Quadruple fluorescent quantitative PCR (Polymerase Chain Reaction) detection method for simultaneously detecting multiple pathogens in bovine red blood cells

By designing a quadruple real-time PCR detection method, conserved sequences of pathogens in bovine erythrocytes were obtained and screened. PCR primers and probes with the same annealing temperature were constructed, solving the problem of simultaneous detection of multiple pathogens in existing technologies and achieving efficient and reliable multi-pathogen diagnosis.

CN120966957APending Publication Date: 2025-11-18XILINGOL VOCATIONAL COLLEGE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510991271.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-18
Publication Date
2025-11-18

AI Technical Summary

Technical Problem

Existing detection methods are ineffective in identifying mixed infections of multiple pathogens in bovine erythrocytes, and existing single-probe qPCR detection is inefficient and costly.

Method used

A quadruple real-time PCR detection method was designed. The core functional gene sequence of the pathogen was obtained, and conserved sequences were screened using ClustalW and MEGA software. PCR primers and probes with the same annealing temperature were designed, and DNA ligase was used to ligate them into T vectors and transform them into competent cells. Blue-white screening and plasmid extraction were performed, and reaction conditions were optimized.

Benefits of technology

It significantly improves the efficiency of simultaneous detection of multiple pathogens in bovine erythrocytes, reduces the risk of missed diagnoses, and provides a rapid and reliable diagnostic tool.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120966957A_ABST
    Figure CN120966957A_ABST
Patent Text Reader

Abstract

The invention discloses a quadruple fluorescent quantitative PCR (Polymerase Chain Reaction) detection method for simultaneously detecting multiple pathogens in bovine red blood cells. The method comprises the following steps: acquiring core functional gene sequences of four pathogens; carrying out gene sequence comparison, and screening out continuous conservative fragments; comparing the conserved sequence with the bovine genome and the homology of the microorganisms to obtain a specific conserved sequence; designing four pairs of PCR primers with the same annealing temperature, and designing a probe; selecting a gene sequence fragment, treating the gene sequence fragment with restriction enzyme, and connecting a target gene fragment with a T vector by using DNA (Deoxyribose Nucleic Acid) ligase; transforming the connection product into competent cells for culture, determining successful cloning, and extracting plasmids; the PCR primer and the probe are tested for multiple times, and the annealing temperature and the component concentration of a reaction system are adjusted. By implementing the method disclosed by the invention, babesia, theileria, anaplasma and eperythrozoon can be detected at the same time, the diagnosis efficiency is remarkably improved, and the risk of missed diagnosis is reduced.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a PCR detection method, more particularly to a quadruple fluorescent quantitative PCR detection method for simultaneously detecting multiple pathogens in bovine red blood cells BACKGROUND

[0002] Babesia, Theileria, Anaplasma and Eperythrozoon are four major pathogenic microorganisms that parasitize in bovine red blood cells. These pathogens can cause anemia, jaundice, and even death in severe cases, posing a serious threat to the cattle industry. In order to effectively control these diseases, accurate diagnostic methods are particularly important.

[0003] Existing detection methods include blood smear staining microscopy, which is a traditional detection method. By collecting anti-coagulated blood from suspected infected sick cattle, preparing blood smears, staining (such as Wright's staining method or Giemsa staining method), and then observing whether there are typical pathogen morphologies in red blood cells using a microscope. This method is effective for single pathogen infection, but has poor recognition ability for mixed infection, because different pathogens may exhibit atypical morphology when coexisting, increasing the difficulty of diagnosis. It also includes ordinary PCR detection, which uses polymerase chain reaction (PCR) technology to amplify target gene fragments, and then analyzes the results by agarose gel electrophoresis. Although it has high sensitivity and specificity, the operation steps are complex, requiring high professional technical level, and the entire process takes a long time, which is not suitable for popularization in grass-roots quarantine work. It also includes single-probe qPCR detection, which is an improvement over traditional PCR. Real-time fluorescent quantitative PCR (qPCR) introduces fluorescently labeled probes, improving the specificity and speed of the reaction. However, existing single-probe qPCR detection can only detect one pathogen at a time. If you want to cover all four pathogens, you need to test multiple times or use multiple devices at the same time, which not only prolongs the detection time, but also greatly increases the cost.

[0004] However, blood smear staining microscopy is difficult to deal with mixed infection of multiple pathogens; ordinary PCR detection is complex and requires high technical skills, making it unsuitable for widespread application in grass-roots; single-probe qPCR detection has high sensitivity, but due to the inability to simultaneously detect multiple pathogens, it results in low detection efficiency and high cost.

[0005] Therefore, it is necessary to design a new method to simultaneously detect Babesia, Theileria, Anaplasma and Eperythrozoon, significantly improve the diagnostic efficiency and reduce the risk of missed diagnosis. SUMMARY

[0006] The present application aims to overcome the shortcomings of the prior art and provide a quadruple fluorescent quantitative PCR detection method for simultaneously detecting multiple pathogens in bovine red blood cells.

[0007] To achieve the above object, the application adopts the following technical scheme: a quadruple fluorescence quantitative PCR detection method for simultaneously detecting multiple pathogens in bovine red blood cells, comprising: obtaining core functional gene sequences of four pathogens; using ClustalW to perform gene sequence alignment, and screening a continuous conservative fragment with required consistency and length by MEGA software to obtain a conservative sequence; comparing the conservative sequence with the homology of bovine genome and microorganisms to obtain a specific conservative sequence; designing four pairs of PCR primers with the same annealing temperature and designing probes based on the specific conservative sequence; selecting a gene sequence fragment, treating it with a restriction endonuclease, and using DNA ligase to connect the target gene fragment with a T vector to obtain a connection product; culturing the connection product in a competent cell, determining a successful clone containing an inserted fragment, and extracting a plasmid; testing the PCR primers and probes multiple times to adjust the annealing temperature and the concentration of the reaction system components.

