Primer group, probe, reagent and kit for detecting cryptosporidium based on RAA technology and detection method and application of primer group, probe, reagent and kit

Through the primer set and probe design of RAA technology, rapid, sensitive and highly specific Cryptosporidium detection is achieved, solving the complex and time-consuming problem of existing detection methods and is suitable for on-site diagnosis at the grassroots level.

CN120330360APending Publication Date: 2025-07-18HENAN AGRICULTURAL UNIVERSITY
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510523897.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-24
Publication Date
2025-07-18

AI Technical Summary

Technical Problem

The existing Cryptosporidium detection methods are complex, time-consuming and labor-intensive, and have low sensitivity, so they cannot be quickly applied in the wild or in the grassroots field.

Method used

Using primer sets and probe designs based on RAA technology, including forward primers Tcp-F112-142 and reverse primers Tcp-R261-291, and probe qtan166-215, rapid detection was achieved by performing a constant temperature amplification reaction at 39°C for 20 minutes, combined with fluorescence detection.

Benefits of technology

It realizes high sensitivity Cryptosporidium detection, with a sensitivity of 4 copies/μL, with strong specificity, simple operation, short time consuming, no expensive large-scale instruments and equipment required, suitable for basic on-site diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330360A_ABST
    Figure CN120330360A_ABST
Patent Text Reader

Abstract

The invention discloses a primer group, a probe, a reagent and a kit for detecting cryptosporidium based on an RAA technology and a detection method and application of the primer group and the probe. The primer group and the probe are designed based on a highly conserved sequence of the cryptosporidium and are high in sensitivity, the lowest detection limit can reach 4 copies / mu L, the specificity is high, only specific amplification is achieved on the cryptosporidium, and the detection time is short. The cryptosporidium detection method is established on the basis of a cryptosporidium RAA amplification method, expensive and complex large-scale instruments and equipment and professional laboratory equipment are not needed, and the test results of 46 clinical samples show that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result is accurate. After reaction at 39 DEG C for 20 minutes, visual result judgment can be carried out under the irradiation of a fluorescence detector or a blue light instrument. The method is of great significance to detection, prevention and control of cryptosporidium.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of parasite detection, and particularly relates to a primer set, a probe, a reagent, a kit, a detection method and an application for detecting Cryptosporidium based on the RAA technology. Background Art

[0002] Cryptosporidium ( Cryptosporidium parvum ) is an important opportunistic pathogenic parasite, mainly causing zoonotic cryptosporidiosis (Non-patent Document 1). Its infection is widespread globally, especially in areas with poor sanitation conditions or among immunocompromised individuals. Cryptosporidium is one of the main species infecting humans in the genus Cryptosporidium, with a relatively high infection rate in developing countries (such as Africa and South Asia), but waterborne or foodborne outbreaks are also frequently reported in developed countries (such as Europe and the United States) (Non-patent Document 2). Cryptosporidiosis is mainly transmitted through the fecal-oral route, but its self-limiting characteristics are often overlooked (Non-patent Document 3). According to statistics, about 5% - 10% of diarrhea cases in developing countries are caused by cryptosporidiosis. For example, in the outbreak in Milwaukee, USA in 1993, about 400,000 people were infected (Non-patent Document 4), and this outbreak caused huge direct and indirect economic losses.

[0003] Currently, the detection methods for Cryptosporidium usually include traditional morphological detection, immunological tests, conventional PCR, etc. (Non-patent Document 5). These detection methods all have many drawbacks: Morphological detection relies on professional laboratory personnel to microscopically observe oocysts, is easily interfered by sample impurities, prone to false positives, and the experimental results have poor repeatability among different operators. Immunological detection requires specific antibodies against Cryptosporidium, has a long detection time (usually several hours to several days), and requires relatively expensive detection equipment. Some immunological bindings are prone to cross-reactions, resulting in false positives. Although the conventional PCR method has high sensitivity, it requires complex pretreatment steps (such as DNA extraction and purification), professional PCR instruments and skilled operators, takes up to 2 - 3 hours, and cannot be quickly applied in the field or at the grass-roots level. In addition, the concentration of oocysts in environmental samples (such as water samples) is low, and pretreatment steps such as centrifugation and filtration are required, which are cumbersome and may result in loss of the target. Most kits rely on the laboratory environment and are difficult to use quickly in the field or at the grass-roots level (Non-patent Documents 1 and 6). These limitations have led to the inability to popularize these existing Cryptosporidium detection methods in clinical applications.

