Application of Cotton WRKY59 Transcription Factor in Improving Cotton Resistance to Verticillium Wilt
By overexpressing WRKY59 transcription factor in cotton, recombinant technology is used to improve cotton's resistance to verticillium wort, solving the problem of cotton's verticillium wort prevention and treatment in the prior art, and achieving a significant effect of improving cotton's disease resistance.
Patent Information
- Application Number
- CN202411350555.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-26
- Publication Date
- 2025-07-01
- Estimated Expiration
- 2044-09-26
AI Technical Summary
The prior art is difficult to effectively prevent and treat cotton Verticillium wilt, and the breeding of transgenic disease-resistant germplasm is progressing slowly, which has failed to systematically clarify the cotton Verticillium wilt mechanism.
By overexpressing WRKY59 transcription factor or recombinant technology in cotton, recombinant vectors and recombinant strains are used to improve the resistance of cotton to verticillium wort.
The resistance of transgenic cotton to Verticillium wort was significantly improved. Compared with non-transgenic wild-type cotton, the disease index of transgenic cotton was significantly reduced after inoculation with Verticillium wort bacteria, indicating that overexpression of WRKY59 transcription factor effectively improved the disease resistance of cotton.
Smart Images

Figure CN119061060B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering, and specifically relates to the application of cotton WRKY59 transcription factor in improving the Verticillium wilt resistance of cotton. Background Art
[0002] Cotton Verticillium wilt is a soil-borne vascular fungal disease mainly caused by Verticillium dahliae Kleb, which can occur throughout the life cycle of cotton, resulting in a significant reduction in cotton yield and a decline in fiber quality, and is known as the "cancer" of cotton. At present, there are no specific fungicides and other defense measures that can effectively control cotton Verticillium wilt. Breeding disease-resistant varieties is considered to be an economical and effective way to control the damage of Verticillium wilt.
[0003] At present, a series of genes related to cotton Verticillium wilt resistance have been identified and isolated (https: / / doi.org / 10.1186 / s42397-021-00109-0). These genes have played disease-resistant functions in terms of tissue structure resistance, physiological and biochemical resistance, R gene-mediated resistance, hormone-mediated disease-resistant signaling pathways and their interactions, etc., providing certain gene resources for enhancing the Verticillium wilt resistance of cotton. However, the breeding progress of cotton transgenic disease-resistant germplasms is slow, and these genes still cannot systematically clarify the mechanism of cotton Verticillium wilt resistance, nor can they overcome the pathogenicity of continuously evolving Verticillium dahliae. Therefore, the key to the long-term and effective Verticillium wilt resistance of cotton lies in exploring more disease-resistant genes and creating more new Verticillium wilt-resistant germplasms through genetic engineering.
[0004] Transcription factors play an essential role in the signal transduction pathway of plant stress resistance, and can co-regulate the expression of multiple stress-responsive genes in terms of time and space. Using transcription factors to improve the stress and disease resistance of plants is considered to be an effective improvement approach. WRKY transcription factors are key regulators for plants to respond to pathogen infection. However, there are few relevant reports on the Verticillium wilt resistance of WRKY transcription factors in cotton at present, and the regulatory mechanism of WRKY transcription factors in response to cotton Verticillium wilt is still unclear. Summary of the Invention
[0005] Object of the Invention: The technical problem to be solved by the present invention is to provide the application of cotton WRKY59 transcription factor or WRKY59 gene encoding the transcription factor in cultivating Verticillium wilt-resistant cotton.
[0006] Another technical problem to be solved by the present invention is to provide the application of an expression cassette, recombinant vector or recombinant strain containing the WRKY59 gene in cultivating Verticillium wilt-resistant cotton.
[0007] Finally, the technical problem to be solved by the present invention is to provide a method for cultivating Verticillium wilt-resistant cotton.
[0008] Technical solution: To solve the above technical problems, the present invention provides the application of the cotton WRKY59 transcription factor or the WRKY59 gene encoding the transcription factor in cultivating cotton resistant to Verticillium wilt, characterized in that the amino acid sequence of the cotton WRKY59 transcription factor is as shown in SEQ ID NO.2, and the nucleotide sequence of the WRKY59 gene is as shown in SEQ ID NO.1 or a nucleotide sequence having at least 98% identity with SEQ ID NO.1.