[0008] Further technical schemes are as follows: the core functional gene sequences of the four pathogens are obtained, comprising: obtaining gene sequences of various strains of Babesia, Theileria, Eperythrozoon and Anaplasma from GenBank in the NCBI database to obtain the core functional gene sequences of the four pathogens.

[0009] Further technical schemes are as follows: the gene sequence alignment is performed using ClustalW, and a continuous conservative fragment with required consistency and length is screened by MEGA software to obtain a conservative sequence, comprising: the gene sequence alignment is performed using ClustalW, and a continuous conservative fragment with consistency not less than 90% and length not less than 15-20 bp is screened by MEGA software to obtain a conservative sequence.

[0010] Further technical schemes are as follows: the homology of the conservative sequence with bovine genome and microorganisms is compared to obtain a specific conservative sequence, comprising: the homology of the conservative sequence with bovine genome and microorganisms is compared by BLAST tool to ensure that the homology between non-target species is not greater than 70% to obtain a specific conservative sequence.

[0011] Further technical schemes are as follows: four pairs of PCR primers with the same annealing temperature are designed based on the specific conservative sequence, and probes are designed, comprising: Four pairs of PCR primers with the same annealing temperature were designed using PrimerPlex, and probes with a Tm value 5-10℃ higher than the primers were designed using Primer Express™ to ensure preferential binding to the template.

[0012] The further technical solutions are as follows: a gene sequence fragment is selected, the gene sequence fragment is treated by a restriction enzyme, and a DNA ligase is used to connect the target gene fragment and a T vector to obtain a connection product, including: A gene sequence fragment is selected using Primer5, the gene sequence fragment is treated by a restriction enzyme, and a DNA ligase is used to connect the target gene fragment and a T vector to obtain a connection product.

[0013] The further technical solutions are as follows: the connection product is transformed into a competent cell for culture, and a successful clone containing an inserted fragment is determined, and a plasmid is extracted, including: The connection product is transformed into a competent cell for culture, and a successful clone containing an inserted fragment is determined by blue-white spot screening, and a plasmid is extracted.

[0014] The further technical solutions are as follows: the connection product is transformed into a competent cell for culture, and a successful clone containing an inserted fragment is determined by blue-white spot screening, and a plasmid is extracted, including: The connection product is transformed into a competent cell, and a specific restriction enzyme is used to cut the target gene and the T vector to form complementary cohesive ends; The target gene fragment with the complementary cohesive ends and the T vector are connected by a DNA ligase to construct a recombinant plasmid; The connection product and the competent cell are mixed and then subjected to heat shock treatment, so that the recombinant plasmid enters the cell and replicates in the cell; The transformed cell is resuscitated in LB liquid medium without an antibiotic, and is coated on an LB plate containing an antibiotic for culture; Blue-white spot screening is performed on an LB agar plate containing IPTG / X-gal, and a white colony indicates a positive clone in which the target gene is successfully inserted; The plasmid DNA is extracted from the screened positive clone.

[0015] The further technical solutions are as follows: the connection product and the competent cell are mixed and then subjected to heat shock treatment, so that the recombinant plasmid enters the cell and replicates in the cell, including: 5 μL of the connection product is added to 50 μL of the competent cell, and is left on ice for 30 minutes to allow the DNA to enter the cell, is subjected to heat shock at 42℃ for 45 seconds, and is immediately placed on ice for cooling for 2 minutes to help the cell absorb the exogenous DNA.

[0016] Further technical solutions are that the transformed cells are resuscitated in the LB liquid medium without antibiotics and are inoculated on the LB plate with antibiotics for culture, comprising: 500 μL of the LB liquid medium without antibiotics is added, and resuscitation culture is carried out at 37℃ on a shaking table for 45 to 60 minutes; The supernatant is removed by centrifugation, and the medium resuspended with bacterial bodies is inoculated on the LB plate with antibiotics, and is cultured at 37℃ for 12 to 16 hours, so that the bacteria grow and express the resistance genes.

[0017] Compared with the prior art, the present application has the beneficial effects that: the core functional gene sequences of the four pathogens are obtained, and ClustalW is used for comparison, and then the MEGA software is used to screen out continuous conservative fragments meeting the consistency and length requirements as conservative sequences, and the homology of the conservative sequences with the bovine genome and other microorganisms is further compared to ensure specificity, and four pairs of PCR primers and corresponding probes with the same annealing temperature are designed based on the screened specific conservative sequences; the target gene fragment is selected, treated by a restriction endonuclease, connected with a T vector by using a DNA ligase, and transformed into a competent cell for culture, and the successful clone containing the correct inserted fragment is selected and the plasmid is extracted, and finally the optimal reaction condition is adjusted by optimizing and testing the PCR primers and the probes for multiple times. This method not only significantly improves the simultaneous detection efficiency for the four pathogens, but also greatly reduces the risk of missed diagnosis, and provides a fast and reliable tool for clinical diagnosis.

[0018] The present application will be further described below in combination with the drawings and specific embodiments. BRIEF DESCRIPTION OF DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0020] Figure 1 The flowchart of the quadruple fluorescence quantitative PCR detection method for simultaneously detecting multiple pathogens in bovine red blood cells provided by the embodiments of the present application is shown in the figure; Figure 2 The schematic diagram of mixed probe detection of anaplasma positive plasmid provided by the embodiments of the present application is shown in the figure; Figure 3 The schematic diagram of mixed probe detection of anaplasma positive plasmid provided by the embodiments of the present application is shown in the figure; Figure 4 The schematic diagram of mixed probe detection of anaplasma positive plasmid provided by the embodiments of the present application is shown in the figure; Figure 5 The schematic diagram of mixed probe for detecting Theileria positive plasmid is provided for the embodiments of the present application. DETAILED DESCRIPTION

[0021] The technical solutions in the embodiments of the present application will be clearly and completely described in combination with the drawings in the embodiments of the present application. Obviously, the described embodiments are some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative efforts belong to the protection scope of the present application.

