Application of maize ZmMTⅠ-9 gene in reducing cadmium accumulation in rice grain

By introducing the maize ZmMTⅠ-9 gene into rice for heterologous overexpression, the problem of cadmium accumulation in rice grains was solved, resulting in a significant reduction in cadmium content and improved tolerance, thus ensuring the quality and safety of agricultural products.

CN119040386BActive Publication Date: 2026-03-24ANHUI AGRICULTURAL UNIVERSITY
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-25
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively reduce cadmium accumulation in rice grains, and rice has a strong ability to absorb and accumulate cadmium, which affects the quality and safety of agricultural products.

Method used

The maize ZmMTⅠ-9 gene was introduced into rice via transgenic technology for heterologous overexpression, which improved the rice's tolerance to cadmium stress and reduced cadmium absorption and accumulation.

Benefits of technology

It significantly improves rice's tolerance to cadmium, reduces cadmium content in grains, and enhances the safety and yield of rice varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119040386B_ABST
    Figure CN119040386B_ABST
Patent Text Reader

Abstract

The application relates to the technical field of genetic engineering, and particularly relates to application of a corn ZmMTI-9 gene in reducing cadmium accumulation in rice grains. Through early test, it is found that the corn ZmMTI-9 gene is involved in responding to the process of cadmium stress, the application carries out function verification on the gene by cloning and analyzing the corn ZmMTI-9 gene and combining with heterologous overexpression of the gene in rice through transgenic technology. The results show that the cadmium tolerance of the ZmMTI-9 overexpression plant is significantly enhanced, and the cadmium content in the grains is significantly reduced. The application provides a feasible technical scheme for rice grain low-cadmium accumulation breeding and production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to the application of the maize ZmMTⅠ-9 gene in reducing cadmium accumulation in rice grains. Background Technology

[0002] Cadmium (Cd) is one of the most biotoxic and prevalent heavy metals in farmland pollution. Cd-contaminated soil not only harms crop growth and development, leading to reduced yield and quality, but also poses a serious threat to human health through the food chain. Therefore, cultivating new varieties resistant to cadmium stress and with low cadmium accumulation in grains has become an important means of sustainable and efficient use of land resources and ensuring the quality and safety of agricultural products. Currently, various methods for reducing soil heavy metal content have been proposed. Among them, phytoremediation is a low-cost, high-efficiency, safe, and environmentally friendly remediation method, but the plants used must possess high tolerance to heavy metals and hyperaccumulation capabilities. Patent document CN116024256A discloses a genetic engineering application of the rice gene OsHSFA4d. This application uses the promoter of the ubiquitin gene from the gramineous plant maize to construct a gene expression vector that can effectively inhibit the expression of the OsNramp5 gene, thereby reducing the absorption of cadmium by rice roots and the accumulation of cadmium in grains. Patent document CN113832170A discloses a ZmHSMT3 gene obtained from maize and uses genetic engineering technology to construct the pCAMBIA2300 overexpression vector. This vector is then transferred into the rice variety Zhonghua 11 via Agrobacterium-mediated transformation, resulting in overexpression in the wild type and a reduction in cadmium content in the rice grains. Rice is a high-cadmium-accumulating plant, exhibiting strong absorption and accumulation of cadmium. Even when planted in non-cadmium-contaminated soil, the cadmium content in the grains may still be high. Therefore, breeding and planting crop varieties with low cadmium accumulation in edible organs has become a crucial step in phytoremediation. Identifying low-cadmium-accumulating germplasm and related genes is fundamental for conducting related crop breeding and production regulation. Therefore, further research is needed to reduce cadmium absorption or accumulation in rice grains, or to identify key genes for low cadmium accumulation in grains. Summary of the Invention

[0003] Given the shortcomings of existing technologies, the purpose of this invention is to provide a gene that can participate in regulating cadmium accumulation in rice grains, for the purpose of breeding rice varieties with low cadmium accumulation in grains.

[0004] To achieve the above objectives, the present invention adopts the following technical solution:

[0005] In one aspect, this invention provides the application of the maize ZmMTⅠ-9 gene in enhancing the tolerance of crops to cadmium stress, wherein the crop is rice; the CDS sequence of the maize ZmMTⅠ-9 gene is shown in SEQ ID NO.1. The ZmMTⅠ-9 protein consists of 76 amino acid residues with a molecular weight of 7.52 kDa, and its amino acid sequence is shown in SEQ ID NO.2. The maize ZmMTⅠ-9 gene of this invention can significantly enhance the tolerance of rice to cadmium stress.