[0009] The present invention also includes the application of an expression cassette, a recombinant vector or a recombinant strain containing the WRKY59 gene in cultivating cotton resistant to Verticillium wilt, and the nucleotide sequence of the WRKY59 gene is as shown in SEQ ID NO.1 or a nucleotide sequence having at least 98% identity with SEQ ID NO.1.
[0010] Among them, the recombinant vector is obtained by introducing the WRKY59 gene into an overexpression vector.
[0011] Among them, the overexpression vector includes pCAMBIA2301.
[0012] Among them, the application includes obtaining cotton resistant to Verticillium wilt by gene editing, transgenic, mutagenesis, hybridization, backcross or asexual reproduction methods.
[0013] The present invention also includes a method for cultivating cotton resistant to Verticillium wilt, and the method includes:
[0014] (1) Overexpressing the WRKY59 gene in the cotton, and the nucleotide sequence of the WRKY59 gene is as shown in SEQ ID NO.1; or
[0015] (2) Overexpressing the cotton WRKY59 transcription factor in the cotton, and the amino acid sequence of the cotton WRKY59 transcription factor is as shown in SEQ ID NO.2.
[0016] Among them, the steps in step (1) are: introducing the WRKY59 gene into a plant expression vector to obtain a cotton WRKY59 overexpression vector, introducing the cotton WRKY59 overexpression vector into Agrobacterium to obtain engineering Agrobacterium, and transforming the engineering Agrobacterium into cotton to obtain transgenic cotton plants.
[0017] Among them, the plant expression vector includes pCAMBIA230.
[0018] Among them, the Agrobacterium includes EAH105.
[0019] Beneficial effects: Compared with the prior art, the present invention has the following advantages: Overexpression of the WRKY59 gene in cotton significantly improves the resistance of transgenic cotton to Verticillium wilt. On the 16th day after inoculation with Verticillium dahliae, the disease index of transgenic cotton is 23.64 - 38.0%, while that of the non-transgenic wild-type control is as high as 53.85%. On the 22nd day, the disease index of transgenic cotton is 45.46% - 50.0%, while that of the non-transgenic wild-type control is 70.0%. Brief description of the drawings
[0020] Figure 1 PCR electrophoresis map for cloning of cotton WRKY59 gene; from left to right are Marker, cotton DNA 1 - 4; among them, Marker from top to bottom are 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp respectively.
[0021] Figure 2 Plant expression vector map of cotton WRKY59 gene.
[0022] Figure 3 PCR identification results of some T0 generation individual plants of transgenic WRKY59 cotton; from left to right are Marker, cotton T0 generation seedling DNA 1 - 6; among them, Marker from top to bottom are 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp respectively.
[0023] Figure 4 Improved resistance of transgenic WRKY59 cotton to Verticillium wilt after inoculation with Verticillium dahliae; 18 days after inoculation with Verticillium dahliae, cotton resistant and susceptible phenotypes, where WT is non-transgenic wild-type line, #20 - 2, #12 - 2 are independent lines of cotton WRKY59 transgenic plants.
[0024] Figure 5 Disease index of transgenic WRKY59 cotton after inoculation with Verticillium dahliae; 16 - 22 days after inoculation with Verticillium dahliae, WT is non-transgenic wild-type, #20 - 2, #12 - 2 are independent lines of cotton WRKY59 transgenic plants, and the disease index of transgenic lines is significantly lower than that of non-transgenic wild-type lines, indicating that overexpression of WRKY59 gene improves disease resistance.
[0025] Figure 6 qPCR detection results of pathogen biomass in the stems of cotton seedlings after inoculation with Verticillium dahliae; WT is non-transgenic wild-type, #20 - 2, #12 - 2 are independent lines of cotton WRKY59 transgenic plants, and the pathogen biomass of transgenic lines is significantly lower than that of non-transgenic wild-type lines, indicating that overexpression of WRKY59 gene improves disease resistance.
