An SNP locus related to peanut oil content and its application

Abstract

The present invention discloses an SNP locus related to peanut oil content and its application. The SNP locus is located at the 152042973 base of chromosome A07 of peanut. This locus has two genotypes, AG and GG. The peanut materials carrying the AG genotype have a significantly higher oil content than those carrying the GG genotype. The SNP locus of the present invention not only expands the gene resource tools of peanuts, but also has good and extensive application potential verified by scientific research experiments and data statistics.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to an SNP locus related to peanut oil content and its application. Background Art

[0002] Peanut (Arachis hypogaea L.) is an oil crop widely planted in the world. China is the largest peanut producer and consumer in the world. About 55% of the total peanut production in China is used for oil extraction, and peanut oil is the second largest source of domestic vegetable oil. However, the production of peanut oil in China far from meets the market demand, and the supply gap is more than 40%. When the peanut yield per unit area in China is already relatively high as a whole, increasing the peanut oil content to increase the peanut oil production is an effective way to alleviate the supply contradiction of peanut oil in China.

[0003] Peanut oil content belongs to a complex quantitative genetic trait, which is regulated by multiple genes and is easily affected by environmental factors. It is difficult to accurately improve such traits by traditional breeding techniques. With the completion of peanut genome sequencing and assembly (Bertioli et al. 2019; Zhuang et al. 2019; Chen et al. 2019), and at the same time, the cost of high-throughput sequencing has decreased significantly, which provides favorable support for the mining of candidate genes for peanut oil content and the development of functional markers. Candidate genes are a certain type of genes that may be related to the variation of target traits according to the research results of other existing species or through the prediction of specific domains. By analyzing the population resequencing data, the population variation site information is obtained, and the association analysis is carried out on the phenotype and variation sites of the population to obtain the variation sites significantly associated with the phenotype. Then, candidate genes are screened through these significantly associated variation sites, and combined with the genes on the oil synthesis pathway obtained by comparing and annotating other species previously, it is beneficial to quickly mine the major and minor genes of the phenotype and the main functional sites on the genes.

[0004] Although a large number of QTLs related to peanut oil content have been mapped at present. However, since the phenotypic contribution rates of the vast majority of these QTLs are small and the repeatability is poor among different years and environments, these QTLs are difficult to be applied to the genetic improvement of peanut oil content.

[0005] Based on this, the present invention uses the high-density SNP or Indel genotype data of peanut natural population to perform genome-wide association analysis on peanut kernel oil content in 9 environments, aiming to associate stable major functional sites, and accordingly develop molecular markers with practical significance for molecular improvement of peanut kernel oil content. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide an SNP locus related to peanut oil content, and at the same time, conduct technical research and application expansion on its potential applications in theoretical research related to peanut oil content and in peanut molecular breeding, agricultural yield increase, etc.

[0007] To solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0008] An SNP locus related to peanut oil content, the SNP locus is located at the 152042973 base of peanut chromosome A07, the SNP locus corresponds to the 31st base from the 5' end of the sequence shown in SEQ ID NO.1, and this locus has two genotypes, AG and GG. The peanut materials carrying the AG genotype have a significantly higher oil content than the peanut materials carrying the GG genotype.

[0009] As a preferred technical solution of the present invention, the uses are to conduct theoretical research on the development principle of peanut oil content based on the SNP locus, and / or to conduct research on the molecular regulation pathway of peanut oil content development based on the SNP locus; including: based on the SNP locus, confirm, identify and / or distinguish the downstream associated effector molecules through the differences in locus genotypes, and construct a molecular regulation pathway for peanut oil content; the effector molecules include but are not limited to messenger RNA, protein, associated biological enzymes, various molecular regulation components, various molecular signal components; further, on the basis of constructing the molecular regulation pathway for peanut oil content, identify and confirm the major or key regulatory nodes and their corresponding biological macromolecules or small molecule components.

[0010] The present invention also includes the use of the above peanut SNP locus, and the use is to develop molecular markers based on the SNP locus by existing technical means, and further screen or assist in screening the peanut oil content phenotype in the early stage of molecular marker-assisted selection breeding.

