A microsatellite DNA amplification primer pair and second-generation sequencing method

Abstract

The invention relates to the field of biological genetic engineering, and in particular to a microsatellite DNA amplification primer pair and a second-generation sequencing method; the primer pair comprises a left primer and a right primer, the primer comprises a TA[barcode] region and a conserved sequence binding region, the conserved sequence binding region of the left primer is AAAAGAGAGAGAGAGT, and the corresponding conserved sequence binding region of the right primer is TCTCTCTCTCTCTCCA, the TA[barcode] region is connected to the 5' end of the left primer or the right primer, the sequencing method has low cost but increased rate, and is a mixed sample sequencing after PCR amplification, which can make the amount of data output by sequencing more uniform.

Description

Technical Field

[0001] The invention relates to the field of biological genetic engineering, and in particular to a microsatellite DNA amplification primer pair and a second-generation sequencing method. Background Art

[0002] The rapid development of high-throughput sequencing technology has significantly increased sequencing throughput and rapidly reduced costs. Researchers can obtain genome sequence information of individuals or groups more directly and comprehensively through sequencing. In theory, genome sequencing can obtain almost all variations in its genome, providing the most comprehensive materials for genetic research, animal and plant breeding, and disease research. However, in population-level research, deep whole-genome sequencing of hundreds or thousands of samples requires extremely high costs.

[0003] Genome sequencing is the use of specific technical means to analyze the deoxyribonucleic acid (DNA) base sequence in the genome. With the advancement of technology, genome sequencing methods have evolved from first-generation sequencing (Sanger sequencing) to second-generation sequencing (including 454 and Illumina platforms) and third-generation sequencing (such as PacBio and Nanopore). The cost of sequencing continues to decrease, which has increased sequencing throughput and shortened sequencing time. Therefore, genome sequencing technology is widely used in more research fields. Genome sequences provide important theoretical basis for studying gene functions, associations between genes, and coordination of various parts of the genome. For example, in agriculture, high-throughput sequencing technology provides new opportunities for germplasm resource identification, location of important traits, and functional genome mining, thereby promoting animal and plant genome selection breeding, accelerating the breeding process, and improving the efficiency of molecular breeding.

[0004] Next-generation sequencing (NGS) is a high-throughput DNA sequencing technology based on the development of PCR and gene chips. Its technical process mainly includes steps such as genomic DNA extraction, library construction, sequencing on the machine, and data analysis. Library construction is the modification process of DNA fragments and adapters, which is a key link in the entire second-generation sequencing process, and its quality directly affects the quality of subsequent sequencing data. All second-generation sequencing platforms require a gene library containing adapter sequences formed by specific primers or connections. Usually, DNA is randomly cleaved by enzyme treatment or ultrasonic treatment, and the optimal fragment length is selected. Finally, the ends of the DNA fragments need to be modified with adapters for sequencing on the machine, and the library is enriched by PCR. The second-generation sequencing technology has a wide range of applications in genotyping, including SNP typing, genome resequencing, and RNA sequencing. The advantages of these technologies are high throughput, high accuracy, high resolution, and low cost. Single nucleotide polymorphism genotyping chip (SNP chip) is a high-throughput genotyping tool based on microarray technology. It can detect hundreds of thousands to millions of SNPs simultaneously in a single experiment, providing a cost-effective method for the analysis of genetic diversity and is widely used in the construction of genetic linkage maps, evolutionary relationship studies, functional genomics exploration, and support for conservation efforts. The advantages of SNP chips include high throughput and fast data processing speed, but one of their limitations is that they can only detect known variant sites (usually with a population frequency of more than 1%), and a larger sample size is required for the detection of rare variants. Commercial SNP chips are generally designed based on certain well-known varieties, and the genetic distance from most studied local varieties or closed populations is large, causing some marker sites on the chip to be invalid in specific populations. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide a microsatellite DNA amplification primer pair for establishing a sequencing library, wherein the primer pair is applicable to a large number of species and the detection results are accurate and reliable.