[0026] Figure 7 RT-qPCR detection results of the expression level of the disease resistance-related gene PR1 in the leaves after inoculating cotton seedlings with Verticillium dahliae; WT is non-transgenic wild type, #20-2 and #12-2 are independent transgenic lines of cotton WRKY59, control is the control treatment without inoculating Verticillium dahliae, V.d is the treatment of inoculating Verticillium dahliae; the expression level of the transgenic line GhPR1 gene is significantly higher than that of the non-transgenic wild type line. Specific implementation manners
[0027] The following will describe the implementation schemes of the present invention in detail in combination with embodiments. However, those skilled in the art will understand that the following embodiments are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. For those not specified in the embodiments, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. For the reagents or instruments not specified for the manufacturer, they are all conventional products that can be obtained through commercial purchase.
[0028] Example 1 Analysis of the differences in the WRKY59 gene sequences among different cotton materials
[0029] According to the transcriptome results of cotton inoculated with Verticillium dahliae, we selected a gene GH_D12G2738 that responds to Verticillium dahliae induction. The gene was subjected to blast alignment analysis in NCBI and was found to be annotated as WRKY59.
[0030] Using the gene ID "GH_D12G2738" as the search term, further search for the gene SNP and InDel variations of the WRKY59 gene in the upland cotton (Gossypium hirsutum) and sea island cotton (Gossypium barbadense) populations on the Cotton Omics Database website (http: / / cotton.zju.edu.cn / index.htm). The results are shown in Table 1. The first 14 variations are the variations of the WRKY59 gene in upland cotton, including 9 exon variations and 5 intron variations; the last 14 variations are the variations of the WRKY59 gene in sea island cotton, including 10 exon variations and 4 intron variations. This result indicates that there are certain variations in the WRKY59 gene sequence in the cotton population.
[0031] Table 1 Variations of the WRKY59 gene in the upland cotton and sea island cotton populations
[0032]
[0033]
[0034]
[0035] Example 2 Cloning and Sequence Analysis of Cotton WRKY59 Gene
[0036] According to the cotton reference genome sequence, primers WRKY59-F3 were designed:
[0037] TTTAAAGCCCTAACCCCCATTGTC and WRKY59-R3:
[0038] ACATATCACCAACAAAGTATTTTTCG. Using the genomic DNA of Gossypium hirsutum cv. TM-1 (Wang Peng et al., Cultivation of Gossypium barbadense chromosome segment substitution lines with the background of Gossypium hirsutum genetic standard line TM-1. Chinese Science Bulletin, 2008, 53(9): 1065-1069), Simian 3 (Zhang Peitong et al., QTL mapping of yield and its components in high-yield cotton variety Simian 3. Acta Agronomica Sinica, 2006, 32(8): 1197-1203), CCRI 37 (Lv Yangchun et al., Performance of CCRI 37 in Chaoyang trial. China Cotton, 2002, 6: 38), and Ao 3503 (Liu Tingli et al., Studies on the culture characteristics, pathogenic types, pathogenicity differentiation and ISSR genetic variation of Verticillium dahliae in cotton in northern Xinjiang. Acta Gossypii Sinica, 2017, 29(6): 541-549) as templates respectively, the cotton WRKY59 gene sequence was amplified by PCR with the high-fidelity enzyme phanta (Nanjing Novoprotein Scientific Co., Ltd.). The PCR reaction system was as follows: 2×Phanta Max Buffer 10 μl, dNTP Mix (10 mM each) 0.4 μl, 10 μM forward primer 0.5 μl, 10 μM reverse primer 0.5 μl, cDNA 1 μl, Phanta Max Super-Fidelity DNA Polymerase (1 U / μl) 0.2 μl, supplemented with sterile water to 20 μl. The PCR amplification reaction procedure was as follows: pre-denaturation: 95°C for 3 min; 35 cycles: denaturation at 95°C for 30 sec; annealing at 58°C for 30 sec, extension at 72°C for 1 min; incubation: 72°C for 5 min. Take 4 μl of the PCR product and detect it by 1.2% agarose gel electrophoresis. The results are as Figure 1 shown. Specific target bands of 1208 bp that meet the expectations can be amplified from all four DNA templates.