[0004] In recent years, there have been research reports and related patents on Cryptosporidium. For example, the patent with the application number 201210585063.9 discloses a detection method and detection kit for Cryptosporidium, and the patent with the application number 201811173335.8 discloses fluorescent PCR primers, probes, kits and methods for detecting Cryptosporidium. The above-mentioned schemes all perform fluorescent PCR reactions by designing specific primers, and complex pretreatment steps are required before the reaction, and the sample detection takes a long time. The patent with the application number 201910173306.X discloses primers, probes and detection methods for detecting Cryptosporidium by the RAA fluorescence method, but the detection sensitivity per reaction only reaches 100 Copies / reaction, and the sensitivity is relatively low when detecting Cryptosporidium in environmental samples (such as water samples, feces) on-site.

[0005] Non-patent literature: Non-patent literature 1: DUMAINE J E, TANDEL J, STRIEPEN B. Cryptosporidiumparvum [J]. Trends Parasitol, 2020, 36(5): 485-6. Non-patent literature 2: NWOSU A, BERKE O, TROTZ-WILLIAMS L A, et al. Exploringthe geographical distributionof human cryptosporidiosis in Southern Ontariofrom 2011 to 2014 [J]. ZoonosesPublic Health, 2022, 69(5): 425-38. Non-patent literature 3: OKHUYSEN P C, CHAPPELL C L. Cryptosporidium virulencedeterminants--are we there yet?[J]. Int J Parasitol, 2002, 32(5): 517-25. Non-patent literature 4: MORRIS R D, NAUMOVA E N, GRIFFITHS J K. Did Milwaukeeexperience waterborne cryptosporidiosis before the large documented outbreakin1993? [J]. Epidemiology, 1998, 9(3): 264-70. Non-patent Document 5: KING P, TYLER K M, HUNTER P R. Anthroponotic transmission of Cryptosporidium parvum predominates in countries with poorer sanitation: a systematic review and meta-analysis [J]. Parasit Vectors, 2019, 12(1): 16. Non-patent Document 6: LAUDE A, VALOT S, DESOUBEAUX G, et al. Is real-time PCR-based diagnosis similar in performance to routine parasitological examination for the identification of Giardia intestinalis, Cryptosporidium parvum / Cryptosporidium hominis and Entamoeba histolytica from stool samples? Evaluation of a new commercial multiplex PCR assay and literature review [J]. Clin Microbiol Infect, 2016, 22(2): 190.e1-.e8. Non-patent Document 7: TAI L, LI J, YIN J, et al. A novel detection method of Cryptosporidium parvum infection in cattle based on Cryptosporidium parvum virus 1 [J]. Acta Biochim Biophys Sin (Shanghai), 2019, 51(1): 104-11. Summary of the Invention

[0006] Existing detection methods for Cryptosporidium are complex, time-consuming and laborious, and have low sensitivity. To solve the above problems, a primer set, a probe, a reagent, a kit, a detection method and an application for detecting Cryptosporidium based on the RAA technology are provided.

[0007] The present invention is implemented in the following manner: A primer set for detecting Cryptosporidium based on the RAA technology, the primer set includes a forward primer Tcp-F112-142 and a reverse primer Tcp-R261-291, and the nucleotide sequence of the forward primer Tcp-F112-142 is shown as SEQ ID No. 2; the nucleotide sequence of the reverse primer Tcp-R261-291 is shown as SEQ ID No. 6.

[0008] A probe for detecting Cryptosporidium based on the RAA technology, and the nucleotide sequence of the probe qtan166-215 is shown as SEQ ID No. 10.

[0009] The probe qtan166-215 is modified with a dT-fluorescent group and a dT-quencher group. The dT-fluorescent group is modified at the position 31 bp from the 5'-end of the probe sequence; the dT-quencher group is modified at the position 34 bp from the 5'-end of the probe sequence. There are 2 bases AA spaced between the dT-fluorescent group and the dT-quencher group. Among them, the base A at the position 33 bp from the 5'-end is replaced by tetrahydrofuran THF, and the 3'-end is modified by C3-spacer.

[0010] The fluorescent group is FAM; the quencher group is BHQ1.

[0011] A detection reagent, and the reagent contains the primer set according to claim 1 and / or the probe according to any one of claims 2-4.

[0012] A detection kit, and the detection kit contains the detection reagent according to claim 6.

[0013] The working concentrations of the forward primer Tcp-F112-142, the reverse primer Tcp-R261-291 and the probe qtan166-215 in the detection kit are all 10 μM.