[0022] It should be understood that, when used in the specification and the appended claims, the terms "comprise" and "include" indicate the presence of described features, integers, steps, operations, elements, and / or components, but do not exclude one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0023] It should also be understood that the terms used in the present application specification are only for the purpose of describing specific embodiments and are not intended to limit the present application. As used in the present application specification and the appended claims, "a", "an", and "the" are intended to include the plural forms unless the context clearly indicates otherwise.

[0024] It should be further understood that the term "and / or" used in the present application specification and the appended claims means any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.

[0025] Please refer to Figure 1 , Figure 1 The schematic flow chart of the quadruple fluorescence quantitative PCR detection method for simultaneously detecting multiple pathogens in bovine red blood cells provided for the embodiments of the present application is shown. First, the core functional gene sequences of the four pathogens are obtained from the NCBI database. The conserved sequences with high consistency and moderate length are screened out through ClustalW alignment and MEGA software, and the BLAST tool is used to ensure that the homology between these sequences and non-target species does not exceed 70%, so as to design specific PCR primers and probes. Subsequently, specific gene fragments are selected and connected to T vector after restriction enzyme treatment, and the recombinant plasmid is transformed into competent cells. Successful cloning is determined by blue-white spot screening, and the plasmid is extracted. Finally, the PCR primers and probes are optimized and tested multiple times, the annealing temperature and the concentration of the reaction system components are adjusted, and the accuracy and sensitivity of the detection are ensured. This method can significantly improve the diagnostic efficiency and reduce the risk of missed diagnosis, and provides a reliable solution for the simultaneous rapid detection of multiple pathogens.

[0026] Figure 1 is a flowchart of a four-fluorescence quantitative PCR detection method for simultaneously detecting multiple pathogens in bovine red blood cells provided by an embodiment of the present application. As shown in Figure 1 , the method comprises the following steps S110-S170.

[0027] S110, obtaining core functional gene sequences of four pathogens.

[0028] In this embodiment, the gene sequences of various strains of Babesia, Theileria, Eperythrozoon and Anaplasma were obtained from GenBank in the NCBI database to obtain the core functional gene sequences of the four pathogens.

[0029] In this embodiment, in order to ensure that the designed PCR primers and probes can specifically and sensitively detect Babesia, Theileria, Eperythrozoon and Anaplasma, the gene sequences of various strains of the four pathogens were first obtained from GenBank in the NCBI database.

[0030] For each pathogen, its core functional gene was selected as the research object. For example, the RAP gene of Babesia, the cytb gene of Theileria, the 16S rRNA gene of Eperythrozoon and the msp4 gene of Anaplasma. These genes are not only essential for the function of the pathogen, but also have high conservation in different geographically distributed strains.

[0031] In order to ensure that the selected conserved sequences have wide representativeness, multiple strains from different geographical locations and publication years were included in the data collection to ensure that the designed primers and probes can be applied to a wider range of situations.

[0032] S120, using ClustalW to align the gene sequences, and using MEGA software to select continuous conserved fragments with required consistency and length to obtain conserved sequences.

[0033] In this embodiment, the conserved sequence refers to a DNA, RNA or protein sequence that is highly similar or completely identical in different species or different individuals of the same species due to its important biological function.

[0034] Using ClustalW to align the gene sequences, and using MEGA software to select continuous conserved fragments with consistency not less than 90% and length not less than 15-20bp to obtain conserved sequences.

[0035] In this embodiment, to ensure that the designed PCR primers and probes can provide highly specific and sensitive detection methods for Babesia, Theileria, Eperythrozoon and Anaplasma, it is necessary to screen highly conserved DNA fragments from the core functional gene sequences of these pathogens.

[0036] Specifically, first, according to the gene sequences of different geographical distribution strains obtained from the NCBI database in step S110.

[0037] The collected gene sequences of multiple strains are subjected to multiple sequence alignment using ClustalW software. ClustalW is a widely used bioinformatics tool that can effectively align multiple sequences and identify their similarity regions. Through this alignment, we can find conserved sequences shared by different strains.

[0038] The alignment results generated by ClustalW are imported into MEGA software. MEGA (Molecular Evolutionary Genetics Analysis) is a powerful molecular evolution genetic analysis tool that can help further analyze the consistency and evolutionary relationship of sequences.

[0039] Set the consistency not less than 90% as the screening standard. This means that at least 90% of the sites in the selected conserved fragments are the same in all compared sequences.

[0040] At the same time, the length of the conserved fragment should not be less than 15-20bp. This is because shorter sequences may not provide enough specificity to design effective PCR primers or probes, while longer sequences may increase experimental complexity and cost.

[0041] Calculate the consistency proportion of each site by MEGA software, and mark the continuous conserved fragments that meet the above conditions (i.e. consistency ≥ 90%, length ≥ 15-20bp). These fragments are considered to be conserved sequences suitable for subsequent primer and probe design.

[0042] For the screened conserved sequences, further verification is needed to determine whether they are significantly different from other organisms other than the target species, in order to avoid potential cross-reactions. This is usually done through BLAST search to ensure that the screened conserved sequences have high specificity.