[0039] The PCR products were sent to Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the obtained WRKY59 genomic sequence was 100% identical to the cotton TM-1 reference genome sequence, indicating that there were no SNP and InDel variations between the WRKY59 genes of Simian 3, CCRI 37, and 3503 and the reference genome TM-1.
[0040] Example 3 Cloning of Cotton WRKY59 CDS and Construction of Overexpression Vector
[0041] Select cotton TM-1 leaves, extract total RNA using Novoprotein FastPure Complex Tissue / Cell Total RNA Isolation Kit. After the quality of the total RNA is qualified by electrophoresis, reverse transcribe it into cDNA using Novoprotein HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper).
[0042] According to the reference genome sequence of cotton WRKY59 (Cotton Omics Database website http: / / cotton.zju.edu.cn / index.htm , gene ID: GH_D12G2738), design primers WRKY59-F4: ATCCTCTAGAACTAGAATGGAGGACATGGAAGAACGGGAAC and WRKY59-R4: TCTGAGCTTTATTGCCATTAGGAAAAGAAACCATGGTCATC. Using the obtained cDNA as a template, amplify the 858bp CDS sequence of the WRKY59 gene with the high-fidelity enzyme phanta (Nanjing Novoprotein Biotechnology Co., Ltd.). The PCR reaction system and PCR amplification reaction program refer to Example 2. Take 4μl of the PCR product and detect it by 1.2% agarose gel electrophoresis. If the expected band is found, the remaining product is purified and recovered using a PCR clean-up kit (purchased from Axygen). Then clone the WRKY59 gene fragment into the plant expression vector pCAMBIA2301 digested with BamHI using Novoprotein ClonExpress II One Step Cloning Kit. The homologous ligation system is as follows: 5×CEII buffer 2μL, Exnase 1μL, PCR product 4μL, 75 - 100ng of the digested linearized pCAMBIA2301 vector 3uL, for a total of 10μL. Mix the above system and react at 37°C for 30 min. Then add the entire 10μL ligation product to 30μL of Escherichia coli DH5α competent cells, mix gently, place at room temperature for 5 min, and then heat shock to transform Escherichia coli. Plate and culture overnight on an LB plate containing 50mg / L kanamycin. The next day, the clones verified to be positive by PCR are sent to Tsingke Biotechnology Co., Ltd. for sequencing. The plasmid of the clone with correct sequencing is named 2301-GhWRKY59.
[0043] Example 4 Agrobacterium-Mediated Genetic Transformation of Cotton
[0044] The obtained 2301-GhWRKY59 plant expression vector was transferred into the Agrobacterium strain EAH105 by the freeze-thaw method. Referring to the method of this laboratory (Tianzi Chen, et al. Cultivation and genetic transformation of high-efficiency somatic embryogenesis lines of Xinjiang upland cotton. Molecular Plant Breeding, 2013, 11(6): 775-782), the cotyledons and hypocotyl explants of Simian 3 cotton were transformed by the Agrobacterium-mediated method to obtain transgenic cotton materials.
[0045] The T0 regenerated cotton plants and their T1 and T2 progeny cotton plants were verified by PCR with the specific primer pair PPDK-F1: CGTGCAGGATTCACCCGTTCGCC and NOS-R3: GCAAGACCGGCAACAGGATTCAATC, and all contained a transgenic specific target band of approximately 1.2 kb ( Figure 3 ), indicating that the GhWRKY59 transgenic cotton was successfully obtained.