[0014] The detection kit further includes reagents for the RAA reaction, specifically nucleic acid amplification reagents, A Buffer, B Buffer, negative control and positive control. Among them, the A Buffer is a hydrolysis buffer; the B Buffer is a magnesium acetate solution; the nucleic acid amplification reagents specifically include recombinase, single-stranded binding protein, strand displacement DNA polymerase, and the nucleic acid amplification reagents exist in the form of freeze-dried powder.

[0015] A method for detecting Cryptosporidium for non-disease diagnosis and treatment purposes, the method includes the following steps: (1) Extract sample DNA; (2) Use the detection kit according to any one of claims 6-8 to perform RAA amplification on the sample DNA obtained in step (1); (3) According to the amplification result, determine whether Cryptosporidium is contained in the sample; The application of the primer set according to claim 1 and / or the probe according to any one of claims 2-4 in the preparation of a Cryptosporidium detection preparation.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. The primer set and probe for detecting Cryptosporidium based on the RAA technology provided by the present invention are designed based on the highly conserved sequences of Cryptosporidium, with high sensitivity, and the lowest detection limit can reach 4 copies / μL; 2. The detection kit in the present invention has high specificity, specifically amplifies only Cryptosporidium, and does not produce a positive reaction to Giardia lamblia, Toxoplasma gondii, Eimeria tenella, and Blastocystis hominis; 3. The detection method provided by the present invention is simple, can conveniently, quickly and accurately identify Cryptosporidium, is easy to operate, has a short detection time, does not require expensive and complex large-scale instrument equipment and professional laboratory equipment, and only needs to react for 20 min under the constant temperature condition of 39 °C to complete, greatly shortening the detection time, improving the detection efficiency, and being more suitable for grass-roots field diagnosis and point-of-care testing. Description of the Drawings

[0017] Figure 1 It is the comparison result of the conserved regions.

[0018] Figure 2 It is the schematic diagram of primer and probe design.

[0019] Figure 3 It is the forward primer screening diagram of the RAA method; among them, 1: F112-142; 2: F110-140; 3: F134-164; 4: F122-152; 5: positive control; 6: negative control.

[0020] Figure 4 It is the reverse primer screening of the RAA method; among them, 1: R261-291; 2: R231-261; 3: R263-293; 4: R229-259; 5: positive control; 6: negative control.

[0021] Figure 5 It is the RAA temperature optimization; among them, 1: 37 °C; 2: 38 °C; 3: 39 °C: 4: 40 °C: 5: 41 °C; 6: negative control.

[0022] Figure 6It is the specificity test of the RAA method; among them, 1: Cryptosporidium; 2: Giardia lamblia; 3: Toxoplasma gondii; 4: Eimeria tenella; 5: Blastocystis hominis; 6: negative control.

[0023] Figure 7 It is the visualization result of the RAA method specificity test; among them, 1: Cryptosporidium; 2: Giardia lamblia; 3: Toxoplasma gondii; 4: Eimeria tenella; 5: Blastocystis hominis; 6: negative control.

[0024] Figure 8 It is the electrophoresis result of the amplification of the Cryptosporidium 18S rRNA gene; among them, M: marker; 1: target gene; 2: target gene Figure 9 It is the electrophoresis result of the PET-28a reverse PCR; among them, M: marker; 1: linearized PET-28a; 2: linearized PET-28a.

[0025] Figure 10 It is the electrophoresis result of the bacterial liquid PCR; among them, M: marker; 1-4 are all recombinant plasmids.

[0026] Figure 11 It is the sensitivity and visualization result of the RAA method; among them, 1: 1.6×10 4 copies / μL; 2:: 1.6×10 3 copies / μL; 3: 1.6×10 2 copies / μL; 4: 16 copies / μL; 5: 8 copies / μL; 6: 4 copies / μL; 7: 1 copies / μL; 8: negative control.

[0027] Figure 12 Nested PCR clinical sample detection electrophoresis map; among them, 1-46: samples to be tested; P: positive control; N: negative control.

[0028] Figure 13 RAA clinical sample detection visualization result; among them, 1-46: samples to be tested; 47: positive control; 48: negative control. Specific implementation mode

[0029] The following further describes the present invention in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, the specific experimental methods involved in the following embodiments are all conventional methods or implemented according to the conditions recommended by the manufacturer's instructions if not otherwise specified.

[0030] Recombinase-aided amplification (RAA) is a new isothermal in vitro nucleic acid amplification technique, which can be completed within 30 minutes at 37-42°C. RAA can effectively reduce the time required in the traditional detection process of Cryptosporidium during the detection of Cryptosporidium.