[0011] The present invention also includes the use of the above peanut SNP locus, and the use is to regulate the peanut oil content according to production requirements in the agricultural industry, including: increasing the peanut oil content or decreasing the peanut oil content.

[0012] The present invention also includes a gene detection kit for detecting the SNP locus, and the gene detection kit contains a specific primer combination for PCR amplification corresponding to the SNP locus, as well as template DNA, buffer, dNTPs and other necessary components for gene detection.

[0013] As a preferred technical solution of the present invention, the specific primer combination for PCR amplification includes: the primer pair composed of SEQ ID NO.2 and SEQ ID NO.3.

[0014] The present invention also includes a method for identifying or assisting in the identification of peanut oil content at an early stage of breeding. Based on the SNP locus, at an early stage of marker-assisted selection breeding, primers are designed to perform PCR amplification on any DNA fragment containing the SNP locus in the genomic DNA of the peanut to be tested. The genotype of the peanut is identified by digesting the PCR amplification product with an enzyme, and the phenotype of the peanut oil content is identified or assisted in identification based on the following correlation between the genotype and the phenotype: the peanut with the genotype A has a higher peanut oil content than the peanut with the genotype B; the specific primer pair for PCR amplification is the primer pair composed of SEQ ID NO.2 and SEQ ID NO.3.

[0015] As a preferred technical solution of the present invention, the digestion is performed using the restriction endonuclease AvrII.

[0016] As a preferred technical solution of the present invention, the recognition sequence of the restriction endonuclease AvrII is CCTAGG.

[0017] The present invention also includes a primer combination for detecting the SNP locus, including: the primers composed of SEQ ID NO.2 and SEQ ID NO.3.

[0018] The beneficial effects produced by adopting the above technical solutions are as follows: The research group of the present invention performed a genome-wide association analysis of peanut kernel oil content in 9 environments using high-density SNP or Indel genotype data of a peanut natural population, and associated multiple stable major functional loci. Among them, it is worth noting that the newly discovered variant loci with single non-synonymous mutations are located at the 152042037th, 152042706th, and 152042973rd bases of chromosome A07 respectively, and all three SNPs are located on the exon. Among them, 152042037 and 152042706 are homozygous mutations, and 152042973 is a heterozygous mutation.

[0019] Among them, the third mutation above (i.e., the SNP of the present invention) has been verified to constitute a main SNP locus with environmental stability that can significantly affect peanut oil content, and a practical and low-cost molecular marker can be developed based on this for molecular improvement of peanut kernel oil content. Description of the Drawings

[0020] Figure 1 It is a phenotypic distribution map of peanut kernel oil content in a natural population under 9 environments.

[0021] Figure 2 It is a SNP density map of resequencing of a natural population.

[0022] Figure 3 It is a genome-wide association analysis result map of peanut kernel oil content.

[0023] Figure 4 Schematic diagram of the verification results of molecular markers developed using significantly associated loci in an inbred population.

[0024] Figure 5 Schematic diagram of the expression of the associated gene AhyHOC at different developmental stages of peanut kernels.

[0025] Figure 6 Schematic diagram of the accumulation pattern of oil content at different developmental stages of peanut kernels. Detailed implementation manners

[0026] The following examples illustrate the present invention in detail. All kinds of raw materials and equipment used in the present invention are conventional commercially available products and can be directly obtained through market purchase. The materials, reagents, etc. used in the following examples can be obtained from commercial channels without special instructions. The peanut materials used in the following examples are all from the National Crop Germplasm Bank (http: / / icscaas.com.cn / jiguoku / zhongzhiku.htm), and the material information can be found on the Chinese Crop Germplasm Information Network, website: http: / / icgr.caas.net.cn.

[0027] It should be understood that when used in the specification of this application and the appended claims, the term "comprising" indicates the presence of the described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or their combinations. It should also be understood that the term "and / or" used in the specification of this application and the appended claims refers to any combination and all possible combinations of one or more of the associated listed items, and includes these combinations.