[0043] Through the above steps, highly conserved sequences suitable for PCR primer and probe design can be accurately screened from a large amount of gene sequence data, thereby providing a solid foundation for developing an efficient four-fluorescence quantitative PCR detection method. This method not only improves the accuracy and efficiency of detection, but also reduces the risk of missed diagnosis, enabling primary veterinarians and cattle breeders to more effectively prevent and treat blood parasites.

[0044] S130, comparing the conservation sequence with the homology of the bovine genome and microorganisms to obtain specific conservation sequences.

[0045] In this embodiment, specific conservation sequences refer to DNA, RNA or protein sequences that remain highly similar or identical in the target species (e.g. cattle) but have significant differences in non-target species (e.g. microorganisms).

[0046] Specifically, by comparing the conservation sequence with the homology of the bovine genome and microorganisms using the BLAST tool, it is ensured that the homology between non-target species is not more than 70%, to obtain specific conservation sequences.

[0047] By using the BLAST (Basic Local Alignment Search Tool) bioinformatics tool to compare the conservation sequence with the homology of the bovine genome and selected microorganisms, sequences that exist in the bovine genome but are not common or do not exist in microorganisms can be screened. This process ensures that the homology of the identified conservation sequences in non-target species is not more than 70%, thereby ensuring that these sequences have sufficient specificity for the target species.

[0048] This specific confirmation step is crucial as it helps to avoid potential cross-reactions, especially during the development of diagnostic reagents or therapeutic regimens. In addition, this method can also help researchers better understand the evolutionary relationships between different species and their unique biological characteristics, providing a solid foundation for subsequent functional verification and application research. Therefore, by setting a strict homology threshold (not more than 70%), highly specific conservation sequences for a specific target species can be effectively identified, thereby promoting progress in the fields of precision medicine, molecular marker development, etc.

[0049] S140, designing four pairs of PCR primers with the same annealing temperature based on the specific conservation sequences, and designing probes.

[0050] In this embodiment, four pairs of PCR primers with the same annealing temperature are designed using PrimerPlex, and probes with a Tm value of 5-10°C higher than the primers are designed using Primer Express™ to ensure preferential binding to the template.

[0051] In step S140, based on the previously determined specific conserved sequences, the next task is to design four pairs of PCR primers with the same annealing temperature and design probes. This process is crucial for ensuring the efficiency and specificity of the PCR reaction.

[0052] Firstly, the four pairs of PCR primers are designed using the PrimerPlex software. PrimerPlex is a powerful multiplex PCR primer design tool that helps users generate optimal primer combinations based on specified parameters. In this example, each pair of primers is designed with the same annealing temperature, which maintains consistent reaction conditions during PCR amplification, thereby improving amplification efficiency and specificity. By setting appropriate parameters such as primer length, GC content, and avoiding primer dimer formation, PrimerPlex can screen the best primer combinations that meet these conditions.

[0053] Secondly, to further enhance the specificity and sensitivity of detection, Primer Express™ software is used to design probes with a Tm value (melting temperature) that is 5-10°C higher than the designed PCR primers. Primer Express™ is another professional primer and probe design software suitable for probe design in real-time quantitative PCR (qPCR). Higher Tm values allow the probe to bind to the target sequence after the primer binds to the template, which helps to reduce non-specific binding and ensures that the probe preferentially and stably binds to the target template. Typically, such probes use fluorescence labeling technology to facilitate real-time monitoring of the accumulation of amplification products during PCR reactions.

[0054] In summary, in this embodiment, the design strategies of PrimerPlex and Primer Express™ not only ensure the optimal matching and consistency between PCR primers, but also optimize the Tm value of the probe to improve the performance of the entire PCR system, providing reliable technical support for subsequent gene analysis. This method shows significant advantages for precise detection of genetic information of specific species, especially in achieving efficient and accurate amplification of target sequences in complex samples.

[0055] S150, select the gene sequence fragment, after restriction enzyme treatment, use DNA ligase to connect the target gene fragment with T vector to obtain the connection product.

[0056] In this embodiment, the connection product refers to the recombinant DNA molecule formed by successfully connecting the target gene fragment with the T vector using DNA ligase after restriction enzyme treatment.

[0057] Specifically, the gene sequence fragments are selected using Primer5, and after restriction enzyme treatment, the target gene fragments are connected with T vectors using DNA ligase to obtain the ligation product.

[0058] Step S150 involves an important step in genetic engineering: combining selected gene sequence fragments with vectors for subsequent cloning, expression, and other operations. In this process, first, appropriate gene sequence fragments need to be selected, then these fragments and vectors are cut by restriction enzymes, and finally DNA ligase is used to connect them to form recombinant DNA molecules. The process is described in detail below.

[0059] In this embodiment, Primer5 software is used to select specific gene sequence fragments. Primer5 is a professional software widely used in designing PCR primers and analyzing gene sequences. It can help users accurately select specific regions of target genes as amplification templates according to experimental needs. This process includes considering the functional domains, conserved regions, and key sequence characteristics that may affect downstream applications such as expression studies.

[0060] Once the desired gene sequence fragments are determined, the next step is to treat them with restriction enzymes. Restriction enzymes are a class of enzymes that can recognize and cut specific sites on double-stranded DNA. Selecting the appropriate restriction enzyme is crucial to ensure that the target gene fragment can be correctly inserted into the vector. Generally, appropriate enzymes are selected based on the characteristics of the target sequence and the type of vector used to ensure that the ends after cutting can match the corresponding ends of the vector.