[0031] The design of RAA primers follows the following basic principles: the primer length should be greater than or equal to 30 bp, preferably between 30 and 38 bp; the amplicon length does not exceed 500 bp, preferably between 100 and 200 bp; the GC content is greater than 30% and less than 70%, preferably between 40% and 60%; the last base at the 3'-end of the primer should be very conservative; it is best to avoid many repeated short sequences in the primer; avoid the direct formation of hairpin structures or primer dimers in the primer, etc.

[0032] The design principles and precautions of RAA probes are as follows: When designing the probe, it should be noted that a pair of extremely close T bases (only separated by 1-5 nucleotides, and both of these 2 T bases should be very conservative) should be found in the conserved region of the target sequence. The T base closer to the 5'-end is replaced by a dT-fluorescent group, and the other T base closer to the 3'-end is replaced by a dT-quencher group. There is a base between the 2 T bases replaced by tetrahydrofuran (THF) base. There is no known sequence requirement for the base between the 2 T bases, and there is also no sequence requirement for the base replaced by THF. The probe length should be 46-52 nucleotides, of which at least 30 are located at the 5'-end of the THF site, and at least 15 are located at its 3'-end, and the 3'-end base needs to be modified (such as amine group, phosphate group, biotin, biotin-TEG or C3-spacer, etc.) to block the polymerase extension of the probe. (Note: The THF base, dT-fluorescent group and dT-quencher group replace the bases within the target amplicon sequence, rather than being inserted additionally).

[0033] (I) Design of RAA detection primers and probes To ensure the effective amplification of the RAA method, primers need to be screened. Download 18 publicly available Cryptosporidium 18S rRNA gene sequences from the Genkbank database on NCBI, and use MAGE 7.0 software to compare these gene sequences. The comparison results are as Figure 1 shown, and the highly conserved sequences (200-300 bp) are screened as follows (SEQ ID No. 1): TATATGAAATTTTACTTTGAGAAAATTAGAGTGCTTAAAGCAGGCATATGCCTTGAATACTCCAGCATGGAATAATATTAAAGATTTTTATCTTTCTTATTGGTTCTAAGATAAGAATAATGATTAATAGGGACAGTTGGGGGCATTTGTATTTAACAGTCAGAGGTGAAATTCTTAGATTTGTTAAAGACAAACTAATGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCAACTAGAGATTGGAGGTTGTTCCTTACTCCTTCAGAACCTTA Using a highly conserved sequence as the RAA detection target, primers and probes were designed according to the requirements for RAA primers and probes, such as Figure 2 Primers and probes were designed, and the designed primers and probes are shown in Table 1.

[0034] Table 1 Cryptosporidium-specific primers and probes The probe was modified with a dT-fluorophore and a dT-quencher. The dT-fluorophore was modified at the position 31 bp from the 5'-end base number of the probe sequence; the dT-quencher was modified at the position 34 bp from the 5'-end base number of the probe sequence. There were 2 bases AA spaced between the dT-fluorophore and the dT-quencher. Among them, the A at the position 33 bp from the 5'-end base number was replaced with a THF base, and the 3'-end was modified with C3-spacer.

[0035] Preferably, the fluorophore is FAM and the quencher is BHQ1.

[0036] The modified probe is: GTGAAATTCTTAGATTTGTTAAAGACAAAC(FAM-dT)A(THF)(BHQ1-dT)GCGAAAGCATTTGCCA[C3-spacer] The primers and probes were all synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0037] (II) Cryptosporidium RAA test 1. Extract sample DNA: Use the OMEGA fecal gene extraction kit or conventional techniques in the art to extract DNA from the sample to be tested (such as animal feces, water samples, etc.) to obtain the DNA sample to be tested. The specific extraction steps can be carried out according to the kit instructions. (OMEGA (E.Z.N.A. ® Stool DNA Kit) fecal DNA extraction kit, product number: D4015-02).

[0038] 2. Use the primers and probes designed above to perform RAA amplification on the sample DNA obtained in step (1). The specific steps are as follows: 2.1 Prepare the RAA reaction system. Prepare the reaction system according to the instructions of the RAA nucleic acid amplification reagent (fluorescent type). The kit is purchased from Nanning Zhuangbo Biotechnology Co., Ltd., and the product model is ZBA12001. The RAA reaction system is shown in Table 2.

