A molecular marker, identification method and application for identifying the adenosine content in sweet corn kernels

Abstract

A molecular marker, identification method and application for identifying the adenosine content in sweet corn kernels, relating to the technical field of genetic engineering; the application of a reagent for detecting the expression of the gene Zm00001d036978 in identifying the adenosine content in sweet corn kernels. The sweet corn gene Zm00001d036978 is a functional gene affecting the adenosine content, and the identification of the adenosine content in sweet corn kernels can be achieved by detecting the expression of the gene Zm00001d036978. The present invention discovers 4 sequence variation sites related to the adenosine content in sweet corn kernels on the gene Zm00001d036978, and using these as molecular markers can achieve rapid identification of the genotypes of sweet corn materials by a fluorescence quantitative PCR instrument, thereby predicting the adenosine content in sweet corn kernels, and having great application potential and value in the process of sweet corn breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a molecular marker for identifying the adenosine content in sweet corn kernels, an identification method and applications thereof. Background Art

[0002] Adenosine is a compound formed by connecting N-9 of adenine and C-1 of D-ribose through a beta glycosidic bond. Adenosine has physiological effects on the cardiovascular system and multiple tissues and organs of the human body. Adenosine is an intermediate for synthesizing adenosine triphosphate, adenine, and vidarabine. At the same time, adenosine also has many specific biological functions, such as generating adenylic acid after phosphorylation, participating in the energy metabolism of the myocardium, participating in functions such as vasodilation and blood pressure reduction. In addition, adenosine can also scavenge free radicals and has a certain antioxidant effect.

[0003] At present, the research on adenosine mainly focuses on the extraction, content identification, and methods for increasing the content in health products such as Cordyceps militaris, Cordyceps cicadae, and Ganoderma lucidum. There is little research on maize with low added value, especially on adenosine in sweet corn, and it is basically in a blank state. Sweet corn with high adenosine content can not only utilize the functions of adenosine itself but also is a potential way to increase the added value of sweet corn. The genetic improvement of adenosine content is of great significance for sweet corn.

[0004] Existing technologies for measuring adenosine content mostly use methods such as mass spectrometry, which are cumbersome, costly, and time-consuming and are not suitable for large-scale detection. The trait of adenosine content in sweet corn is a complex quantitative trait and is regulated by a complex gene network. Association analysis can identify the degree of association between traits and markers in a specific population and is very suitable for simultaneously evaluating all genetic loci across the whole genome, with the advantages of less time and high precision. Association analysis is an effective method for mining genes of plant quantitative traits, broadening the marker-assisted breeding ideas for analyzing excellent traits of crops, and providing theoretical and technical support. However, further research is needed on the gene loci closely associated with adenosine content mapped in the sweet corn genome.

[0005] Acid phosphatase (ACP) is a non-specific phosphohydrolase that can catalyze the hydrolysis of almost all phosphomonoesters. It can also catalyze the transfer of phosphate groups, improve the utilization efficiency of phosphate groups, and directly participate in phosphorus metabolism. Plants will also promote the secretion of acid phosphatase in a low-phosphorus environment; adenosine participates in hydrolysis pathways involving multiple steps of phosphate groups such as adenosine triphosphate, adenine, and vidarabine, and acid phosphatase has a relatively close association with adenosine in these pathways. Therefore, there may be gene loci associated with adenosine content in acid phosphatase. There is an urgent need to develop a molecular marker for detecting gene loci that significantly affect adenosine content, and then complete the detection of high and low adenosine content. Summary of the Invention

[0006] To overcome the deficiencies of the prior art, one of the objectives of the present invention is to provide the use of a reagent for detecting the expression of gene Zm00001d036978 in the identification of adenosine content in sweet corn kernels.

[0007] Another objective of the present invention is to provide a molecular marker for identifying the adenosine content in sweet corn kernels.

[0008] A third objective of the present invention is to provide the use of an SNP molecular marker for identifying the pericarp thickness of sweet corn in maize breeding.

[0009] A fourth objective of the present invention is to provide a KASP marker primer.

[0010] A fifth objective of the present invention is to provide a kit for identifying the adenosine content in sweet corn kernels.

[0011] A sixth objective of the present invention is to provide a method for identifying sweet corn with high adenosine content.

[0012] A seventh objective of the present invention is to provide the use of a KASP marker primer in maize breeding.

