, T114Y, D129L, Q132R, Q132M, D135M, N143 D, K144R, T149L, Q151N, Q151Y, C154N, D157E, A160E, N165D, V166I, N167S, N167W, T177V, D192E.

[0051] Based on wild-type xylanase H1, this invention provides mutants containing the above-mentioned single mutation sites.

[0052] Referring to the amino acid sequence of the mutant, the encoding nucleotide sequence of the xylanase mutant was obtained.

[0053] Example 3 Expression of xylanase in Pichia pastoris

[0054] 3.1 Construction of expression vector

[0055] Based on the codon preference of Pichia pastoris, the gene sequences of xylanase H1 and its mutants were optimized and synthesized by Shanghai Jereh Biotechnology Co., Ltd., with EcoRI and NotI restriction sites added at the 5' and 3' ends of the synthesized sequences, respectively.

[0056] Following the method described in Example 1, the gene sequences of the synthesized xylanase H1 and its mutants were double-digested with EcoRI and NotI, respectively, and then ligated with the pPIC-9K vector digested with the same enzymes overnight at 16°C. The ligation was then performed on E. coli DH5α, plated on LB+Amp plates, and incubated upside down at 37°C. After the transformants appeared, colony PCR was performed (reaction system: single clones picked from the template, rTaq DNA polymerase 0.5 μL, 10× Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5' AOX primer (10 mM): 0.5 μL, 3' AOX primer: 0.5 μL, ddH2O 14.5 μL, reaction program: 95°C pre-denaturation for 5 min, 30 cycles: 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 72°C for 10 min). The positive clone was verified, and the correct recombinant expression plasmid was obtained after sequencing.

[0057] 3.2 Construction of Pichia pastoris engineered strains

[0058] 3.2.1 Preparation of competent yeast cells

[0059] Pichia pastoris strain GS115 was activated on YPD plates and cultured at 30℃ for 48 h. Activated GS115 single clones were then inoculated into 6 mL of YPD liquid medium and cultured at 30℃ and 220 rpm for approximately 12 h. The culture was then transferred to Erlenmeyer flasks containing 30 mL of YPD liquid medium and cultured at 30℃ and 220 rpm for approximately 5 h. Cell density was measured using a UV spectrophotometer. Once the OD600 value was within the range of 1.1–1.3, 4 mL of cells were collected by centrifugation at 4℃ and 9000 rpm for 2 min, and transferred to sterile EP tubes. The supernatant was gently discarded, and the remaining supernatant was blotted dry with sterile filter paper. The cells were resuspended in 1 mL of pre-cooled sterile water, centrifuged at 4℃ and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were washed once more with 1 mL of sterile water, centrifuged at 4℃ and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were then resuspended in 1 mL of pre-cooled sorbitol (1... Resuspend the bacterial cells in sorbitol (1 mol / L); centrifuge at 4℃ and 9000 rpm for 2 min, gently discard the supernatant, and gently resuspend the bacterial cells in 100-150 μl of pre-cooled sorbitol (1 mol / L).

[0060] 3.2.2 Conversion and Screening

[0061] The recombinant expression plasmids constructed in 3.1 were linearized with Sac I. After purification and recovery of the linearized fragments, they were transformed into Pichia pastoris GS115 by electroporation. Recombinant Pichia pastoris strains were screened on MD plates, and multi-copy transformants were then screened on YPD plates (0.5 mg / mL-8 mg / mL) containing different concentrations of genimycin.

[0062] The obtained transformants were transferred to BMGY medium and cultured at 30℃ and 250 rpm for 1 day with shaking. They were then transferred to BMMY medium and cultured at 30℃ and 250 rpm with shaking. 0.5% methanol was added daily to induce expression for 4 days. The cells were removed by centrifugation at 9000 rpm for 10 min to obtain fermentation supernatants containing xylanase H1 and xylanase mutant, respectively.