[0039] Table 2 RAA amplification system 2.2 According to the number of reactions, prepare a Mix containing water, A Buffer, forward primer RAA-F (10 μM), reverse primer RAA-R (10 μM), and probe (10 μM) according to the reaction system. After mixing evenly, add it to the detection unit tube containing the nucleic acid amplification reagent. The A Buffer is a hydrolysis buffer; the B Buffer is a magnesium acetate solution; the nucleic acid amplification reagent specifically contains recombinase, single-stranded binding protein, and strand displacement DNA polymerase, and the nucleic acid amplification reagent exists in the form of lyophilized powder.

[0040] 2.3 Add the DNA sample to be tested obtained in step 1 to the detection unit tube.

[0041] 2.4 Then add 2.5 μl of B buffer to the lid of the detection unit tube, cover the tube lid, gently invert and shake it up and down 5-6 times, and centrifuge at low speed for 30 s.

[0042] 2.5 Place the detection unit tube in the qTOWER2.0 fluorescence quantitative PCR instrument and start the detection according to the program in Table 3. Specifically, react at 39 °C for 20 min, and collect the fluorescence value once every 30 s.

[0043] Table 3 RAA reaction program 3. According to the amplification results, it is determined whether Cryptosporidium is contained in the sample. In this embodiment, a blue light gel cutter (Sangon Biotech (Shanghai) Co., Ltd.; blue light gel cutter No.: G500312 EQU312 wavelength: 440 - 485 nm) can be used to directly visually judge the detection unit after RAA amplification in a dark room, so as to achieve the purpose of result visualization.

[0044] The judgment criteria are as follows: If there is no amplification curve in the negative control or the visualization result is colorless, and there is an amplification curve in the positive control or the visualization result is green, the experimental data is valid; otherwise, the experimental result is invalid and needs to be retested. If there is no amplification curve in the sample to be tested or the visualization result is colorless, the sample is judged to be negative; if there is an amplification curve or the visualization result is green, the sample is judged to be positive.

[0045] Among them, the template in the negative control is double-distilled water, and the template in the positive control is a qualitative nucleic acid standard sample of Cryptosporidium parvum prepared by the Parasitology Laboratory of the College of Veterinary Medicine, Henan Agricultural University (developed by the Parasitology Laboratory of Henan Agricultural University).

[0046] (3) Primer screening for the RAA method Randomly select and fix a forward primer to screen for the optimal reverse primer, and then fixedly use the screened optimal reverse primer to screen for the optimal forward primer. The primer combination with the best amplification effect is the best primer combination.

[0047] Using the qualitative nucleic acid standard sample of Cryptosporidium parvum as the positive control and double-distilled water as the negative control, the primer screening is carried out by using the RAA amplification system and method established in step (2). The screening results are as Figure 3 、 4 shown. It can be seen from the figure that the amplification effect of the forward primer Tcp-F112-142 and the reverse primer Tcp-R261-291 is the best. Therefore, the best primer combination Tcp-F112-142 and Tcp-R261-291 is selected for the establishment of the subsequent research method.

[0048] (4) Optimization of RAA amplification conditions The RAA amplification method can occur between 37°C and 42°C. In this experiment, 5 groups of temperature gradients (37°C - 41°C) are designed, and the reaction temperatures are set at 37°C, 38°C, 39°C, 40°C, and 41°C in a PCR instrument. Using the best primer and probe combination screened in step (3), the RAA amplification is carried out by using the RAA amplification system and method established in step (2), so as to screen out the optimal reaction temperature for Cryptosporidium RAA amplification. The optimization results of the amplification temperature are as Figure 5As shown, the results indicate that the optimal amplification temperature for the RAA method is 39 °C.

[0049] (V) Specificity test of the RAA method Using the nucleic acids of Giardia lamblia, Toxoplasma gondii, Eimeria tenella, Blastocystis sp., and Cryptosporidium as templates respectively, and double-distilled water as the negative control, RAA amplification was carried out using the RAA amplification system and method established in step (II) to conduct a specificity test on the Cryptosporidium RAA method. A blue light gel cutting instrument (Sangon Biotech (Shanghai) Co., Ltd.; blue light gel cutting instrument No.: G500312 EQU312 wavelength: 440 - 485 nm) was used to directly visually judge the detection unit after RAA amplification in a dark room. All samples were DNA samples collected by the Parasitology Laboratory of the College of Veterinary Medicine, Henan Agricultural University and stored after molecular identification.