[0006] In one aspect, the present invention provides the application of the maize ZmMTⅠ-9 gene in reducing cadmium accumulation in rice grains. By introducing the maize ZmMTⅠ-9 gene into rice for heterologous overexpression, the cadmium tolerance of rice plants is enhanced, significantly reducing the absorption of cadmium by the plants and reducing cadmium accumulation in rice grains.

[0007] In this invention, the ZmMTⅠ-9 gene fragment is transferred into rice using transgenic technology, and functional transgenic plants are screened to obtain them. These transgenic plants have cadmium tolerance and low cadmium accumulation in the grains.

[0008] In one aspect, the present invention provides a method for breeding rice varieties with low cadmium accumulation in grains, comprising the following steps:

[0009] (1) Insert the ZmMTⅠ-9 gene fragment shown in SEQ ID NO.1 into the overexpression vector to construct a recombinant plasmid;

[0010] (2) The target fragment was transferred into recipient rice using Agrobacterium-mediated transformation technology, and functional transgenic plants were obtained by cultivation and screening.

[0011] Preferably, the overexpression vector is pCAMBIA1301a.

[0012] Preferably, the host bacterium used in the Agrobacterium-mediated transformation technology is Agrobacterium EHA105. The genetic transformation material is rice embryogenic callus.

[0013] In one embodiment, the rice variety is Nipponbare.

[0014] The beneficial effects of this invention are as follows:

[0015] This invention verifies the function of the ZmMTⅠ-9 gene by cloning and analyzing it in maize and then performing heterologous overexpression in rice using transgenic technology. The ZmMTⅠ-9 overexpression plants showed significantly enhanced tolerance to cadmium and significantly reduced cadmium content in the grains. This invention provides a feasible technical solution for breeding and producing rice with low grain accumulation. Attached Figure Description

[0016] Figure 1 ZmMTⅠ-9 heterologous expression yeast assay. A: PCR verification gel image of the transgenic yeast strain; B: Schematic diagram of the growth of transgenic ycf1 strain under different Cd concentrations at gradient dilutions; the culture medium used in B is SD-Ura (galactose).

[0017] Figure 2 : Identification results of positive genetically modified rice seedlings.

[0018] Figure 3 Effects of Cd stress on the growth of wild-type and transgenic rice seedlings. A: Change in growth rate after 7 days of Cd stress; B: CAT activity after 14 days of Cd stress; C: POD activity after 14 days of Cd stress; D: APX activity after 14 days of Cd stress; E: MDA content after 14 days of Cd stress. * indicates a significant difference from wild-type rice at the 0.05 level, and ** indicates a significant difference from wild-type rice at the 0.01 level.

[0019] Figure 4 Effects of 14 days of Cd stress on Cd and Zn content in wild-type and transgenic rice seedlings. A: Cd content in aboveground parts; B: Cd content in roots; C: Cd conversion rate; D: Cd uptake; E: Zn content in aboveground parts; F: Zn content in roots; G: Zn conversion rate; I: Zn uptake. * indicates a significant difference from wild-type rice at the 0.05 level, and ** indicates a significant difference from wild-type rice at the 0.01 level.

[0020] Figure 5 Effects of Cd-contaminated soil on the phenotypes of wild-type and transgenic rice after 70 days of growth. A: Aboveground phenotype (scale bar: 10cm); B: Plant height; C: 100-grain weight; D: Comparison of main panicle; E: Main panicle length; F: Seed setting rate. * indicates a significant difference from wild-type rice at the 0.05 level, and ** indicates a significant difference from wild-type rice at the 0.01 level.

[0021] Figure 6 The effect of Cd-contaminated soil on the Cd and Zn content of wild-type and transgenic rice after 70 days of growth. A: Cd content in rice straw; B: Cd content in grains; C: Cd content in husks; D: Zn content in rice straw; E: Zn content in grains; F: Zn content in husks. * indicates a significant difference compared to wild-type rice at the 0.05 level, and ** indicates a significant difference compared to wild-type rice at the 0.01 level. Detailed Implementation

[0022] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments and experimental examples are commercially available. Unless otherwise stated, all reagents used in this invention are analytical grade reagents. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0023] Example 1:

[0024] 1.1 Cloning and Analysis of the CDS Region of the ZmMTs Gene

[0025] In the initial stage of this invention, nine candidate genes of the maize metallothionein gene family (ZmMTs) were identified using GWAS. Through stress-induced experiments, it was found that six genes in the ZmMT gene family—ZmMTⅠ-3, ZmMTⅠ-9, ZmMTⅡ-1, ZmMTⅡ-6, ZmMTⅡ-7, and ZmMTⅡ-8—are involved in the maize seedling response to Cd stress. Therefore, this invention further cloned the full-length CDS sequences of these six genes in the maize B73 variety. Specifically:

[0026] (1) Total RNA was extracted from maize B73 leaves using a total RNA extraction kit, and DNase I was used to remove genomic DNA contamination.