[0028] As used in the specification of this application and the appended claims, the term "if" can be interpreted as "when", "once", "in response to determining", or "in response to detecting" according to the context. Similarly, the phrase "if determined" or "if [the described condition or event] is detected" can be interpreted as meaning "once determined", "in response to determining", "once [the described condition or event] is detected", or "in response to detecting [the described condition or event]" according to the context.

[0029] In addition, in the description of the specification and the appended claims of this application, the terms "first", "second", "third", etc. are only used for distinguishing descriptions and should not be construed as indicating or implying relative importance. The reference to "one embodiment" or "some embodiments" etc. described in the specification of this application means that a specific feature, structure, or characteristic described in connection with that embodiment is included in one or more embodiments of this application. Thus, the statements "in one embodiment", "in some embodiments", "in other some embodiments", "in still other embodiments", etc. that appear in different places in this specification do not necessarily all refer to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "comprise", "include", "have" and their variants all mean "including but not limited to", unless otherwise specifically emphasized in other ways.

[0030] Example 1. Overview of Innovative SNP Development Technology

[0031] In the present invention, the peanut materials collected in the early stage are subjected to WGS genomic paired-end PE150 resequencing using the Illumina HiSeq 6000 high-throughput sequencer. The resequencing data after sequencing is subjected to quality control using FastQC (www.bioinformatics.babraham.ac.uk / projects / fastqc). The quality control statistics of the population resequencing data are shown in Table 1.

[0032] Table 1

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042] The sequencing data was mapped to the Arachis hypogaea reference genome (the version number of the Arachis hypogaea reference genome sequence is GCA_004170445.1_ASM417044v1) using the BWA tool, and then SNP identification and InDel detection were performed using HaplotypeCaller of GATK. The obtained variant result file was preliminarily filtered based on sequencing depth and quality metrics using VariantFiltration of GATK to screen out false positives and pseudo-variations. Then, PLINK and VCFtools software were used to strictly filter the genotype file, and the filtering criteria were set as sequencing depth greater than 5X, integrity greater than 0.8, MAF (minor allele frequency) not less than 0.05, missing rate less than 0.2, and conforming to the Hardy-Weinberg law.

[0043] Furthermore, the screened high-quality SNPs were annotated and functionally predicted, and finally 8,610,286 high-quality SNP sites were obtained. The distribution of the identified high-quality SNP sites in the population on chromosomes is as Figure 2 shown.

[0044] Specifically, a total of 97,540 SNP sites were identified in the exon region, including 63,052 transition SNPs and 34,488 transversion SNPs. Classified according to the annotation position, a total of 97,540 exon region SNPs, 4,330,443 intergenic region SNPs, and 24,068 UTR region SNPs were identified. Among all the SNPs in the CDS region, non-synonymous mutations accounted for the highest proportion, with a total of 61,064, synonymous mutations of 34,025, 2,148 SNPs with premature protein translation termination, and 303 stop codon variations.

[0045] Based on the above-obtained 8,610,286 high-quality SNP sites, PLINK and GCTA software were respectively used to perform principal component analysis and kinship analysis on the peanut natural population, obtaining the eigenvector PCA matrix and kinship coefficient Kinship matrix of the population. Combining with the phenotypic data of peanut oil content traits, GEMMA software was used to perform a mixed linear model analysis with population structure as a fixed effect and kinship as a random effect to obtain the association P-value of each SNP with the phenotypic trait. By setting a threshold through Bonferroni correction, significantly associated variant sites were mined, and candidate genes were screened through gene sequence alignment annotation. At the same time, molecular markers were developed at the significantly associated sites for marker-assisted selection (MAS). The proposal of the present invention provides a new technical means for screening and obtaining peanut materials with high oil content.