[0006] The primer pair includes a left primer and a right primer, and the primer includes a TA[barcode] region and a conserved sequence binding region, specifically:

[0007] The conservative sequence binding region of the left primer is AAAAGAGAGAGAGAGT from 5' to 3' end, and the corresponding conservative sequence binding region of the right primer is TCTCTCTCTCTCTCCA from 5' to 3' end; the TA [barcode] region is connected to the 5' end of the left primer or the right primer, and the barcode is designed in accordance with base balance and / or laser balance.

[0008] Another object of the present invention is to provide a method for second-generation genome sequencing using the above-mentioned microsatellite DNA amplification primer pair, comprising the following steps:

[0009] Extract DNA from each sample to be sequenced;

[0010] Using the above primer pairs, PCR amplify the DNA of each sample to be sequenced to obtain a sequencing library;

[0011] Quantify the PCR amplification products to keep them at a consistent concentration and then mix them;

[0012] The sequencing library is sequenced using next-generation sequencing to obtain sequencing data. The samples to be sequenced are distinguished by different barcodes, and the sequencing data are mapped to the reference genome or assembled separately to mine population variation sites.

[0013] As a more optimal technical solution of the present invention, the DNA extraction method of the sample to be sequenced is CTAB method, SDS method or magnetic bead method.

[0014] As a better technical solution of the present invention, the PCR amplification process of the sample to be sequenced includes binding amplification and enrichment amplification; binding the above-mentioned primers to the genome is binding amplification, and the first five cycles are carried out at 94°C, 1 minute, 35°C, 1 minute and 72°C, 1 minute respectively; enrichment amplification is to increase the annealing temperature to 50°C for 35 cycles.

[0015] As a more optimal technical solution of the present invention, the concentration of the quantification of the PCR amplification product is 200 ng / ul.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The primer pairs provided by the present invention are applicable to a large number of species and can be applied to common crops. In the present invention, soybean and corn are verified, and the detection results are accurate and reliable.

[0018] In the sequencing method provided by the present invention, the preparation time of the sequencing library is reduced, multiple barcodes are used for simultaneous sequencing, the cost is reduced and the rate is increased, and mixed sequencing is performed according to the results after PCR amplification, so that the amount of data output by sequencing can be more uniform. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The drawings constituting part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments and descriptions of the present invention are used to explain the present invention and do not constitute an improper limitation on the present invention. In the drawings:

[0020] Figure 1 This is the agarose gel electrophoresis diagram of the PCR products after DNA from soybean and corn leaves was selected for library construction.

[0021] Figure 2 This is the base content distribution diagram obtained in Example 4.

[0022] Figure 3 This is a graph showing the sequencing result comparison of the primers (the TA[barcode] region is connected to the 5' end of the left primer).

[0023] Figure 4 This is a graph showing the sequencing results of the primers (TA[barcode] region connected to the 5' end of the left primer) compared with the soybean sequence.

[0024] Figure 5 This is a graph showing the sequencing results of the primer (TA[barcode] region connected to the 5' end of the left primer) compared with the sequence of corn.

[0025] Figure 6 This is a graph showing the sequencing result comparison of the primers (the TA[barcode] region is connected to the 5' end of the right primer).

[0026] Figure 7 This is a graph showing the sequencing results of the primer (TA[barcode] region connected to the 5' end of the right primer) and the alignment results of the soybean sequence.

[0027] Figure 8 This is a graph showing the sequencing results of the primer (TA[barcode] region connected to the 5' end of the right primer) compared with the sequence of corn. DETAILED DESCRIPTION

[0028] The technical solution of the present invention will be clearly and completely described below in conjunction with specific embodiments and experimental examples. However, it should be understood by those skilled in the art that the embodiments are only used to illustrate the technical solution of the present invention and should not be regarded as limiting the scope of protection of the present invention. Based on the following embodiments, all other implementation schemes obtained by ordinary technicians in the field without making creative work, such as modification, deformation or simple replacement, should belong to the scope of protection of the present invention.