[0063] (1) Definition of xylanase enzyme activity unit

[0064] Under conditions of 50℃ and pH 8.0, the amount of enzyme required to degrade and release 1 μmol of reducing sugar per minute from a xylan solution with a concentration of 5 mg / ml is defined as one unit of enzyme activity, denoted by U.

[0065] (2) Method for determining xylanase activity

[0066] Take 10.0 ml of xylan solution and equilibrate at 50°C for 20 min.

[0067] Take 10.0 ml of appropriately diluted enzyme solution and equilibrate at 50°C for 5 min.

[0068] Blank sample determination: Pipette 2.00 ml of appropriately diluted enzyme solution (equilibrated at 50℃) into a graduated test tube, add 5 ml of DNS reagent, and vibrate electromagnetically for 3 s. Then add 2.0 ml of xylan solution, equilibrate at 50℃ for 30 min, and heat in a boiling water bath for 5 min. Cool to room temperature with tap water, add water to a final volume of 25 ml, and vibrate electromagnetically for 3-5 s. Using the standard blank sample as a blank control, measure the absorbance A at 540 nm. B .

[0069] Sample determination: Pipette 2.00 ml of appropriately diluted enzyme solution (equilibrated at 50℃) into a graduated test tube, then add 2.0 ml of xylan solution (equilibrated at 50℃), vibrate electromagnetically for 3 s, and precisely incubate at 50℃ for 30 min. Add 5.0 ml of DNS reagent, vibrate electromagnetically for 3 s to terminate the enzymatic reaction. Heat in a boiling water bath for 5 min, cool to room temperature with tap water, and dilute to 25 ml with water, vibrating electromagnetically for 3 s. Using a standard blank sample as a blank control, measure the absorbance A at 540 nm. E .

[0070]

[0071] In the formula:

[0072] X D — Xylanase activity in the sample dilution, U / ml;

[0073] A E —Absorbance of the enzyme reaction solution;

[0074] A B —Absorbance of the enzyme blank sample;

[0075] K—the slope of the standard curve;

[0076] C O —The intercept of the standard curve;

[0077] M—The molar mass of xylose, M(C5XYN110O5) = 150.2 g / mol;

[0078] t—Enzymatic hydrolysis reaction time, min;

[0079] 1000 — conversion factor, 1 mmol = 1000 μmol;

[0080] X D The value should be between 0.04 and 0.10 U / ml. If it is not within this range, the enzyme dilution should be changed and the analysis should be performed again.

[0081] X = X D ·D f (2)

[0082] X—Xylanase activity in the sample, U / ml;

[0083] Df—Dilution factor of the sample.

[0084] (3) Measurement results

[0085] Enzyme activity was detected using the above method, and the results showed that the enzyme activity of the fermentation supernatant of the recombinant Pichia pastoris strain expressing xylanase H1 and its mutant was 310-550 U / mL.

[0086] Example 4 Expression of xylanase in Trichoderma reesei

[0087] First, based on the codon preference of Trichoderma, the gene sequences of xylanase H1 and its mutants were optimized. The optimized gene sequences were synthesized by Shanghai Jierui Biotechnology Co., Ltd., and two restriction enzyme sites, KpnI and MluI, were added to the 5' and 3' ends of the synthesized sequences, respectively.

[0088] 4.1 Construction of expression vector

[0089] The synthesized xylanase gene fragment and the pSC1G vector were digested with restriction endonucleases KpnI and MluI (Fermentas), respectively. The digestion products were purified using a gel purification kit, and the xylanase gene and pSC1G vector digestion products were ligated using T4 DNA ligase (Fermentas) and transformed into E. coli Trans5α (Transgen). Selection was performed using ampicillin, and the clones were sequenced (Invitrogen) for verification. After successful sequencing, recombinant plasmids containing the xylanase gene were obtained.

[0090] 4.2 Construction of recombinant Trichoderma reesei strains

[0091] (1) Preparation of protoplasts

[0092] Take the host fungus Trichoderma reesei ( Trichoderma reesei UE spore suspension was inoculated onto PDA plates and cultured at 30℃ for 6 days. After abundant sporulation, colonies of about 1cm×1cm were cut and placed in liquid medium containing 120 mL YEG+U (0.5% yeast powder, 1% glucose, 0.1% uridine) and cultured at 30℃ with shaking at 220 rpm for 14~16 h.