[0013] The present invention provides the use of a reagent for detecting the expression of gene Zm00001d036978 in the identification of adenosine content in sweet corn kernels, wherein the gene Zm00001d036978 is located at 108109102bp - 108113917bp on chromosome 6 of the sweet corn genome.

[0014] Preferably, when the expression level of the gene Zm00001d036978 increases, it is identified that the adenosine content in sweet corn kernels increases.

[0015] The application of an expression inhibitor of gene Zm00001d036978 in regulating the adenosine content in sweet corn kernels.

[0016] The present invention provides a molecular marker for identifying the adenosine content in sweet corn kernels, including at least one of the following:

[0017] InDel locus marker, located at 108109290bp (InDel6_108109290) on chromosome 6 of the sweet corn genome, with alleles G / GAAC;

[0018] The first SNP locus marker, located at 108111970bp (SNP6_108111970) on chromosome 6 of the sweet corn genome, with alleles G / T;

[0019] The second SNP locus marker is located at 108113553 bp (SNP6_108113553) on chromosome 6 of the sweet corn genome, and the alleles are T / G;

[0020] The third SNP locus marker is located at 108113600 bp (SNP6_108113600) on chromosome 6 of the sweet corn genome, and the alleles are G / A.

[0021] The present invention provides an application of a molecular marker for identifying the adenosine content in sweet corn kernels in the identification of the adenosine content in sweet corn kernels.

[0022] Preferably, when the genotype of the InDel locus marker is the allele G / G, it is identified as sweet corn kernels with a high adenosine content.

[0023] The present invention provides a KASP marker primer for detecting the molecular marker for identifying the adenosine content in sweet corn kernels.

[0024] Preferably, when the molecular marker for identifying the adenosine content in sweet corn kernels is an InDel locus marker, its KASP marker primers include: a first primer as shown in SEQ ID NO: 1, a second primer as shown in SEQ ID NO: 2, and a third primer as shown in SEQ ID NO: 3.

[0025] The present invention provides a kit for identifying the adenosine content in sweet corn kernels, including the above-mentioned KASP marker primers.

[0026] The present invention provides a method for identifying sweet corn with a high adenosine content, including the following steps:

[0027] S1, obtaining the genome of the sweet corn sample to be tested;

[0028] S2, detecting the allele typing of the genome by using the kit. When the InDel locus at 108109290 bp on chromosome 6 of the sweet corn genome is the allele G / G, the sweet corn to be tested is identified as sweet corn with a high adenosine content.

[0029] The present invention provides an application of a KASP marker primer in corn breeding.

[0030] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0031] The present invention discovers that the sweet corn gene Zm00001d036978 (location: Chr6:108,109,102-108,113,917; B73 version 4.0) is a functional gene affecting adenosine content, and the identification of adenosine content in sweet corn kernels can be achieved by detecting the expression of gene Zm00001d036978.

[0032] The present invention discovers 4 sequence variation sites on gene Zm00001d036978 that are related to adenosine content in sweet corn kernels. Using these as molecular markers, rapid identification of the genotype of sweet corn materials by a fluorescence quantitative PCR instrument can be achieved, thereby predicting the adenosine content in sweet corn kernels.

[0033] The present invention proposes a KASP marker primer. For the InDel6_108109290 locus, it detects the genotype of sweet corn materials and then predicts the adenosine content, which has great application potential and value in the process of sweet corn breeding. Brief Description of the Drawings

[0034] Figure 1 It is the distribution map of adenosine content in the sweet corn population in Example 1 of the present invention.

[0035] Figure 2 It is the result map of the genome-wide association analysis of adenosine content in Example 2 of the present invention.

[0036] Figure 3 It is the candidate gene screening map related to adenosine content in Example 2 of the present invention; among them, above Figure 3 is the local Manhattan map of adenosine QTL for adenosine content; below Figure 3 is the gene distribution map within the QTL interval.

[0037] Figure 4 It is the distribution map of the difference in adenosine content among materials with different alleles at InDel6_108109290 in Example 2 of the present invention.

[0038] Figure 5 It is the gene structure of gene Zm00001d036978 and the sequence variation information map of its knockout line in Example 3 of the present invention.

[0039] Figure 6 It is the comparison map of adenosine content between the knockout line of gene Zm00001d036978 and the wild-type material in Example 3 of the present invention.

[0040] Figure 7 It is the genotyping result map of the KASP marker in sweet corn in Example 4 of the present invention.