[0027] (2) The single-stranded cDNA was reverse transcribed using HiScript 111 RT SuperMix for qPCR (+gDNA wiper) (Nanjing Novizan Biotechnology Co., Ltd., catalog number: R323-01).

[0028] (3) Primers were designed based on the sequence obtained from Blast and amplified using KOD ONE high-fidelity enzyme. The primer sequences are shown in Table 1.

[0029] (4) The amplified product was ligated into the pMD18-T vector, transformed into Escherichia coli DH5α, and single clones were selected for sequencing.

[0030] Table 1: Primer list for ZmMTs gene amplification

[0031] Gene upstream of primer (F) Downstream of primer (R) ZmMT1 5'ATGTCGTGCTGCGGAGGC 3' 5'TCACTTGCCGCAGTTGCAG 3' ZmMT3 5'ATGTCTTGCAGCTGCGGAT 3' 5'TCAGCAGTTGCAGGGGCT 3' ZmMT6 5'ATGTCTTGCAGCAGCGGC 3' 5'TCAGTTGCAGCTGCAGCAG 3' ZmMT7 5'ATGCAAGTGCGGCAGCGG 3' 5'TCACTTGCAGGTGCAGGGGTC 3' ZmMT8 5'ATGTCGTGCTGCGGAGGC 3' 5'TCACTTGCAGGTGCAGGGG 3' ZmMT9 5'ATGTCTTGCAACTGCGGAT 3' 5'TCAGCAGTTGCAGGGGTC 3'

[0032] 1.2 ZmMTs gene heterologous expression yeast experiment

[0033] (1) The correctly sequenced gene was transferred into the yeast expression vector pYES2. The gene was then transferred into the Cd-sensitive yeast strain ycf1 using the lithium acetate conversion method and PCR verification was performed to ensure that the ZmMTs gene was transferred into the strain.

[0034] (2) The transgenic yeast strain ycf 1 was inoculated into SD-Ura (glucose) liquid medium and cultured overnight at 30°C and 220 rpm / min.

[0035] (3) In a clean bench, aspirate 1 ml of bacterial solution into a 2 ml centrifuge tube, centrifuge and discard the supernatant, add 1 mL of sterile ddH2O, resuspend and mix well, and measure the OD of the cleaned bacterial solution. 600 The value was calculated and diluted to 0.2. (Using OD...) 600 The bacterial culture with a concentration of 0.2 was used as the stock solution and was serially diluted 10 times, resulting in four dilution gradients. 8 μL of the bacterial culture was spotted into SD-Ura (galactose) solid medium containing 0, 60, and 70 μM Cd concentrations. The culture was incubated upside down in a 30°C incubator for 2-3 days and then observed.

[0036] Result: As Figure 1 As shown, in the dilution spot test, the transgenic Cd-sensitive ycf1 strain and the empty vector yeast showed essentially the same growth vigor under control and 60 μM Cd stress, with no significant difference. However, under 70 μM Cd stress, compared with the empty vector ycf1 strain, the spots of ycf1 strains transgenic ZmMTⅠ-3 and ZmMTⅠ-9 were larger and more complete, while the spots of ycf1 strain transgenic ZmMTⅡ-1 showed the opposite. The growth vigor of the spots of the remaining transgenic ycf1 strains was not significantly different from that of the empty vector ycf1 strain (see...). Figure 1 (B) In heterologous gene expression yeast, ZmMTⅠ-9 significantly improved yeast tolerance to Cd, therefore this gene was selected as the target gene for subsequent validation tests.

[0037] 1.3 ZmMTⅠ-9 gene sequence analysis

[0038] Sequencing revealed that the full-length CDS of the ZmMTⅠ-9 gene is 231 bp, with the nucleotide sequence shown in SEQ ID NO.1, encoding 76 amino acids. The corresponding amino acid sequence is shown in SEQ ID NO.2, and the molecular weight of the protein is 7.52 kDa.