[0093] Mycelia were collected by filtration through sterile gauze and washed once with sterile water. The mycelia were placed in an Erlenmeyer flask containing 20 mL of 10 mg / mL lysin solution (Sigma L1412) and incubated at 30 °C and 90 rpm for 1-2 h. The progress of protoplast transformation was detected by microscopic observation.

[0094] Add 20 mL of pre-chilled 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl2) to the Erlenmeyer flask, gently mix, filter through sterile Miracloth filter cloth, collect the filtrate, centrifuge at 3000 rpm, 4℃ for 10 min; discard the supernatant, add 5 mL of pre-chilled 1.2 M sorbitol solution to resuspend the bacterial cells, centrifuge at 3000 rpm, 4℃ for 10 min; discard the supernatant, add an appropriate amount of pre-chilled 1.2 M sorbitol to resuspend and dispense (200 μL / tube, protoplast concentration 10). 8 (units / mL).

[0095] (2) Transformation of expression carriers

[0096] All the following operations were performed on ice. 10 μg of the recombinant plasmid constructed above was added to a 7 mL sterile centrifuge tube containing 200 μL of protoplast solution. Then, 50 μL of 25% PEG (25% PEG, 50 mM Tris-Cl, 50 mM CaCl2) was added, the bottom of the tube was gently tapped to mix, and the mixture was placed on ice for 20 min. Next, 2 mL of 25% PEG was added, mixed, and the mixture was placed at room temperature for 5 min. Then, 4 mL of 1.2 M sorbitol was added, gently mixed, and poured into the melted upper culture medium maintained at 55℃. After gently mixing, the mixture was spread onto the prepared lower culture medium plate and incubated at 30℃ for 5–7 days until transformants appeared. The transformed transformants were then transferred to the lower culture medium plate for re-screening; strains with smoother colony edges were considered positive transformants.

[0097] Following the above method, the applicant constructed recombinant Trichoderma reesei engineered strains expressing xylanase H1 and its mutants.

[0098] (3) Fermentation verification and enzyme activity assay

[0099] The engineered Trichoderma reesei strains constructed above were inoculated onto PDA solid plates and incubated upside down in a 30℃ incubator for 6-7 days until spores were abundant. Two 1cm diameter mycelial blocks were then inoculated into 250mL Erlenmeyer flasks containing 50mL of fermentation medium (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH4)2SO4, 0.09% MgSO4, 2% KH2PO4, 0.04% CaCl2, 0.018% Tween-80, 0.018% trace elements). The flasks were incubated at 30℃ for 48 hours, followed by incubation at 25℃ for 48 hours. The fermentation broth was centrifuged to obtain fermentation supernatants containing xylanase H1 and its mutant, respectively.

[0100] Enzyme activity was detected using the above method. The results showed that the enzyme activity of the fermentation supernatant of the recombinant Trichoderma recombinant strain expressing xylanase H1 and its mutant was 300-500 U / mL.

[0101] Example 5: Heat resistance analysis of xylanase mutants

[0102] The fermentation supernatant of the above recombinant strain was diluted 10-fold with 0.1M disodium hydrogen phosphate-0.05M citrate buffer, and the xylanase activity of the diluted supernatant was measured at two temperatures: 50℃ and 75℃. The enzyme activity at 50℃ was taken as 100%, and the relative enzyme activity at 75℃ was calculated. The specific results are shown in Table 1.

[0103] Relative enzyme activity (%) = enzyme activity of sample at 75℃ / enzyme activity of sample at 50℃ × 100%.

[0104] Table 1. Relative enzyme activity levels of xylanase H1 and its mutants at 75℃.