[0046] Example 2: Phenotypic and Genotypic Identification of Peanut Natural Population

[0047] A natural population consisting of 239 accessions, including the main cultivated varieties and local varieties of peanuts over the years, was selected as the research object. They were planted in multiple locations over multiple years. After shelling, plump seeds of each strain were selected and ground, and the oil content was measured using a Minispec mq-20 nuclear magnetic resonance spectrometer (NMR). The plump seeds (80 - 100 g) of each family were divided into three portions, that is, three values were measured, and the average was taken to represent the oil content of the family. Based on the completed reference genome sequence and gene function annotation information of Fuhuasheng peanut, combined with the existing gene set of the oil synthesis pathway in Arabidopsis thaliana, important genes in the oil synthesis pathway were screened as the candidate gene set. The natural population of peanuts was re-sequenced using an Illumina HiSeq6000 high-throughput sequencer. The data downloaded after re-sequencing was quality-controlled using FastQC (www.bioinformatics.babraham.ac.uk / projects / fastqc). The sequencing data was mapped back to the Fuhuasheng peanut reference genome using the default parameters of BWA (bio-bwa.sourceforge.net). Then, SNP identification and InDel detection were performed using the software GATK (software.broadinstitute.org / gatk). The obtained variant result file was preliminarily filtered using VariantFiltration of GATK to screen out false positives and pseudo-variations. Then, the genotype file was strictly filtered using the PLINK and VCFtools software. The filtering criteria were set as sequencing depth greater than 5X, integrity greater than 0.8, MAF (minor allele frequency) not less than 0.05, deletion rate less than 0.2, and conforming to the Hardy-Weinberg law. The ANNOVAR software was used to annotate and predict the functions of the selected high-quality SNPs, and a self-written Python script was used to extract the variant information in the target region to obtain the final genotype typing file of the peanut natural population.

[0048] Example 3: Genome-wide association analysis of the kernel oil content in the peanut natural population

[0049] Genome-wide association analysis was performed based on the obtained oil content phenotypic data and population genotype data to screen for strongly associated loci between phenotypes and variant sites, and to lock in important functional genes that were significantly correlated with the phenotypic variation of oil content. The haplotype information between different materials was analyzed, and the phenotypic variation differences between materials corresponding to each allelic variation were compared to determine excellent allelic variations.

[0050] Example 4: Design of SNP markers (dCAPS molecular markers)

[0051] Three non-synonymous mutations were found, among which the first two were homozygous mutations and the third one, 152042973, was a heterozygous mutation. The variant type at the locus was A / G. The molecular markers were designed using the online tool dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / dcaps.html). By analyzing the optimal restriction sites and selecting restriction endonucleases, functional markers were developed. Molecular markers were designed at the above-mentioned 3 SNP loci, named OM1, OM2, and OM3 respectively. Among them, OM1 was the recognition site of the VspI restriction endonuclease, OM2 was the recognition site of the Bsp1407I restriction endonuclease, and OM3 was the recognition site of the AvrII restriction endonuclease.

[0052] For the major SNP - OM3, its related sequence information is as follows:

[0053] GTATCCATCCTTACATCTCCTACTACTGGT A / G GGGTGACCGCCAGTTTCGGCATGTTGGGCGATATCATTATTGCCGAACCCGATGCTTACATTGCATTTGCGGGTAAAAGAGTAATTGAACAAACGTTGAATAC GACAATACCCGAAGGTTCACAAGTAGCTGAATATTTATTCCAAAAGGGCTTATTTGATTCAATCGTACC GCGTAATCCTTTAAAAGGGGTTTTAAGTGAGTTATTTCAGCTCCATGCTTTCTTCCCTTTGTGA (SEQ ID NO.1); The SNP is located at the 31st base from the 5' end of the sequence shown in SEQ ID NO.1.

[0054] The sequences for developing the molecular markers are as follows:

[0055] ③ The recognition sequence of OM3 is CCTAGG, and the primer pair is OP3:

[0056] Forward primer: 5’GTATCCATCCTTACATCTCCTACTACTCCT 3’ (SEQ ID NO.2);

[0057] Reverse primer: 5’TCACAAAGGGAAGAAAGCAT3’ (SEQ ID NO.3).