[0061] After completing the restriction enzyme treatment, the next task is to connect the target gene fragments with T vectors. T vectors are a special type of plasmid vector, and their name comes from the fact that one end has a protruding thymine (T) residue. This design is to facilitate direct connection with target gene fragments treated with blunt ends or sticky ends, as most PCR products are blunt-ended. In this process, DNA ligase plays a key role, as it can catalyze the formation of phosphodiester bonds between two DNA fragments, thereby achieving physical connection between fragments.

[0062] Finally, the ligation product obtained through the above steps is the recombinant T vector containing the target gene fragments. Such recombinant vectors can be replicated and amplified in host cells such as E. coli, and provide basic materials for further molecular biology research, such as protein expression, gene function analysis, etc.

[0063] In summary, in the present embodiment, by using Primer5 to select a gene sequence fragment, using restriction endonuclease treatment, and then using DNA ligase to connect the target gene fragment with the T vector, the expected connection product is successfully obtained. This method not only simplifies some complex steps in traditional cloning technology, but also improves the experimental efficiency and success rate.

[0064] S160, transforming the connection product into competent cells for culture, and determining successful clones containing the inserted fragment and extracting plasmid.

[0065] In the present embodiment, the connection product is transformed into competent cells for culture, and the successful clones containing the inserted fragment are determined by blue-white spot screening method, and the plasmid is extracted.

[0066] In an embodiment, the above step S160 can include steps S161-S166.

[0067] S161, transforming the connection product into competent cells, using specific restriction endonuclease to cut the target gene and the T vector to form complementary cohesive ends; S162, connecting the target gene fragment with complementary cohesive ends to the T vector by DNA ligase to construct a recombinant plasmid; S163, mixing the connection product with competent cells and performing heat shock treatment, so that the recombinant plasmid enters the cells and replicates in them.

[0068] Specifically, 5 μL of the connection product is added to 50 μL of competent cells, and incubated on ice for 30 minutes to allow the DNA to enter the cells, heat shocked at 42°C for 45 seconds, immediately placed on ice for 2 minutes to help the cells absorb the exogenous DNA.

[0069] S164, recovering the transformed cells in LB liquid medium without antibiotics, and coating on LB plate containing antibiotics for culture.

[0070] Specifically, 500 μL of LB liquid medium without antibiotics is added, and incubated at 37°C on a shaker for 45 to 60 minutes; Centrifugation to remove the supernatant, leaving the culture medium to resuspend the bacterial cells, and coating the culture medium to resuspend the bacterial cells on the LB plate containing antibiotics, and incubating at 37°C for 12 to 16 hours to allow the bacteria to grow and express the resistance gene.

[0071] S165, using LB agar plate containing IPTG / X-gal for blue-white spot screening, and white colonies indicating positive clones successfully inserted with the target gene; S166, extracting plasmid DNA from the screened positive clones.

[0072] In this embodiment, in step S160, the ligation product obtained in the previous step (i.e., the recombinant plasmid) is transformed into competent cells for culture, and a successful clone containing the inserted fragment is determined through a series of screening methods, and finally the plasmid is extracted. The specific operation includes the following steps: First, the target gene and T vector are cut using a specific restriction enzyme to form complementary cohesive ends, which prepares for the subsequent ligation reaction.

[0073] Then, the target gene fragment with complementary cohesive ends is ligated with the T vector using DNA ligase to construct a recombinant plasmid. This is a key step to realize the expression or replication of the exogenous gene in the host cell.

[0074] Next, the above-obtained ligation product is mixed with the prepared competent cells, and heat shock treatment (such as 5 μL of ligation product added to 50 μL of competent cells, incubated on ice for 30 minutes, then heat shocked at 42°C for 45 seconds, and then quickly cooled) is performed to allow the recombinant plasmid to enter the cells and start replication therein.

[0075] The transformed cells need to be recovered in LB liquid medium without antibiotics for a period of time (for example, 500 μL of LB liquid medium without antibiotics is added, and incubated at 37°C on a shaker for 45 to 60 minutes), and then centrifuged to remove the supernatant, and the bacterial cells are resuspended with the remaining culture medium. Then, these cells are plated on LB plates containing appropriate antibiotics, and incubated at 37°C for 12 to 16 hours to allow the bacteria to grow and express the resistance gene.

[0076] Blue-white spot screening is performed using an LB agar plate containing IPTG / X-gal, where white colonies indicate positive clones with successful insertion of the target gene. This is because clones without inserted exogenous DNA express β-galactosidase, making the colonies appear blue; while clones with inserted exogenous DNA cannot express the enzyme completely, and therefore appear white.

[0077] Finally, the plasmid DNA is extracted from the screened positive clones, ready for further analysis or application.

[0078] S170, the PCR primers and probes are tested multiple times, and the annealing temperature and the concentration of the reaction system components are adjusted.

[0079] The PCR primers and probes are tested multiple times, and the annealing temperature and the concentration of the reaction system components are adjusted to optimize the PCR reaction conditions.

[0080] The method of the embodiment establishes a multiplex fluorescent quantitative PCR (qPCR) method capable of simultaneously detecting four blood pathogens of Babesia, Theileria, Eperythrozoon and Anaplasma. To achieve this goal, first, the multiple strains of the four pathogens are collected in the NCBI GenBank database, covering different geographical strains and publication years, focusing on the core functional genes of each pathogen, including the RAP gene of Babesia, the cytb gene of Theileria, the 16S rRNA gene of Eperythrozoon and the msp4 gene of Anaplasma.

[0081] Based on data collection, ClustalW is used to align homologous sequences, and MEGA software is used to calculate site conservation. With a consistency of ≥ 90% as the threshold, continuous conservative fragments with a length of not less than 15-20 bp are screened to meet the subsequent primer and probe design requirements. Then, the BLAST tool is used to perform homology comparison of the candidate conservative sequences with the bovine genome and common symbiotic / parasitic microbial sequences to ensure significant differences (homology ≤ 70%) with non-target species sequences to avoid cross-reactions.