[0039] Example 2: Construction of ZmMTⅠ-9 gene-transformed rice

[0040] 2.1 Construction of recombinant plasmids

[0041] Based on the previously cloned sequences, specific primers were designed. The primer sequences are as follows (lowercase indicates restriction enzyme sites):

[0042] ZmMTⅠ-9-PCR-F: 5'-ggggtaccccATGTCTTGCAACTGCGGAT-3' (SEQ ID NO.3);

[0043] ZmMTⅠ-9-PCR-R: 5'-gctctagagcTCAGCAGTTGCAGGGGTC-3' (SEQ ID NO.4),

[0044] Full-length CDS was amplified using LA Taq DNA Polymerase, recovered from the gel, and ligated into the pCAMBIA1301a vector. The cells were then transformed and cultured. Single clones were picked and sequenced. After successful sequencing using the M13 forward and reverse primers, the cells were digested with XbaI and KpnI restriction enzymes and ligated into a 35S empty vector digested with the same restriction enzymes. The ligation product was heat-shocked into *E. coli* DH5α competent cells. After culture, single clones were picked by streaking and cultured, and plasmids were extracted for enzyme digestion and detection.

[0045] 2.2 Agrobacterium-mediated genetic transformation

[0046] Take 300 μL of transgenic Agrobacterium (EHA105) and inoculate it into 10 mL of LB liquid medium. Incubate at 28°C and 180 rpm on a shaker for 10–16 h to propagate the bacteria. Transfer 2 mL of Agrobacterium culture to a 2 mL centrifuge tube, centrifuge at 7000 rpm for 2 min, discard the supernatant, and resuspend the bacteria in infection solution containing 200 μL of MAS. Adjust the OD of the culture to 0.5%. 600 =0.01~0.02, which is the co-culture infection solution; use a spoon to transfer the subcultured callus to a sterile culture bottle, add the co-culture infection solution, and soak the callus for 30 minutes; pour out the co-culture infection solution, and after the callus has dried, transfer the rice callus to the co-culture medium and continue to culture at 28℃ in the dark for 2 days.

[0047] The co-cultured callus tissue was transferred to a sterile culture flask, and sterile deionized water was added. The flask was washed 8–10 times, then soaked in 50 mg / L termethin solution for 30 min. Finally, the rice callus tissue was poured onto a culture dish lined with filter paper and air-dried. The dried callus tissue was transferred to a selection medium (50 mg / L Hyg) using sterile forceps and cultured at 28°C under light for 7 days. The callus tissue with good activity obtained after the previous screening was subjected to a second screening. Callus tissue with good growth was selected and subcultured on fresh selection medium; after light culture, transgenic positive seedlings were obtained. The seedlings were then transferred into soil, and seedling DNA was extracted. Specific primers were designed for positive seedling identification. The primer sequences are as follows, where the forward primer is the vector sequence and the reverse primer is the gene sequence:

[0048] ZmMTⅠ-9-JD-F: 5'-CTGCGGATCAAGCTGCG-3' (SEQ ID NO.5);

[0049] ZmMTI-9-JD-R: 5'-CGCACTTGCAGTTGCCA-3' (SEQ ID NO. 6).

[0050] The results of the identification are as follows Figure 2 As shown, after screening and identification, transgenic lines line3 and line4 were obtained.

[0051] Example 3: Effects of cadmium stress on rice seedling growth and cadmium content

[0052] Rice was cultured in an artificial climate chamber at 30℃ and 75% relative humidity. Ten seeds each of the overexpression lines 3 and 4, and the wild-type (WT) were completely submerged in water and germinated in the dark for 3 days, with the water changed daily. After germination, the seeds were transferred to a floating plate containing 0.5 mM CaCl2 solution, labeled, and cultured in the dark for 3 days. Then, the 0.5 mM CaCl2 solution was replaced with Kimura nutrient solution, which was changed every 3 days. After 14 days of normal culture, the rice was treated with 1 μM Cd.

[0053] Result: As Figure 3 As shown, after 7 days of cadmium treatment, the root length and seedling length of line 3 and line 4 were significantly increased compared with wild-type rice. Figure 3 (A). After 14 days of cadmium treatment, compared with WT, the CAT activity in the leaves of line 3 and line 4 was significantly increased by 57.86% and 96.23%, respectively; POD activity was significantly increased by 5.72% and 3.42%, respectively; and MDA content was significantly decreased by 14.80% and 8.25%, respectively. Figure 3 (BE). After 14 days of cadmium treatment, compared with WT, the cadmium content in the aboveground parts of lines 3 and 4 decreased significantly by 12.24% and 23.91%, respectively; the cadmium content in the underground parts of lines 3 and 4 decreased significantly by 9.15% and 13.38%, respectively; and the cadmium uptake of lines 3 and 4 decreased by 7.72% and 11.89%, respectively (see BE). Figure 4 (AD). Other studies have shown that the Zn content in plants also changes under Cd stress. This invention found that after 14 days of cadmium treatment, compared with WT, the Zn content in the aboveground parts of lines 3 and 4 increased significantly by 20.53% and 16.40%, respectively; the Zn content in the underground parts of lines 3 and 4 increased significantly by 16.94% and 18.95%, respectively; the Zn conversion rate of lines 3 and 4 increased by 4.69% and 3.88%, respectively; and the Zn uptake of lines 3 and 4 increased by 32.32% and 25.30%, respectively. Figure 4(EI). Under Cd stress, the Cd content and uptake of ZmMTⅠ-9 transgenic rice seedlings decreased, while the Zn content increased. However, under normal growth conditions, the Zn content in the roots and the Zn translocation rate in the plants of transgenic rice were significantly lower than those of the wild type. This indicates that the ZmMTⅠ-9 gene is closely related to Zn translocation but not to Cd translocation; it is hypothesized that Zn and Cd ions compete with ZmMTⅠ-9 for binding. When both Cd and Zn ions are present, ZmMTⅠ-9 tends to bind to Zn ions, thereby reducing Cd toxicity.