[0029] Unless otherwise specified, the experimental methods used in the following embodiments and experimental examples are all conventional methods; the raw materials, reagents, instruments, etc. used are all commonly used in the art, available to the public or commercially available, unless otherwise specified; the terms and abbreviations involved have the conventional meanings in the art.

[0030] In the embodiment of the present invention, young leaves of soybean and corn are used to extract DNA. Primer pairs are designed for amplification, and then library construction is performed. The reagents used for library construction include: dNTP, magnesium ion, Taqbuffer, Taq enzyme, left primer, right primer; the amplification program is: the first 9 cycles are performed at 94°C, 45 seconds, 30°C, 1 minute, 72°C, 20 seconds respectively; enrichment amplification is to increase the annealing temperature to 50°C for 30 cycles.

[0031] Example 1: Design and synthesis of PCR amplification primer pairs.

[0032] Microsatellite DNA is distributed in different locations throughout the genome, and the sequences at both ends are mostly conservative single-copy sequences. Based on the sequences at both ends, the design requires low DNA quality and specific primer pairs with simple and easy-to-operate library construction steps. Since the sequencing capacity of the sequencing instrument is much greater than the amount of test sample sequences, in order to avoid instrument waste, one channel of the sequencer can measure multiple samples at the same time. However, in order to distinguish the sequences of multiple samples, it is necessary to add specific "labels" (barcodes) to different samples so that different sample data can be separated in subsequent data analysis.

[0033] The PCR amplification primer pair is:

[0034] Universal left primer (5' to 3' end): TA[Barcode]AAAGAGAGAGAGAGT,

[0035] Universal right primer (5' to 3' end): TCTCTCTCTCTCTCCA.

[0036] or

[0037] Universal left primer (5' to 3' end): AAAGAGAGAGAGAGT,

[0038] Universal right primer (5' to 3' end): TA[Barcode]TCTCTCTCTCTCTCTA.

[0039] The barcode is designed in accordance with base balance and / or laser balance. Base balance means that the barcode sequence should have four bases, A, T, G, and C, and the proportion of each base is approximately 25%. For example, the two bases A and C share a laser, which is excited by a red laser with a wavelength of 660nm; G and T share a laser, which is excited by a green laser with a wavelength of 532nm. Therefore, laser balance is to try to meet the requirement that each base position is A+C=G+T in a set of barcodes used. Barcodes that do not meet base balance and laser balance will have great data separation risks, or cannot separate samples, or cannot identify certain sequencing fragments. Examples of barcodes designed according to the above principles are shown in Table 1;

[0040] Table 1

[0041] Serial number barcode 1 GACACT 2 TGGAAT 3 GAACAA 4 GGCATG 5 CCGCTA 6 GACATA 7 CGACAG 8 TGGTGA 9 TTAGCG 10 AGGTGC 11 AAAGAC 12 TCTTCA 13 CGAAGG 14 AGCTCC 15 TGGTAG 16 GGTCGT 17 GTTAAC

[0042] Example 2: Extraction of DNA from samples to be sequenced.

[0043] The samples to be sequenced are soybean and corn DNA, and the extraction method can be one of the CTAB method, SDS method or magnetic bead method. This embodiment uses the magnetic bead method to extract soybean and corn DNA, specifically:

[0044] Step 1: Take about 100 mg of fresh plant tissue or about 20 mg of dry weight tissue, add liquid nitrogen and grind thoroughly. In this embodiment, tender leaves of soybean and corn are selected.

[0045] Step 2: immediately add 600 μL of buffer GEA1 to the ground powder, quickly invert to mix, and heat in a 65° C. water bath for 15 min or in a 75° C. oven for 30 min. In this embodiment, heating in a 65° C. water bath for 15 min is selected.

[0046] Note: Mixing the sample several times can increase the nucleic acid yield.

[0047] Step 3: Add 200 μL of buffer GEA2, mix thoroughly by inversion, and leave at room temperature for 15 min.