[0046] Example 5 Disease Resistance Identification of WRKY59 Transgenic Cotton
[0047] Referring to the method of this laboratory (Tianzi Chen, et al., A Ve homologous gene from Gossypium barbadense, Gbvdr3, enhances the defense response against Verticillium dahliae. Plant Physiology and Biochemistry, 2016, 98: 101-111), two transgenic T3 lines (#12-2, #20-2) obtained in Example 4 and the wild-type receptor Simian 3 cotton were inoculated with the Verticillium dahliae strain TV-4 carrying green fluorescent protein GFP (Tianzi Chen, et al., Optimization of the Agrobacterium-mediated transformation system for Verticillium dahliae. Cotton Science, 2011, 23(6): 507-514) for disease resistance identification. The specific steps are as follows: Cotton seeds were sown in plastic cups containing nutrient soil, 5 seeds per cup, and cultured indoors at 25 degrees with a 16 h / 8 h light cycle. TV4 was cultured in liquid 1 / 2 PDB (2.0 g / L potato extract, 10.0 g / L glucose, pH 7.0) at 25 degrees on a shaker at 120 rpm. When the cotton seedlings grew to the two-leaf and one-heart stage, weak seedlings were removed, and the seedlings with uniform growth were left. The bottom of the cup was cut off with scissors, and a new plastic cup containing 20 mL of TV4 bacteria (spore concentration 1.5×10 7 cfu / mL) was put on, so that the spore solution could be fully absorbed by the cotton seedling roots. The seedlings were continuously cultured under the same environmental conditions, and the disease occurrence process was observed regularly. Starting from 16 days post inoculation (16 dpi), the disease grades of the cotton plant leaves were investigated every 2 days.
[0048] Disease grading: The diseases of each cotton strain were counted according to the new 5-grade disease grading standard. Grade 0: The cotton plants are healthy, without diseased leaves and grow normally; Grade 1: 1%-33% of the leaf area of the cotton plants is diseased and turns yellow and wilts; Grade 2: 34%-66% of the leaf area of the cotton plants is diseased and turns yellow and wilts; Grade 3: 67%-99% of the leaf area of the cotton plants is diseased and turns yellow and wilts; Grade 4: All the leaves of the cotton plants fall off and the cotton plants die. Calculation method of disease index: Disease index = [∑(number of diseased plants at each level × corresponding disease level) / total number of plants surveyed × highest disease level (4)] × 100.
[0049] At 16 dpi after inoculation with Verticillium dahliae, the disease indices of the two transgenic lines were 23.64% and 38.0%, while that of the wild-type receptor was 53.85%; the disease indices of each line increased with time. At 22 dpi, the disease indices of the two transgenic lines were 45.46% and 50.0%, while that of the wild-type receptor was 70.0% ( Figure 4 , Figure 5 ), indicating that the overexpression of GhWRKY59 significantly improved the resistance of transgenic cotton to Verticillium wilt.
[0050] Example 6 qPCR detection of Verticillium dahliae biomass in WRKY59 transgenic cotton
[0051] For the cotton seedlings used for disease resistance identification by inoculating with the Verticillium dahliae strain TV-4 in Example 5, at 22 days (25 dpi) after inoculation, take the hypocotyl segments of each cotton strain and extract the total DNA using the CW Biotech Plant Genomic DNA Extraction Kit (product number CW0531). Referring to the reference (Chi Li et al., Verticillium dahliae Effector VdCE11 Contributes to Virulence by Promoting Accumulation and Activity of the Aspartic Protease GhAP1 from Cotton. Microbiology Spectrum, 2023, 11(1):), using the VdEF-1a gene of Verticillium dahliae as the target gene and GhSSU of cotton as the internal reference gene, perform qPCR with the Novoprotein ChamQ Universal SYBR qPCR Master Mix to detect the relative content of Verticillium dahliae in the stems of cotton seedlings. Each strain was detected with no less than 7 individual plants.
[0052] The primer sequences are as follows: VdEF1a-F: TGAGTTCGAGGCTGGTATCT and VdEF1a-R: CACTTGGTGGTGTCCATCTT, GhSSU-F: AACTTAAAGGAATTGACGGAAG and GhSSU-R: GCATCACAGACCTGTTATTGCC. The qPCR amplification system is as follows: 7 μl of 2×SYBR qPCR Master Mix, 0.5 μl of 10 μM forward primer, 0.5 μl of 10 μM reverse primer, 1 μl of DNA, and sterile water is added to make up 14 μl. The qPCR amplification reaction procedure is as follows: pre-denaturation: 95°C for 3 min; 40 cycles: denaturation at 95°C for 15 sec; annealing at 60°C for 20 sec, and extension at 72°C for 20 sec.
[0053] The qPCR results showed that the biomass of Verticillium dahliae in the hypocotyls of transgenic lines (#12-2, #20-2) was significantly less than that of the wild-type WT plants ( Figure 6 ), indicating that overexpression of GhWRKY59 transgenic can improve the resistance of transgenic cotton to Verticillium wilt.