[0041] Figure 8It is a comparison chart of adenosine content in different genotype sweet corn materials in Example 4 of the present invention. Detailed implementation manners

[0042] Next, in combination with the detailed implementation manners, the present invention will be further described. It should be noted that, on the premise of non-conflict, the following described embodiments or various technical features can be arbitrarily combined to form new embodiments.

[0043] For the experimental methods without specific conditions indicated in the following embodiments, they are usually carried out according to conventional experimental conditions or the experimental conditions recommended by the manufacturer. Unless otherwise specified, various reaction reagents involved in the embodiments can be obtained through commercial channels.

[0044] Example 1

[0045] 1. Materials and methods

[0046] 1.1 Planting and sampling of sweet corn population

[0047] The sweet corn population in this example includes 295 sweet corn lines. These materials have extensive genetic diversity, and their geographical origins include China, the United States, Thailand, Canada, etc., and the ecological types include tropical and temperate zones, etc., so that this population has rich phenotypic and genotypic variations, which is also the basis for the mining of functional genes. The sweet corn materials in this population are planted and sampled at the Guangzhou experimental base. It is used to identify the adenosine content in sweet corn kernels. The main planting and sampling details include the following aspects.

[0048] 1) In terms of material planting, plant according to a suitable and consistent planting density (row spacing 0.7 m, plant spacing 0.25 m), and unify the water and fertilizer management.

[0049] 2) Record the self-pollination time of each line, sample the sweet corn kernels 20 days after pollination, immediately put them into liquid nitrogen for preservation after sampling, and then transfer them to a -80 °C refrigerator for preservation until the adenosine content in the sample is measured.

[0050] 3) Grind the sweet corn kernels in a low-temperature environment (model Retsch MM400) before sample determination. Accurately weigh 100 mg before sample extraction for the determination of adenosine content in the sample.

[0051] 1.2 Determination of adenosine content in sweet corn kernels

[0052] The quantitative method of adenosine is carried out according to the method reported by Yan et al. earlier. The method of gas chromatography-mass spectrometry is used to simultaneously determine adenosine and other metabolites. The following key points are mainly included in the determination process to ensure the accuracy of the measured metabolite content data.

[0053] 1) Accurately quantify the sample to be determined before determination.

[0054] 2) Three biological replicates were set for each sample to reduce environmental and human operation errors.

[0055] 3) The chromatograph-mass spectrometer platform model used for metabolite detection was (Agilent 7890A-5975C, USA), and the chromatographic column used was DB-35MS UI (30 m × 0.25 mm, 0.25 μm). The mass range of this chromatograph-mass spectrometry analysis was from 85 - 700 m / z.

[0056] 4) Two methods were used to identify adenosine. One was to identify the molecular formula and name of the measured metabolites through the combined analysis of the database Agilent MassHunter Qualitative Analysis (versions B06.00 and B.07.01). The other was to use the standard product of adenosine to identify the metabolic data measured in the material to ensure that the obtained data originated from the target metabolite, i.e., adenosine.

[0057] Refer to Figure 1 , by measuring the adenosine content in 287 materials of the sweet corn population, we found that there was abundant content variation of adenosine in the population. The highest value and the lowest value differed by about 25 times, and the coefficient of variation of adenosine content in the population was 0.426. The abundant variation not only provided a prerequisite for the identification of adenosine regulatory loci but also was the basis for the genetic improvement of adenosine phenotypes.

[0058] Example 2

[0059] 2.1 Association analysis of adenosine content

[0060] The whole-genome sequencing of the sweet corn population was performed, and approximately 9.8 million high-quality SNP data were identified within the whole genome. Using the whole-genome SNP data, we completed the calculation of the population structure PCA result data and the kinship matrix data (Kinship) among the materials within the sweet corn population required for association analysis. Thus, we developed the genotype file required for association analysis.

[0061] Combined with the adenosine content data in Example 1, association analysis was performed using the software TASSEL (v3.0), and the association analysis model used was the mixed linear model (MLM). Population structure has a great influence on the results of association analysis. The existence of population structure may lead to the situation that the association between gene polymorphism sites and traits in the population is not caused by functional sites, resulting in false positive results. Therefore, it is necessary to perform structure analysis and correction on the population when conducting association analysis. The Q(PCA)+K(Kinship) mixed linear model used in the association analysis of the present invention can well solve the false positive phenomenon caused by population structure. The threshold used in the association analysis in the present invention is P<5.08×10 -7 (1 / n, where n represents the number of effective markers within the whole genome atmosphere).