[0048] Step 4: Centrifuge at 4000 rpm for 45 minutes and transfer 400 μL of supernatant to a new deep-well plate.

[0049] Step 5, add 5 μL RNase A (10 mg / mL), invert and mix.

[0050] Step 6, nucleic acid binding: add 400 μL of binding solution to each reaction well in the 96-well plate, shake and mix the magnetic beads for 1 min before use, add 10 μL of magnetic beads, and after adding the magnetic beads, shake at 1200 rpm for 5 min.

[0051] Step 7. Magnetic separation: Place the 96-well plate on a magnetic rack and let it stand for 120 seconds until the magnetic beads are completely adsorbed, then discard the supernatant.

[0052] Step 8. Cleaning: add 600 μL of rinsing solution GEW1 (rinsing solution GEW1: anhydrous ethanol = 1:1) to each reaction well in the 96-well plate, shake at 1200 rpm for 2 min, perform magnetic separation as in step 7, and discard the supernatant; add 600 μL of rinsing solution GEW2 (rinsing solution GEW2: anhydrous ethanol = 1:4) to each well in the 96-well plate, shake at 1200 rpm for 2 min, perform magnetic separation as in step 7, and discard the supernatant.

[0053] Step 9, alcohol removal: After the supernatant is completely removed, dry at room temperature for 7 minutes.

[0054] Step 10, nucleic acid elution: add 200 μL of elution buffer GEB to each reaction well in the 96-well plate and shake at 1200 rpm for 10 min.

[0055] Step 11. Nucleic acid transfer: Place the 96-well plate on a magnetic stand and let it stand for 120 seconds until the magnetic beads are completely adsorbed. Transfer 190 μL of the nucleic acid solution to a clean 2 mL 96-well plate. The extraction process is complete.

[0056] Example 3: Perform PCR amplification on each sample DNA to be sequenced.

[0057] The primer pairs designed in Example 1 were added to the sample DNA to be sequenced prepared in Example 2, the barcode in the primer pairs was GACATA, and different samples used primer pairs containing different barcodes.

[0058] Step 1: Binding amplification of primer pairs to the genome:

[0059] The first 9 cycles were performed at 94°C for 45 seconds, 30°C for 1 minute, and 72°C for 20 seconds for denaturation, annealing, and extension.

[0060] Step 2, enrichment amplification: increase the annealing temperature to 50°C for 35 cycles.

[0061] Example 4: Detection of PCR products by agarose gel electrophoresis.

[0062] Prepare 2% agarose gel (1.2g agarose and 60ml 1xTAE), dissolve the agarose in a microwave oven, add 4ul of dye EB, mix well and pour into the gel plate to solidify, add 4ul PCR product to each well, add 5ul Marker 2000bp, adjust the voltage to 60V and run for 45min. After the electrophoresis, use a gel imager to observe the results, and estimate the size of the DNA fragment according to the position of the DNA Marker.

[0063] Quantify the PCR products of all samples to be sequenced to a concentration of 200 ng / ul, keep the concentration consistent, and mix the quantified PCR products. Figure 1 Shown are the agarose gel electrophoresis results of PCR products after DNA libraries were constructed from soybean and corn leaves. It can be seen that the primer pair can randomly bind in different species and amplify fragments of uniform size and concentration. Left primer: TAGACATAAAAGAGAGAGAGAGT (SEQ ID NO.1); right primer: TCTCTCTCTCTCTCTCCA (SEQ ID NO.2); GACATA in the left primer sequence is the barcode sequence, the first blank is Marker 2000bp, blanks 1 to 3 are soybean DNA samples, and blanks 4 to 6 are corn DNA samples.

[0064] Example 4: Using Illumina sequencing.

[0065] Step 1, sample preparation: Ultrasonic waves randomly break the DNA chain to obtain DNA fragments, use enzymes to fill the ends, add A at the 3' end, and then use ligase to add adapters to both ends of the DNA fragments. Adapters mainly include: sequencing primer binding site (green), index (yellow / red) and sequences complementary to oligos on the flowcell chip (purple / blue).