[0054] Example 7 Expression of PR1 gene in WRKY59 transgenic cotton
[0055] For the cotton seedlings used for disease resistance identification by inoculating the Verticillium dahliae strain TV-4 in Example 5, total RNA was extracted from young leaves before inoculation and 22 days after inoculation. The total RNA was extracted using the Novozymes FastPure Complex Tissue / Cell Total RNA Isolation Kit. After the quality of the total RNA was qualified by electrophoresis, it was reverse-transcribed into cDNA using the Novozymes HiScriptII 1st Strand cDNA Synthesis Kit (+gDNA wiper). Using the cotton GhPR1 gene as the target gene and cotton GhUBQ14 as the internal reference gene, qPCR was performed using the Novozymes ChamQ Universal SYBR qPCR Master Mix to detect the relative expression level of the disease resistance-related PR1 gene in the leaves of cotton seedlings. Three individual plants were detected for each line.
[0056] The primer sequences are as follows: GhUBQ14-QF1: CAACGCTCCATCTTGTCCT and GhUBQ14-QR1: TGATCGTCTTTCCCGTAAGC, GhPR1-QF1: GGCACAGAACTACGCTAATCAACG and GhPR1-QR1: GCTTTACCCTCTCACTAACCCACAT. The PCR amplification system and qPCR amplification reaction procedure refer to Example 6.
[0057] The qPCR results showed that after inoculation with Verticillium dahliae strain TV-4, the expression levels of the resistance-related gene GhPR1 were significantly increased in the transgenic lines (#12-2, #20-2) Figure 7 ), indicating that the overexpression of GhWRKY59 significantly increased the expression of the resistance-related gene PR1, thereby enhancing the resistance of transgenic cotton to Verticillium wilt.
Claims
1. Cotton WRKY59 transcription factor or a gene encoding the transcription factor WRKY59 The application of the gene in breeding cotton resistant to Verticillium wilt is characterized in that: The amino acid sequence of the cotton WRKY59 transcription factor is shown in SEQ ID NO.
2. WRKY59 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the application is to overexpress the cotton WRKY59 transcription factor.
2. Contains WRKY59 The use of a gene expression cassette, a recombinant vector or a recombinant strain in cultivating cotton resistant to Verticillium wilt is characterized in that: Said WRKY59 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the application is to overexpress the WRKY59 Gene.
3. The use according to claim 2, characterized in that: The recombinant vector is WRKY59 The gene was introduced into an overexpression vector.
4. The use according to claim 3, characterized in that: The overexpression vector includes pCAMBIA2301.
5. The use according to any one of claims 1 to 4, characterized in that: The application includes obtaining cotton with resistance to Verticillium wilt by transgenic method.
6. A method for cultivating cotton resistant to Verticillium wilt, characterized in that: The method comprises: (1) Overexpression in cotton WRKY59 Gene, WRKY59 The nucleotide sequence of the gene is shown in SEQ ID NO.1; or (2) Overexpressing cotton WRKY59 transcription factor in cotton, wherein the amino acid sequence of the cotton WRKY59 transcription factor is shown in SEQ ID NO.
2.
7. The method for cultivating cotton resistant to Verticillium wilt according to claim 6, characterized in that: The step (1) includes the following steps: WRKY59 The gene is introduced into a plant expression vector to obtain a cotton WRKY59 overexpression vector, the cotton WRKY59 overexpression vector is introduced into Agrobacterium to obtain an engineered Agrobacterium, the engineered Agrobacterium is transformed into cotton to obtain a transgenic cotton plant.
8. The method for cultivating cotton resistant to Verticillium wilt according to claim 7, characterized in that: The plant expression vector includes pCAMBIA230.
9. The method for cultivating cotton resistant to Verticillium wilt according to claim 7, characterized in that: The Agrobacterium includes EAH105.
Citation Information
Patent Citations
Transcription factor for regulating and controlling aging of leaf blades and improving multiple stress tolerance and application thereof
CN102964439A
Gene GauRev2 capable of remarkably improving verticillium wilt resistance of cotton and application of gene GauRev2
CN113234729A