[0062] 2.2 Identification of the function of the Zm00001d036978 gene

[0063] As Figure 2 shown, through the association analysis of adenosine content, we detected a QTL locus significantly related to adenosine content at 108.08 Mb (B73, version 4.0) on chromosome 6. The interval size of this QTL is approximately 200 Kb and contains a total of 8 annotated genes( Figure 3 ). The significance of the most significant SNP (S6_108096739) is P = 2.02E -17 , and this locus can explain 32.9% of the variation in adenosine content, which is a major QTL locus affecting adenosine content.

[0064] Combined with the association analysis of the whole genome InDel data, we identified a total of 34 InDel loci significantly related to adenosine content within this QTL region. Several of the most significant loci are on and near the gene Zm00001d036978 (location: Chr6:108,109,102 - 108,113,917; B73 version 4.0). Combining the functional annotation of this gene, we determined that the Zm00001d036978 gene is the functional gene affecting the adenosine content in sweet corn kernel tissue. Through the association analysis of the expression level of the Zm00001d036978 gene, we did not identify significant loci on the genome, that is, the SNP loci affecting adenosine content have nothing to do with the expression level of this gene.

[0065] On the other hand, we identified the InDel variation sites in the Zm00001d036978 gene region. A total of 3 InDel sites were identified in the exon region of the gene region, namely InDel6_108109120, InDel6_108109290, and InDel6_108113865.

[0066] Referring to Figure 4 , through the candidate gene association analysis of these three loci, we found that the InDel6_108109290 locus was extremely correlated with the content of adenosine, and the allele (G / G) had a higher adenosine content; while the degree of association between InDel6_108109120, InDel6_108113865 and the content of adenosine was much lower than that of InDel6_108109290.

[0067] Referring to Table 1, we found that the InDel locus (InDel6_108109290) and three SNP loci (SNP6_108111970, SNP6_108113553 and SNP6_108113600) were completely linked. Thus, we identified a gene that affects the adenosine content in sweet corn grain tissue, and four variant sites in the exon region of this gene may contain the functional sites of the gene, which are suitable as sites for molecular marker screening, and functional markers can be developed according to these variant sites.

[0068] Table 1 Exon variation information of gene Zm00001d036978

[0069]

[0070] Example 3

[0071] Verifying the function of gene Zm00001d036978 using CRISPR-Cas9 gene editing technology

[0072] Association analysis is an effective method for gene mining. However, at the same time, association analysis is also an indirect method for finding genes associated with target phenotypes. Because of the linkage disequilibrium it relies on, the candidate genes found by association analysis have a certain false positive rate. Gene editing technology can edit specific sites of specific genes, causing changes or even complete loss of the normal function of the genes. Combining the identification of phenotypes in gene editing materials can quickly verify the function of target genes and obtain direct evidence for gene function research. Therefore, we conducted a gene editing experiment on gene Zm00001d036978 and designed two small guide RNAs (sgRNAs) in the first exon region of gene Zm00001d036978 for protein localization ( Figure 5 ).

[0073] Specifically: Using the gene editing sgRNA primer design software CRISPR-P (version 2.0) to obtain the guide RNA sequence for this gene editing.

[0074] The sgRNA sequences are respectively: 5’-CCCCTGAGCGCGGACAGTAC-3’;

[0075] 5’-CCTGGTGGTAGTTGTTGGCCTCA-3’.

[0076] It was transferred into the immature embryo tissues of maize inbred line KN5585 through Agrobacterium-mediated transformation to complete the transfer of the editing system, thereby completing the site-directed mutation of the gene sequence of Zm00001d036978. Mutants with sequence variations in the target region were successfully obtained (i.e., a 4-base deletion occurred at small guide RNA 1 and a 10-base deletion occurred at small guide RNA 2).

[0077] Refer to Figure 6 , after purification of the mutants, we identified the content of adenosine in the mutants. The results showed that the adenosine content in the knockout line of gene Zm00001d036978 was about 50% of that in the wild-type material. The significant decrease in the adenosine content in the knockout line (P = 1.97×10 -7 ) also confirmed the results of our association analysis, that is, the gene Zm00001d036978 can affect the adenosine content in sweet corn kernels, and the most significant locus may be the functional locus of this gene.

[0078] Example 4

[0079] Design of molecular markers and their application in screening the adenosine content of maize kernels

[0080] Both the adenosine content association analysis results and the gene editing experiment results from Examples 2-3 showed that the gene Zm00001d036978 can regulate the adenosine content in sweet corn kernels. A sequence variation site InDel6_108109290 containing 3 bp in the non-coding region of this gene became an ideal molecular marker screening site.