[0105] Xylanase and single point mutants thereof 75°C / 50°C relative enzyme activity (%) Wild type H1 49% Q24P 56% S38T 84% N56I 68% G40M 56% G40R 58% G40K 55% G40F 59% G40H 60% S38V 69% S38K 68% S38W 82% S38H 68% S38T 62% S38I 69% D41P 84% N56L 59% N56I 68% N56P 59% N56K 60% A57E 61% A57D 59% A57Y 68% A59K 64% A59R 62% A59I 72% A59M 71% A59H 59% H61F 56% H61Y 67% A75S 67% T80M 65% T103I 57% T107E 67% T114Y 58% Q132M 59% Q132R 55% D135M 72% N143D 64% K144R 60% T149L 55% Q151N 62% Q151Y 69% C154N 56% D157E 56% A160E 68% N165D 64% N167S 58% N167W 58% T177V 81%

[0106] As shown in Table 1, compared with wild-type xylanase H1, the single-point mutants provided by this invention generally exhibit a 12.2%-71.4% increase in relative enzyme activity at 75℃. Among them, the mutants containing single points S38T, S38W, D41P, and T177V all show relative enzyme activities exceeding 80% at 75℃, significantly higher than wild-type xylanase H1. This demonstrates that the single-point mutants provided by this invention exhibit significantly improved heat resistance, achieving unexpected technical benefits.

[0107] Example 6: Tolerance analysis of xylanase mutants to alkaline environments

[0108] Dilute the fermentation supernatant of the recombinant strain to 50 U / ml with deionized water; add 1 ml of supernatant to 9 ml of preheated buffer solution at the corresponding pH (pH 9.0, 10.0, 11.0, 12.0) for 10 min, and treat at 37℃ for 2 h; after the reaction is complete, quickly add 5 ml of replenishing solution and shake well; then dilute with buffer solution and determine residual enzyme activity. Calculate the residual enzyme activity rate with the enzyme activity of untreated fermentation supernatant as 100%.

[0109] Enzyme activity residual rate (%) = enzyme activity of treated sample / enzyme activity of untreated sample × 100%.

[0110] The results showed that after treatment at pH 9.0-11.0 for 2 hours, the residual enzyme activity of wild-type xylanase H1 and its single-point mutant was generally higher than 91%, with almost no loss of enzyme activity.

[0111] After treatment at pH 12.0 for 2 hours, the residual enzyme activity of wild-type xylanase H1 was only 45.06%, while the residual enzyme activity of single-point mutants of xylanase was as high as 61.51-93.29%, especially the residual enzyme activity of mutants containing single points S38T, S38W, D41P, and T177V, which were as high as 90.6%, 92.33%, 93.11%, and 93.29%, respectively. This demonstrates that the single-point mutants provided by this invention have significantly improved tolerance to alkaline environments, achieving unexpected technical effects.

[0112] In summary, the mutation sites obtained by screening in this invention are Q24P, S38V, S38K, S38W, S38H, S38T, S38I, G40M, G40R, G40K, G40F, G40H, D41P, N56L, N56I, N56P, N56K, A57E, A57D, A57Y, A59K, A59R, A59I, A59M, A59H, H61F, H61Y, A75S, T80M, and T10. 3I, T107E, T114Y, D129L, Q132R, Q132M, D135M, N143D, K144R, T149L, Q151N, Q151Y, C154N, D157E, A160E, N165D, V166I, N167S, N167W, T177V, and D192E can all significantly improve the tolerance of xylanase H1 to high temperature and alkaline environments, thus facilitating its widespread application in the papermaking industry.

Claims

1. A xylanase mutant, characterized in that, The mutant is a xylanase with the amino acid sequence SEQ ID NO:1 in which amino acid 177 is changed from Thr to Val.

2. A DNA molecule encoding the xylanase mutant of claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid as described in claim 3.

5. The host cell as described in claim 4, characterized in that, The host cell is Pichia pastoris (Pichia pastoris). Pichia pastoris ).

6. The host cell as described in claim 4, characterized in that, The host cell is *Trichoderma reesei* ( Trichoderma reesei ).

7. The application of the xylanase mutant of claim 1 in the papermaking field.

Images