[0082] The design of primers and probes uses PrimerPlex software for multiplex PCR strategy optimization, sets the "minimum dimer" option, and ensures that the output primer pair is compatible with the TaqMan probe. The probe design is completed using Primer Express™ software, with the probe Tm value set to be higher than the primer by 5-10°C (65-75°C) to ensure that the probe binds to the template preferentially. Primer5 software is further used to select target sequences containing primer sites within each pathogen, remove restriction enzyme sites, and have a length of not more than 300 bp for constructing positive control plasmids.

[0083] Restriction enzymes are used to cut the synthesized target gene fragments and T vectors to form complementary cohesive ends; then DNA ligase is used to link the target fragments and T vectors to construct four recombinant cloning vectors containing pathogen target sequences. The ligation product is transformed into competent cells: 5 μl of ligation product is mixed with 50 μl of competent cells, and after ice bath for 30 minutes, it is heated at 42°C for 45 seconds, and then ice bath for 2 minutes; 500 μl of antibiotic-free LB liquid medium is added, and incubated at 37°C for 45-60 minutes; after centrifugation and discarding 400 μl of supernatant, the bacterial cells are resuspended and plated on LB plates containing antibiotics (such as Amp⁺), and incubated at 37°C for 12-16 hours. White colonies (containing inserted fragments) are selected by blue-white spot screening (containing IPTG / X-gal), and the extracted plasmid is the positive control. The negative control is the non-recombinant corresponding empty vector.

[0084] Furthermore, the method in this embodiment also includes a rapid nucleic acid release agent for blood samples and an optimized qPCR reaction system. The experimental challenges lie in the accurate screening of the target gene sequence and the consistent design of the annealing temperatures for the four primer pairs, requiring multiple tests and adjustments to achieve efficient co-detection of four pathogens in a single reaction system.

[0085] Please see Figures 2 to 5 The four probe primers were mixed to detect four plasmids, specifically including: Specific primers and probes were designed for the genomes of *Aphelenchus hygrophytes*, *Heliophytes*, *Theileria*, and *Babesia*, and corresponding positive plasmids were synthesized for testing. The primer, probe, and plasmid sequences for each parasite are as follows: No slurry: Upstream primer: CGTAGTCAAAATTGATGAAATCACA; Downstream primer: AGGATATTTCCGGAGTAAACTGGT; Probe sequence: FAM-CACCTCAGTCATGTTAAATGGCTGC-BHQ1; plasmid sequence: GCGCTGTGGGATATTCTCTGGGAGGAGCCAGAGTGGAATTGGAAGCGAGCTACAGAAGGTTTGCTACTTTGGCGGACGGGCAGTACGCAAAAAGTGGTGCGGAATCTCTGGCAGCTATTACCCGCGACGCTAACATTACTGAGACCAATTACTTCGTAGTCAAAATTGATGAAATCACAAACACCTCAGTCATGTTAAATGGCTGCTATGACGTGCTGCACACAGATTTACCTGTGTCCCCGTATG TATGTGCCGGGATAGGCGCGCAAGCTTTGTTGACATCTCTAAGCAAGTAACCACAAAGCTGGCCTACAGGGGCAAGGTTGGGATTAGCTACCAGTTTACTCCGGAAATATCCTTGGTGGCAGGTGGGTTCTACCACGGGCTATTTGATGAGTCTTACAAGGACATTCCCGCACACAACAGTGTAAAGTTCTCTGGAGAAGCAAAAGCCTCAGTCAAAGCGCATATTGCTGACTACGGCTTAACCTT.