[0054] Example 4: Effect of heterologous expression of ZmMTⅠ-9 on cadmium content in rice grains

[0055] Take 3.5 kg of soil (basic physical and chemical properties: pH 5.5, organic matter content 34.22 g / kg). -1 Available phosphorus content: 20.75 mg / kg -1 Available potassium content: 87.5 mg / kg -1 The Cd content is 3.99 mg·kg. -1 Pour the water into a 4L plastic bucket, add water to make a total weight of 5.4kg, and let it stand for 1 day until the water has completely seeped into the soil.

[0056] Seeds of WT, line 3, and line 4 were completely submerged in water and germinated in the dark for 3 days, with the water changed daily. After germination, they were transferred to a floating plate on a 0.5 mM CaCl2 solution, labeled, and cultured in the dark for 3 days before being placed in an artificial climate incubator. The 0.5 mM CaCl2 solution was then replaced with Kimura nutrient solution, with the nutrient solution changed every 3 days. After 14 days of normal culture, seedlings with uniform growth were selected and transplanted into pots with Cd-treated soil. At maturity, samples were taken, and the plants were divided into three parts: straw, grains, and hulls, and dried at 55°C to constant weight. Plant height, main panicle length, seed setting rate, 100-grain weight, and Cd content were measured simultaneously.

[0057] Result: As Figure 5 As shown, compared with WT, the plant height of transgenic rice line 3 and line 4 plants decreased significantly by 9.91% and 11.22%, respectively, and the main panicle length decreased significantly by 8.47% and 11.21%, respectively, while there were no significant differences in seed setting rate and 100-grain weight (see [link to original text]). Figure 5 The Cd content in rice straw decreased significantly by 12.62% and 6.88%, respectively; the Cd content in grains decreased significantly by 46.35% and 38.16%, respectively; and the Cd content in husks decreased significantly by 35.52% and 44.24%, respectively. Conversely, the Zn content in rice straw increased significantly by 33.91% and 34.33%, while the Zn content in husks decreased significantly by 22.18% and 14.26%, respectively (see [reference]). Figure 6In summary, ZmMTⅠ-9 overexpressing rice showed significantly reduced Cd and significantly increased Zn content at both the seedling and maturity stages, with Zn uptake exceeding Cd uptake. This indicates that under Cd stress, heterologous ZmMTⅠ-9-expressing rice can reduce Cd uptake by preferentially absorbing Zn ions, thereby enhancing Cd tolerance.

[0058] The above description, in conjunction with specific embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, several simple deductions or substitutions can be made without departing from the concept of the present invention, and all such deductions or substitutions should be considered to fall within the scope of protection defined by the claims submitted herein.

Claims

1. Application of maize ZmMTI-9 gene in reducing cadmium accumulation in rice grains, characterized in that, The CDS sequence of the ZmMTⅠ-9 gene is shown in SEQ ID NO.1, and the application is to overexpress the maize ZmMTⅠ-9 gene in rice.

2. A method of reducing cadmium accumulation in rice grains, characterized by, The maize ZmMTⅠ-9 gene was transferred into rice for overexpression. The CDS sequence of the ZmMTⅠ-9 gene is shown in SEQ ID NO.1.

Citation Information

Patent Citations

  • Genetic engineering application of rice gene OsHSFA4d

    CN116024256A

  • Novel application of four rice metallothionein genes

    CN105543243A

  • Corn ZmHSMT3 gene and application thereof in reducing cadmium accumulation of rice grains

    CN113832170A

  • Isolation, cloning and application of PMS3, a gene for photoperiod-sensitive genic male-sterility in rice

    WO2013023623A1