[0050] The results of the specificity test showed that Figure 6 among them, except for the obvious amplification of Cryptosporidium nucleic acid within 20 minutes, other nucleic acids such as Giardia lamblia, Toxoplasma gondii, Eimeria tenella, and Blastocystis sp. were not amplified; Figure 7 in the visualization detection results, only the Cryptosporidium nucleic acid sample showed visible green light to the naked eye. This indicates that the primers and probes used in the present invention have good specificity, and the Cryptosporidium RAA method established in the present invention has good specificity.

[0051] Using the 18S rRNA of Cryptosporidium (IId A19G1) stored in the Parasitology Laboratory of Henan Agricultural University as the target gene, PET-28a was selected as the plasmid construction vector, and the method of homologous recombination was used to construct the Cryptosporidium 18S plasmid.

[0052] 1. Using the 18S rRNA of Cryptosporidium (IId A19G1) stored in the Parasitology Laboratory of Henan Agricultural University as the template, the forward primer (SEQ ID No. 13) and reverse primer (SEQ ID No. 14) in Table 4 were used as the specific primers for the 18S rRNA of Cryptosporidium (IIdA19G1), and PCR amplification was carried out according to the reaction systems and procedures in Tables 5 and 6. The amplification products were detected by agarose gel electrophoresis, and the electrophoresis results are shown in Figure 8 ; the correctly amplified products were recovered by gel (Shanghai Tianneng Technology Co., Ltd.); the specific steps of the DNA gel recovery test are shown in the kit instruction manual (manufacturer: TIANGEN; Universal DNA Purification and Recovery Kit (centrifugal column type); product number: DP214 - 02). After the concentration of the amplified DNA was measured, it was stored in a -20 °C refrigerator.

[0053] 2. Linearization of plasmid vector pET-28a: Forward primer (SEQ ID No. 11) and reverse primer (SEQ ID No. 12) for amplifying the vector were designed according to the insertion site of the target gene in the vector. The specific sequences are recorded in Table 4 and were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Reverse PCR was performed according to the PCR system in Table 5 and the reaction procedure in Table 6. The amplified product was detected by agarose gel electrophoresis, and the electrophoresis result is shown in Figure 9 ; The correctly amplified product was recovered by gel extraction (Shanghai Tianneng Technology Co., Ltd.). The specific operation steps of the gel extraction experiment are shown in the kit instruction manual (manufacturer: TIANGEN; Universal DNA Purification and Recovery Kit (centrifugal column type); product number: DP214-02), obtaining the linearized pET-28a plasmid vector. After concentration determination, it was stored in a -20 °C refrigerator.

[0054] Table 4 PCR amplification sequences Table 5 PCR reaction system Table 6 PCR reaction procedure 3. Construction of recombinant plasmid Plasmid construction was carried out using DNA recombinase (ClonExpress® Ultra One Step Cloning Kit, product number: C115). The target gene and the linearized pET-28a vector obtained by gel extraction in steps 1 and 2 were mixed evenly according to the system in Table 7 and ligated at 50 °C for 20 min to obtain the recombinant product.

[0055] Table 7 Ligation system (1) Thaw the chemically competent cells (DH5α) for cloning on ice.

[0056] (2) Take 10 μl of the recombinant product and add it to 100 μl of the competent cells. Gently flick the tube wall to mix evenly (do not mix by shaking) and let it stand on ice for 30 min.

[0057] (3) After heat shock in a 42 °C water bath for 45 s, immediately place it on ice to cool for 2 - 3 min.

[0058] (4) Add 900 μl of LB liquid medium (without adding antibiotics) and shake the bacteria at 37 °C for 1 h (rotation speed 200 - 250 rpm).

[0059] (5) Preheat the LB solid medium plate containing kanamycin resistance in a 37 °C incubator.

[0060] After the shaking culture in (4) is completed, centrifuge at 5000 rpm / min for 5 min, and discard 900 μl of the supernatant. Resuspend the cell pellet with the remaining medium, and gently spread it evenly on a plate containing kanamycin resistance using a sterile spreading rod.

[0061] (7) Incubate the plate upside down in an incubator at 37 °C for 12 - 16 h.

[0062] Pick a single colony from the solid medium and put it into a centrifuge tube, add it to the liquid LB medium (Kan + :LB medium = 1:1000), then expand the culture of the bacterial solution and use it as the amplification template. Use the primers of F / R Plasmid in Table 4 (forward primer: SEQ ID No. 13 and reverse primer: SEQ ID No. 14) to perform bacterial solution PCR identification, and send it to Beijing Tsingke Biotechnology Co., Ltd. for sequencing. The results of bacterial solution PCR electrophoresis identification are as Figure 10 shown.