[0058] On this basis, conventional existing techniques can be used for restriction fragment length polymorphism (RFLP) detection and genotyping. The reference steps are as follows: 1) Extract the genomic DNA of the peanut to be tested; 2) Using the genomic DNA obtained in step 1) as a template, perform PCR amplification with the forward primer OP3 and the reverse primer OP3. The PCR amplification system (10 μL) is as follows: 7 μL of ddH2O, 1 μL of 10×PCR Buffer, 0.3 μL each of the forward primer (5 μmol / L) and the reverse primer (5 μmol / L), 0.6 μL of dNTP (2.5 μmol / L), 0.1 μL of Taq enzyme, and 0.7 μL of the template (20 ng / μL). The PCR amplification conditions are 94°C for 5 min; 94°C for 45 s, 57°C for 45 s, 72°C for 1 min, for 30 cycles; 72°C for 10 min, and store at 4°C. 3) Digest the PCR product obtained in step 2) with the AvrII restriction endonuclease to obtain a digested product, perform 3% agarose gel electrophoresis detection, record whether the PCR product is cut into two fragments, and judge and record the situation of the peanut to be tested at the said locus according to the following method: If the digested product is two fragments, the peanut to be tested is a peanut with A at the said locus; if the digested product is one fragment, the peanut to be tested is a peanut with G at the said locus. Finally, according to the results of step 3), the peanuts are classified into two types, I and II, at the said locus: I: A / G; II: G / G; the situation before the " / " is the situation on one homologous chromosome, and the situation after the " / " is the situation on the other homologous chromosome.

[0059] Example 5. Verification of Molecular Markers Developed from Genome-Wide Association Significant Loci in an Inbred Population

[0060] To verify whether the said molecular marker can be used to screen peanut materials with different oil contents, molecular markers designed based on SNP loci significantly associated with oil content in genome-wide association analysis were used to genotype 192 peanut inbred lines, and the genotypes of the markers were obtained. The results showed that the marker classified the population into two categories. The green ones were inbred lines carrying the AG genotype, and the pink ones were inbred lines carrying the GG genotype. Combining with the phenotypic data of the oil content of the inbred line seeds, a T-test was performed. The results showed that the oil content of the inbred line materials carrying the AG genotype was extremely significantly higher than that of the inbred line materials carrying the GG genotype (as Figure 4 shown).

[0061] The above results indicate that the SNP molecular markers obtained by the present invention are expected to be used for screening and breeding of peanut oil content based on techniques such as marker-assisted selection (MAS), and further classifying and eliminating materials with different peanut oil contents in the field; in order to achieve efficient, low-cost, and rapid screening of plants with high peanut kernel oil content and use them to cultivate peanut varieties with high oil content.

[0062] Example 6: Genotyping of Natural Populations and Association Analysis of Oil Content Traits

[0063] Each peanut in a natural population consisting of 190 tetraploid peanuts was used as a peanut to be tested for genotyping, and the amplification products of some peanuts were randomly selected for sequencing verification. The results are shown in Table 1 below (AG: Type I; GG: Type II).

[0064] Table 1 Situation of the Polymorphic Loci in the Peanut Natural Population

[0065]

[0066]

[0067]

[0068] Example 7: Association Analysis of the Situation of Gene Polymorphic Loci and Oil Content in Natural Populations

[0069] During 2022 - 2023, the above peanut population was planted at the Gaocheng Diti Experimental Station in Shijiazhuang City, Hebei Province. The oil content of each peanut variety was measured, and the gemma software was used to perform association analysis on the oil content and the situation of the polymorphic loci. The mixed linear model + population structure (MLM+(Q+K)) method was selected for analysis, with P<0.05 as the significance level. The results are shown in Table 2

[0070] Table 2 Results of Association Analysis of the Situation of Gene Polymorphic Loci and Oil Content in Natural Populations

[0071]

[0072]

[0073] The association analysis results in Table 2 show that the differences in oil content between the two types formed by the natural population of 190 tetraploid peanuts shown in Table 1 all reached a significant level (P<0.05). Among them, the oil content of peanuts of Type I was higher than that of peanuts of Type II. In the two environments, the oil content of peanut materials of Type I was 2.31 and 2.16 percentage points higher than that of peanuts of Type II on average. The study of the natural population shows that Type I is an excellent genotype for improving peanut oil content.