[0086] Appendix in red: Upstream primer: ATATTCCTACGGGAAGCAGCAG; Downstream primer: TAATGCTCGTGACCTATGTTTTACC; Probe sequence: HEX-ACAATGGACGAAAGTCTGATGGAGC-BHQ1; Plasmid sequence: ACTAAATCAAAGAGGCTCCCTCGGGGGCCTCGCGTGAAAATAGGAATATGTCCTATTAGGTAGTTGGCGGGGTAAAGGCCCACCAAGCCAGTGATGGGTAGCTGGACTGAGAGGTTGAACAGCCGCAATGGGATTGAGATATGGCCCATATTCCTACGGGAAGCAGCAGTGAGGAATTTTTCACAATGGACGAAAGTCTGATGGAGCAATACCACGTGAACGATGAAGGTCTTCTGATTGTAAAGTTCTTTTATTTAGGAAAAAAAGCGCGCTAGGAAATGAGCGCGCCTTGATGGTACTAATTGAATAAGTGACAGCTAACTATGTGCCAGCAGCTGCGGTAAAACATAGGTCACGAGCATTATCCGGATTTATTGGGCGTAAAGGAAGCGTAGGTGGGGAGGTTGATCCATTGTTAAAGGCATTTGCTTAACAAATGTGTGCGATGGAGATCGCCTCCCTAGAGTTAATCAGGGGGTACTGGAATTCAATGTGTAGC; Babesia: Upstream primer: TCTTCACCATDTCAGCATAACG; Downstream primer: GCCAAGTTYTTCAACAGATTCAG; Probe sequence: JOE-GCAAACTTGGAAWGWGWTGGAATC-BHQ1; Plasmid sequence: TGGTAACTTCGTTAGTATCCTCGATGAACTTCTTTGTAGGTTGGGTAACGTTTTTAGAGAAAAAGTCTCTGAATTTCTCTATCCATCTTTTGTACCAAGGAGCTTCAACGTACGAGGTCAAGCTACCGAGCAGAACCTTCTTCACCATGTCAGCATAACGACGTGCAAACTTGGAAAGAGTTGGAATCTGGGTCAACATGTAATCTTCGTAGCTGCTAGTAAGTTGAGTGATACGTTCGATGCTCCTTTCTTCAAAATCTTCAGGAACATTCCACCTGATGATATCACTCAATGTTTGCTTAATACGACGACTGAATATCTTTGTAGTGAAGCTGAATCTGTTGAAGAACTTGGCGTTCATACTGTTTACTGTCAAATAAGTCTTGTAGTTCATGGTAGCCATATAGAGTACCTTGTTGACAAGATATTCAACATCGGTAGTTCCTTCCTCGTGCACAACATTGTTGTTCAACAGACCAGTGACGAAGTAGTGGTAA; Theileria: Upstream primer: TGTTAAACATTTGTTTCGGTTGG; Downstream primer: GTAATACATAACCAACAAAAGCGGT; Probe sequence: cy5-TTGTTCGTCTTTATCACTCGTTTGGAG-BHQ3; Plasmid sequence: CGGGTTGATGCTTTCTTTCTTTTATGTGCCAGCAAAAGGTATGGCTTTTGAAAGTACTTTGGCCGTAATGTTAAACATTTGTTTCGGTTGGTTTGTTCGTCTTTATCACTCGTTTGGAGTTTCATTTTATTTCTTCTTTATGTTTCTACATATCATGAAAGGTATGTGGTATTCTAGTAATCATTTACCTTGGTCTTGGTATTCTGGTGTTGTTATTTTCGTTTTAAGTATAGCAACCGCTTTTGTTGGTTATGTATTACCAGATGGTCAAATGAGCTTCTGGGGAGCTACAGTCATAGGTGGTTTGTTGAAATTTTTTGGAAAAACTAATGTTCTAATTTTTGGAGGCCAAACAGTTGGTCCAGAGACATTAGAGAGATTCTTTTCTATACATGTTATATTGCCTGTGATTATATTGTTAGTTGTTATATTTCATCTTTATGTTCTTCATAGAGATGGAAGTTCAAATCCATTGGCAGTTA.

[0087] Experimental verification shows that the probes and primers corresponding to the four pathogens have good specificity in the mixed reaction system: the Ct value of the plasmid without plasma is 25.99, only the plasma-free probe is amplified; the Ct value of the positive plasmid of the erythrocyte is 5, only the erythrocyte probe is amplified; the Ct value of the Babesia positive plasmid is 10.45, only the Babesia probe is amplified; the Ct value of the Theileria positive plasmid is 10.45, only the Theileria probe is amplified. The above results confirm that the method of the present embodiment has high specificity and sensitivity in multiplex qPCR detection.

[0088] As can be seen, the method of the present embodiment screens and confirms a group of highly conserved (i.e. almost no variation between different species or strains) but also with intergeneric resolution (can distinguish the difference between different genera) gene sequences in four different pathogens. This group of gene sequences is crucial for the diagnosis and research of specific pathogens.

[0089] The presence of this gene sequence makes it possible to develop a unified detection method for these pathogens, greatly improving the detection efficiency and accuracy. Due to its conservation, it can ensure the stability and reliability of the detection method; and its intergeneric resolution ensures the accuracy of identification.

[0090] Four pairs of specific primers and their corresponding four fluorescent probe sequences were developed and optimized through multiple experiments, especially achieving consistent annealing temperatures for all primer pairs. This means that during PCR amplification, all primers can work efficiently under the same conditions, simplifying experimental design and reducing variables.

[0091] By optimizing all primer pairs to have the same annealing temperature, not only does it improve the simplicity and repeatability of experimental operations, but it also enhances the consistency and reliability of detection results. This is particularly important for high-throughput, automated detection processes.

[0092] Four positive control plasmids containing the selected target insert sequences were created. These plasmids serve as standard references to verify the accuracy and sensitivity of the detection system.

[0093] Positive control plasmids provide a reliable standard for each experiment, helping researchers determine whether the experiment was successful and the results are valid. They are an important part of quality control, ensuring the authenticity and comparability of experimental data.

[0094] In summary, the method of the present embodiment provides an efficient, accurate, and reliable pathogen detection scheme by combining highly conserved and discriminative gene sequences, optimized primer and probe design, and standardized positive control plasmids. This not only promotes scientific research progress in related fields, but also provides strong technical support for public health safety.

[0095] The above-mentioned four-fluorescence quantitative PCR detection method for simultaneously detecting multiple pathogens in bovine red blood cells acquires the core functional gene sequences of the four pathogens, uses ClustalW for comparison, and then uses MEGA software to screen continuous conservative fragments that meet the consistency and length requirements as conservative sequences. These conservative sequences are further compared with the homology of bovine genome and other microorganisms to ensure specificity. Based on the screened specific conservative sequences, four pairs of PCR primers and corresponding probes with the same annealing temperature are designed. The target gene fragments are treated with restriction endonuclease, then connected with T vector using DNA ligase, and then cultured in competent cells. The successful clones containing the correct insert fragments are selected and the plasmid is extracted. Finally, the optimal reaction conditions are adjusted through multiple optimization tests of PCR primers and probes. This method not only significantly improves the simultaneous detection efficiency of the above four pathogens, but also greatly reduces the risk of missed diagnosis, providing a fast and reliable tool for clinical diagnosis.

[0096] The steps in the method of the embodiment of the present application can be adjusted in sequence, combined, and deleted according to actual needs.

[0097] The above merely illustrates the specific embodiments of the present application, but the protection scope of the present application is not limited thereto, and any skilled person in the art can easily think of various equivalent modifications or replacements within the technical range disclosed by the present application, and these modifications or replacements shall be covered within the protection scope of the present application. Therefore, the protection scope of the present application shall be subject to the protection scope of the claims.