[0063] Use a plasmid miniprep kit (GeneJET Plasmid Miniprep Kit, product number: K0503) to extract the recombinant plasmid from the bacterial solution of the clone identified as positive by PCR. The specific experimental steps are shown in the kit instruction manual. After measuring the concentration of the obtained recombinant plasmid, store it in a -20 °C refrigerator.

[0064] (VII) Sensitivity test of Cryptosporidium RAA method Perform serial dilution on the recombinant plasmid obtained in step (VI), and use different recombinant plasmid concentrations (1.6×10 4 copies / μL, 1.6×10 3 copies / μL, 1.6×10 2 copies / μl, 16 copies / μL, 8 copies / μL, 4 copies / μL, 2 copies / μL). Use double-distilled water as the negative control, and adopt the RAA amplification system and method established in step (II) to perform a sensitivity test on the established Cryptosporidium RAA method, and conduct 6 independent repeated tests to analyze the feasibility of the RAA amplification threshold results. Use a blue light gel cutting instrument (G500312 wavelength: 440 - 485 nm) to directly judge the detection unit after RAA amplification with the naked eye in a dark room.

[0065] The results are as Figure 11As shown in Table 8, the sensitivity of RAA amplification can reach 4 copies / μL, the visualization result can reach 4 copies / μL, and the sensitivity reaches 4 copies / reaction, indicating that the RAA method established in the present invention has high sensitivity.

[0066] Table 8 Sensitivity reliability analysis of Cryptosporidium RAA method (VIII) Detection results of Cryptosporidium RAA method and nested PCR in clinical samples Source of clinical samples: Fecal samples collected and preserved from the epidemiological investigation of the Parasitology Laboratory of Henan Agricultural University.

[0067] Positive control: Qualitative standard sample of Cryptosporidium parvum nucleic acid (developed by the Parasitology Laboratory of Henan Agricultural University) Negative control: Double-distilled water.

[0068] DNA extraction: Use the OMEGA fecal gene extraction kit (OMEGA (E.Z.N.A.® Stool DNA Kit) fecal DNA extraction kit, product number: D4015-02) or conventional techniques in the art to extract DNA to obtain the DNA sample to be tested.

[0069] Using the extracted DNA as a template, 46 clinical samples were detected by traditional conventional nested PCR (GB / T 35942-2018 Cryptosporidium nested PCR detection method) and the RAA method established in the present invention respectively. Detection results: Detected by traditional conventional nested PCR: Among the 46 samples, 21 positive samples and 25 negative samples were detected (the results are as Figure 12 )

[0070] The visualization detection results of the RAA method established in the present invention showed that: under the condition that the positive and negative controls were valid, among the 46 samples, 21 positive samples and 25 negative samples were detected (the results are as Figure 13 )

[0071] Compared with the nested PCR detection method for Cryptosporidium in GB / T 35942-2018, the positive detection results of the RAA detection method established in the present invention correspond one by one, and the detection rates are 100% consistent, indicating that the RAA detection method established in the present invention has high accuracy and reliability in clinical applications. The primer-probe combination provided by the present invention can be applied to the RAA technology, and the detection method for detecting Cryptosporidium by combining the RAA technology with the primer-probe combination provided by the present invention is accurate and feasible, and it can be applied to the detection of Cryptosporidium. The primer-probe combination provided by the present invention can be applied to the RAA technology and combined with the RAA technology to quickly and accurately detect whether Cryptosporidium is contained in the sample to be tested, realizing accurate, rapid, sensitive, convenient and high-throughput rapid detection of Cryptosporidium, meeting the current requirements for Cryptosporidium detection; and this detection method is a constant temperature detection method, with simple operation and short time consumption, and is very suitable for on-site field detection, providing assistance for the prevention and control of cryptosporidiosis.

[0072] (IX) Establishment of the kit The present invention provides a kit for detecting Cryptosporidium, which includes a forward primer Tcp-F112-142 with a nucleotide sequence as shown in SEQ ID NO:2, a reverse primer Tcp-R261-291 with a nucleotide sequence as shown in SEQ ID NO:6, a probe with a nucleotide sequence as shown in SEQ ID NO:10, and reagents for the RAA reaction. Among them, the concentrations of the forward primer, reverse primer and probe are all 10 μM.