[0081] According to the sequence variation information of InDel6_108109290, we developed a KASP marker for this site, which can quickly complete the inspection of this site. We used the Primer-Blast tool in NCBI to develop KASP primers. The synthesis and purification of the primers were completed by Sangon Biotech (Shanghai) Co., Ltd., and the purification method of the primers adopted the high-specification UPLC method. The obtained KASP marker contains two forward primers (Forwardprimer) and one universal reverse primer (Reversedprimer).

[0082] The primer information is as follows:

[0083] KASP primer sequence F1 (SEQ ID NO.1):

[0084] gaaggtgaccaagttcatgctGTTTCACACCGGGACCATAT[G]AACAC KASP primer sequence F2 (SEQ ID NO.2):

[0085] gaaggtcggagtcaacggattGTTTCACACCGGGACCATAT[GAAC]AA KASP universal primer sequence (SEQ ID NO.3): TCAAGCTACCAAACCCAATGTACT。

[0086] As shown in sequence SEQ ID NO.1, where the sequence (gaaggtgaccaagttcatgct) represents the FAM fluorophore linker sequence. This primer can amplify the allele (G / G) and excite FAM fluorescence in the fluorescence reaction system.

[0087] As shown in sequence SEQ ID NO.2, where the sequence (gaaggtcggagtcaacggatt) represents the HEX fluorophore linker sequence. This primer can amplify the allele (GAAC / GAAC) and excite HEX fluorescence in the fluorescence reaction system.

[0088] The KASP genotyping experiment was carried out in a 96-well white opaque PCR plate. The PCR reaction volume was 10.14 μl, and the reaction system ratio was: 5 μl of sweet corn DNA working solution with a concentration of 20 ng / μL, 5 μL of 2×KASP Mastermix, and 0.14 μl of primer premix. The total reaction volume was 10.14 μl.

[0089] The KASP PCR reaction program is shown in Table 1:

[0090] Table 1

[0091]

[0092]

[0093] Through the above KASP reaction system and reaction program, the PCR reaction process of each material was completed. The fluorescence scanning of the KASP reaction system was completed using a fluorescence quantitative PCR instrument or a microplate reader to obtain the fluorescence values of each sweet corn line. Through cluster analysis, the genotype information of sweet corn materials was obtained, thus completing the determination using allele types and further predicting the adenosine content.

[0094] Such as Figure 7As shown, the amplification products of the two forward primers and the common primer of the KASP marker are respectively labeled with FAM and HEX fluorescent groups. The allele (G / G) carries the FAM fluorescent group in the PCR reaction system, and the allele (GAAC / GAAC) carries the HEX fluorescent gene in the PCR reaction system. After the PCR reaction is completed, the reaction system is scanned for fluorescence, and the genotype of the DNA template used is determined by the ratio of the FAM fluorescence to the HEX fluorescence value.

[0095] As Figure 8 shown, in this example, 206 materials containing the allele (G / G) and 26 materials containing the allele (GAAC / GAAC) were detected. Statistical analysis of adenosine content showed that sweet corn samples that could excite FAM fluorescence (i.e., allele G / G) had higher adenosine content (P = 1.58×10 -13 ).

[0096] The KASP marker in this example targets the InDel6_108109290 locus, detects the genotype of sweet corn materials, and further predicts the adenosine content, which has great application potential and value in the process of sweet corn breeding.

[0097] The above embodiments are only the preferred embodiments of the present invention and cannot be used to limit the scope of protection of the present invention. Any non-substantial changes and substitutions made by those skilled in the art based on the present invention belong to the scope of protection required by the present invention.

Claims

1. Use of a reagent for detecting the expression of gene Zm00001d036978 in the identification of adenosine content in sweet corn kernels, characterized in that, The gene Zm00001d036978 is located at 108109102bp - 108113917bp on chromosome 6 of the sweet corn genome, and the sweet corn genome is the B73 V4 version of the genome.

2. Application of a molecular marker for identifying the adenosine content in sweet corn kernels in the identification of the adenosine content in sweet corn kernels, wherein the molecular marker is: An InDel locus marker, located at 108109290bp on chromosome 6 of the sweet corn genome, with polymorphisms of G or GAAC, and the sweet corn genome is the B73 V4 version of the genome.

3. The application according to claim 2, wherein When the genotype of the InDel locus marker is allele G / G, it is identified as sweet corn kernels with high adenosine content.

Images