[0074] Example 8: Expression of Gene AhyHOC at Different Developmental Stages of Peanut Kernels

[0075] According to the annotation results of the Fuhuasheng reference genome (Chen et al, 2019), the gene AhyHOC is expressed in the oil synthesis pathway and also in the oil metabolism pathway. It is a gene encoding acetyl-CoA carboxylase, which catalyzes the synthesis of malonyl-CoA from acetyl-CoA during oil biosynthesis, providing three-carbon compounds for fatty acid synthesis. Acetyl-CoA carboxylase is the rate-limiting enzyme in fatty acid synthesis reaction, allosterically activated by citrate and feedback inhibited by palmitoyl-CoA. The expression level of this gene rises rapidly at the initial stage of peanut kernel development, decreases slowly during the kernel filling period, and approaches zero at the full maturity stage of the kernel ( Figure 5 ). The oil content accumulation in peanuts shows a pattern of rapid increase - slow increase - tending to be constant during kernel development ( Figure 6 ), which is basically consistent with the expression trend of this gene. Similar to this, the expression level of this gene is equivalent to the tangent slope of the oil content accumulation in peanut kernels.

[0076] In summary, the third SNP developed in the present invention has been verified to form an environmentally stable major SNP locus that can significantly affect peanut oil content. Primers and markers developed based on this SNP locus by conventional technical means can effectively distinguish peanut materials with high and low oil content, and have reliable accuracy and applicability in the identification of peanut oil content; practical and low-cost molecular markers can be developed based on this for molecular improvement of peanut kernel oil content.

[0077] In the above embodiments, the descriptions of each embodiment have their own focuses. For parts not detailed or recorded in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0078] Although the embodiments of the present invention have been shown and described, for those of ordinary skill in the art, it can be understood that various changes, modifications, substitutions, and variations can be made to these examples without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.

[0079] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent substitutions on some of the technical features; and these modifications or substitutions do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.

Claims

1. Use of a reagent for detecting peanut SNP loci in the preparation of a product for identifying or assisting in the identification of peanut oil content products, characterized in that: The SNP locus is located at the 152042973 base of chromosome A07 of peanut, and the reference genome sequence version number is GCA_004170445.1_ASM417044v1. This locus has two genotypes, AG and GG; the application is to identify or assist in identifying the oil content of peanut. The oil content of peanut materials carrying the AG genotype is extremely significantly higher than that of peanut materials carrying the GG genotype.

2. Gene detection kit, characterized in that: For detecting the SNP locus described in claim 1, the gene detection kit contains a PCR amplification specific primer combination corresponding to the SNP locus, as well as template DNA, buffer, dNTPs, and other necessary components for gene detection; The PCR amplification specific primer combination includes: the primer pair composed of SEQ ID NO.2 and SEQ ID NO.

3.

3. A method for early identification or assisted identification of peanut oil content in the early stage of breeding, characterized in that: Based on the SNP locus described in claim 1, in the early stage of molecular marker-assisted selection breeding, primers are designed to perform PCR amplification on any DNA fragment containing the SNP locus in the genomic DNA of the peanut to be tested. The genotype of the peanut is identified by enzyme digestion of the PCR amplification product, and the oil content phenotype of the peanut is identified or assisted in identification based on the following association relationship between the genotype and the phenotype: the oil content of peanut materials carrying the AG genotype is higher than that of peanut materials carrying the GG genotype; the specific primer pair for PCR amplification is the primer pair composed of SEQ ID NO.2 and SEQ ID NO.

3.

4. The method according to claim 3, wherein: The enzyme digestion uses the restriction endonuclease AvrII.

5. The method according to claim 4, wherein: The recognition sequence of the restriction endonuclease AvrII is CCTAGG.

6. A primer combination for detecting the SNP locus recited in claim 1, comprising: The primers composed of SEQ ID NO.2 and SEQ ID NO.3.

Images