[0073] The usage method of the kit includes the following steps: (1) Extract sample DNA; (2) Use the kit to perform RAA amplification on the sample DNA obtained in step (1); (3) According to the amplification result, judge whether Cryptosporidium is contained in the sample; Among them, the RAA reaction system is: Among them, A Buffer is a hydrolysis buffer; the B Buffer is a magnesium acetate solution The amplification reaction conditions are: 39 °C, 1 min; 39 °C, 30 s; 40 cycles; The above kit for detecting Cryptosporidium is applied to the detection of Cryptosporidium, and this kit provides convenience for the detection of Cryptosporidium.

[0074] In summary, the kit of the present invention has high sensitivity, and the lowest detection limit does not exceed 4 copies / μL; this kit has good specificity and can be used for the detection and prevention of Cryptosporidium infection.

[0075] The main objective of the present invention is to overcome the defects of traditional Cryptosporidium detection methods, such as complexity, time-consuming and laborious. A rapid and convenient detection method is developed. This method is simple to operate, highly specific and time-consuming. The present invention provides a primer and probe combination capable of detecting Cryptosporidium. Based on the RAA amplification method of Cryptosporidium, a complete set of Cryptosporidium detection methods is established. It does not require expensive and complex large-scale instrument equipment and professional laboratory equipment. The test results of 46 clinical samples show that after reacting at 39°C for 20 minutes, the visual result can be determined by a fluorescence detector or under the irradiation of a blue light instrument. The present invention is of great significance for the detection and prevention and control of Cryptosporidium.

[0076] The above are only the preferred embodiments of the present invention. It should be noted that for those skilled in the art, without departing from the overall concept of the present invention, several changes and improvements can still be made, which should also be regarded as the protection scope of the present invention.

Claims

1. A primer set for detecting Cryptosporidium based on the RAA technology, characterized in that, The primer set includes a forward primer Tcp-F112-142 and a reverse primer Tcp-R261-291. The nucleotide sequence of the forward primer Tcp-F112-142 is shown as SEQ ID No. 2; the nucleotide sequence of the reverse primer Tcp-R261-291 is shown as SEQ ID No.

6.

2. A probe for detecting Cryptosporidium based on the RAA technology, characterized in that, The nucleotide sequence of the probe qtan166-215 is shown as SEQ ID No.

10.

3. A probe for detecting Cryptosporidium based on the RAA technology according to claim 2, characterized in that, The probe qtan166-215 is modified with a dT-fluorescent group and a dT-quencher group. The dT-fluorescent group is modified at the position 31 bp from the 5'-end base number of the probe sequence; the dT-quencher group is modified at the position 34 bp from the 5'-end base number of the probe sequence. There are 2 bases AA spaced between the dT-fluorescent group and the dT-quencher group. Among them, the base A at the position 33 bp from the 5'-end base number is replaced by tetrahydrofuran THF, and the 3'-end is modified by C3-spacer.

4. The primer-probe composition for detecting Cryptosporidium based on the RAA technology according to claim 3, wherein The fluorescent group is FAM; the quencher group is BHQ1.

5. A detection reagent, characterized in that, The reagent contains the primer set described in claim 1 and / or the probe described in any one of claims 2-4.

6. A detection kit, characterized in that, The detection kit contains the detection reagent described in claim 5.

7. The detection kit according to claim 6, wherein The working concentrations of the forward primer Tcp-F112-142, the reverse primer Tcp-R261-291 and the probe qtan166-215 in the detection kit are all 10 μM.

8. The detection kit according to claim 7, wherein, The detection kit also includes reagents for the RAA reaction.

9. A method for detecting Cryptosporidium for non-diagnostic and non-therapeutic purposes, characterized in that, The method includes the following steps: Extract the sample DNA; Perform RAA amplification on the sample DNA obtained in step (1) using the detection kit described in any one of claims 6-8; According to the amplification result, determine whether Cryptosporidium is contained in the sample.

10. Use of the primer set described in claim 1 and / or the probe described in any one of claims 2-4 in the preparation of a Cryptosporidium detection preparation.

Citation Information

Patent Citations

  • Detection methods and kits for Cryptosporidium microsporidium

    CN103898203B

  • Fluorescent quantitative PCR primer for detecting Cryptosporidium parvum, probe, kit and method

    CN109234420A

  • Multiple PCR (polymerase chain reaction) detection kit and method for giardia and cryptosporidia of cattle

    CN108796106A

  • Primer, probe and detection method for detecting cryptosporidium by RAA fluorescence method

    CN110055344A

  • RAA primer, probe and detection method for detecting pasteurella multocida diseases

    CN111621580A