[0066] Step 2: Cluster generation: DNA fragments are amplified through bridge PCR to form thousands of clusters at the same time. The clusters are basically synchronized, thus amplifying the signal for subsequent sequencing.

[0067] Step 3, sequencing: Load the single-stranded library into the flowcell and place it in the sequencer. The DNA fragments are amplified and automatically clustered. This process can produce millions of copies of single-stranded DNA. Then sequencing by synthesis occurs: each nucleotide has a fluorescent marker and a reversible terminator. The presence of the terminator means that only one base can be extended in one cycle, and the fluorescent signal can indicate which nucleotide is added. Then add chemicals to cut off the terminator, and the next base can be attached. This cycle repeats to obtain sequence data.

[0068] Sequencing and data analysis:

[0069] The purified library was sequenced directly on the sequencing platform Novasek-PE150. The quality of the data was controlled and the base quality distribution was as follows: Figure 2 As shown, the average quality is above Q30, indicating that the sequencing quality is good.

[0070] The barcode sequence GACATA was used to separate the data from the mixed sample into the experimental samples. The BLAST function on NCBI was used to compare the partial data from the library sequencing of primer pair 1 (TA[barcode] region connected to the 5' end of the left primer) and primer pair 2 (TA[barcode] region connected to the 5' end of the right primer). The partial data from the library sequencing of primer pair 1 (TA[barcode] region connected to the 5' end of the left primer) was compared. Figures 3 to 5 As shown, the sequence alignment of the partial data of the library sequencing was performed using primer pair 2 (TA [barcode] region connected to the 5' end of the right primer) as shown in Figures 6 to 8As shown, the sequence information of the experimental samples corn and soybean can be compared and the consistency of the sequence comparison is relatively high, averaging more than 90%, proving that the primers designed in this experiment are capable of more accurate and random amplification of multiple species. The above results show that the sequencing results of the primer pairs used in this application have reliable accuracy. The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A microsatellite DNA amplification primer pair, characterized in that: The primer pair includes a left primer and a right primer, and the primer includes a TA[barcode] region and a conserved sequence binding region, specifically: The conservative sequence binding region of the left primer from 5' to 3' end is AAAAGAGAGAGAGAGT, and the corresponding conservative sequence binding region of the right primer from 5' to 3' end is TCTCTCTCTCTCTCCA; the TA [barcode] region is connected to the 5' end of the left primer or the right primer; The barcode is designed in accordance with base balance and / or laser balance; The sample to be tested is corn or soybean; the barcode sequence is GACATA.

2. A genome second generation sequencing method, characterized in that: The steps include: Extract DNA from each sample to be sequenced; Performing PCR amplification on the DNA of each sample to be sequenced using the amplification primer pair described in claim 1 to obtain a sequencing library; Quantify the PCR amplification products to keep them at a consistent concentration and then mix them; The sequencing library is sequenced by next-generation sequencing to obtain sequencing data. The samples to be sequenced are distinguished by different barcodes. The sequencing data are mapped to the reference genome or assembled separately to mine population variation sites; The sample to be sequenced is corn or soybean.

3. The method for second generation genome sequencing according to claim 2, characterized in that: The DNA extraction method of the sample to be sequenced is CTAB method, SDS method or magnetic bead method.

4. The method for second generation genome sequencing according to claim 2, characterized in that: The PCR amplification process of the sample to be sequenced includes binding amplification and enrichment amplification; binding the primer to the genome is binding amplification, and the first five cycles are performed at 94°C, 1 minute, 35°C, 1 minute and 72°C, 1 minute respectively; The enrichment amplification was performed by increasing the annealing temperature to 50°C for 35 cycles.

5. The method for second generation genome sequencing according to claim 2, characterized in that: The concentration of the PCR amplification product for quantification is 200 ng / ul.

Images