Claims

1. A quadruple real-time PCR detection method for simultaneous detection of multiple pathogens in bovine erythrocytes, characterized in that, include: Obtain the core functional gene sequences of four pathogens; The gene sequence was aligned using ClustalW, and conserved fragments with consistent identity and length were screened using MEGA software to obtain conserved sequences. The conserved sequences were compared with the homology of the bovine genome and microorganisms to obtain specific conserved sequences; Based on the specific conserved sequence, four pairs of PCR primers with the same annealing temperature were designed, and probes were designed accordingly. Gene sequence fragments were selected, treated with restriction endonucleases, and then ligated with a T vector using DNA ligase to obtain ligation products. The ligation product was transformed into competent cells for culture, and successful clones containing the insert fragment were identified and plasmids were extracted. The PCR primers and probes were tested multiple times, and the annealing temperature and the concentration of components in the reaction system were adjusted.

2. The quadruple real-time PCR detection method for simultaneous detection of multiple pathogens in bovine erythrocytes according to claim 1, characterized in that, The acquisition of the core functional gene sequences of the four pathogens includes: Gene sequences of multiple strains of Babesia, Theileria, Eperythrozoa, and Aplastica were obtained from GenBank in the NCBI database to obtain the core functional gene sequences of the four pathogens.

3. The quadruple real-time PCR detection method for simultaneous detection of multiple pathogens in bovine erythrocytes according to claim 1, characterized in that, The gene sequence was aligned using ClustalW, and conserved fragments meeting the consistency and length requirements were screened using MEGA software to obtain conserved sequences, including: The gene sequence was aligned using ClustalW, and conserved fragments with a length of 15-20 bp and a similarity of at least 90% were selected using MEGA software to obtain conserved sequences.

4. The quadruple real-time PCR detection method for simultaneous detection of multiple pathogens in bovine erythrocytes according to claim 1, characterized in that, The comparison of the conserved sequence with the bovine genome and microbial genomes to obtain specific conserved sequences includes: The conserved sequences were compared with the bovine genome and microbial genomes using the BLAST tool to ensure that the homology between non-target species was no more than 70%, so as to obtain specific conserved sequences.

5. The quadruple real-time PCR detection method for simultaneous detection of multiple pathogens in bovine erythrocytes according to claim 1, characterized in that, Based on the specific conserved sequence, four pairs of PCR primers with the same annealing temperature were designed, and probes were designed, including: Four pairs of PCR primers with the same annealing temperature were designed using PrimerPlex, and probes with a Tm value 5-10°C higher were designed using Primer Express™ to ensure preferential binding to the template.

6. The quadruple real-time PCR detection method for simultaneous detection of multiple pathogens in bovine erythrocytes according to claim 1, characterized in that, A gene sequence fragment is selected, treated with restriction endonucleases, and then ligated to a T vector using DNA ligase to obtain the ligation product, which includes: Gene sequence fragments were selected using Primer5, treated with restriction endonucleases, and then ligated to a T vector using DNA ligase to obtain the ligation product.

7. The quadruple real-time PCR detection method for simultaneous detection of multiple pathogens in bovine erythrocytes according to claim 1, characterized in that, The process of transforming the ligation product into competent cells for culture, identifying successful clones containing the insert fragment, and extracting plasmids includes: The ligation product was transformed into competent cells and cultured. Successful clones containing the insert fragment were identified by blue-white screening, and plasmids were extracted.

8. The quadruple real-time PCR detection method for simultaneous detection of multiple pathogens in bovine erythrocytes according to claim 7, characterized in that, The process of transforming the ligation product into competent cells for culture, identifying successful clones containing the insert fragment using a blue-white screening method, and extracting plasmids includes: The ligation product was transformed into competent cells, and the target gene and T vector were cut with a specific restriction endonuclease to form complementary sticky ends. Recombinant plasmids are constructed by ligating a target gene fragment with complementary sticky ends to a T vector using DNA ligase. The ligation product was mixed with competent cells and then subjected to heat shock treatment, which allowed the recombinant plasmid to enter the cells and replicate therein. Transformed cells were revived in antibiotic-free LB liquid medium and plated on antibiotic-containing LB plates for culture. Blue-white screening was performed using LB agar plates containing IPTG / X-gal; white colonies indicated positive clones that had successfully inserted the target gene. Plasmid DNA was extracted from the selected positive clones.

9. The quadruple real-time PCR detection method for simultaneous detection of multiple pathogens in bovine erythrocytes according to claim 8, characterized in that, The step of mixing the ligation product with competent cells and then subjecting them to heat shock to allow the recombinant plasmid to enter and replicate within the cells includes: Add 5 μL of the ligation product to 50 μL of competent cells and incubate on ice for 30 minutes to allow DNA to enter the cells. Heat shock at 42°C for 45 seconds and immediately place on ice to cool for 2 minutes to help the cells absorb the exogenous DNA.

10. The quadruple real-time PCR detection method for simultaneous detection of multiple pathogens in bovine erythrocytes according to claim 8, characterized in that, The process of resuscitating transformed cells in antibiotic-free LB liquid medium and then plating them onto antibiotic-containing LB plates for culture includes: Add 500 μL of antibiotic-free LB liquid medium and incubate on a shaker at 37°C for 45 to 60 minutes to revive the culture. Centrifuge to remove the supernatant, leaving the culture medium to resuspend the bacterial cells. Spread the resuspended bacterial cells on LB agar plates containing antibiotics and incubate upside down at 37°C for 12 to 16 hours to allow the bacteria to grow and express resistance genes.