A molecular marker related to beef cattle growth traits and its application

Abstract

The present invention belongs to the technical field of molecular marker-assisted selection for beef cattle, and particularly relates to a molecular marker related to beef cattle growth traits and its application. The molecular marker is located in the third intron of the ACOX1 gene in the reference genome (GCF_002263795.1_ARS-UCD1.2_genomic.fna), and the SNP molecular marker sites are g.55675384C>T, g.55676112A>G, g.55680392G>A, g.55681592A>G, and g.55683268C>G. There is a C>T base mutation at the 81st bp in the sequence shown in SEQ ID NO.1 for the molecular marker site g.55675384, an A>G base mutation at the 66th bp in the sequence shown in SEQ ID NO.2 for g.55676112, a G>A base mutation at the 90th bp in the sequence shown in SEQ ID NO.3 for g.55680392, an A>G base mutation at the 85th bp in the sequence shown in SEQ ID NO.4 for g.55681592, and a C>G base mutation at the 101st bp in the sequence shown in SEQ ID NO.5 for g.55683268. The 5 SNP site mutations of the present invention can significantly affect the growth and backfat thickness traits of beef cattle, providing a new molecular marker for beef cattle growth trait detection or molecular marker-assisted breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular marker-assisted selection for beef cattle, and specifically relates to a molecular marker related to beef cattle growth traits and its application. Background Art

[0002] With the continuous growth of China's economy and the continuous improvement of people's living standards, people's dietary concepts have also changed accordingly. Beef is popular among the public due to its high protein, low fat, and rich nutritional components, which has promoted the annual increase in China's beef consumption. As a major livestock production country, the output value of China's beef cattle industry is close to 200 billion yuan. The number of beef cattle in stock accounts for 10% of the total global stock, and the number of slaughtered heads ranks first in the world. The beef consumption and production volume rank second and third in the world respectively. Although China is a large beef cattle breeding country, there is still a large gap between beef supply and demand. According to data from the Organization for Economic Co-operation and Development (OECD), in 2023, China's beef production was 7.53 million tons, consumption was 10.3976 million tons, and the beef supply-demand gap reached 2.8676 million tons. Growth and backfat thickness traits are important economic traits in beef cattle production. Exploring and screening molecular markers related to growth traits helps to increase beef production.

[0003] Molecular marker-assisted breeding utilizes the characteristic that molecular markers are closely linked to target trait genes. By detecting molecular markers, the presence of the target gene can be detected, achieving the purpose of selecting target traits, and it has the advantages of being fast, accurate, and not being interfered by environmental conditions. Single nucleotide polymorphism (SNP) belongs to a type of molecular marker, referring to the change in the DNA sequence caused by the variation of a single nucleotide at the same position in the genome among individuals, which can subsequently affect gene expression levels, transcriptional activity, splicing modification, etc. The growth cycle of beef cattle is long. Screening genetic markers such as genes and SNPs related to growth traits and combining marker-assisted breeding methods for early selection of beef cattle can accelerate the beef cattle breeding process.

[0004] Body weight, body height, height at the withers, body slant length, chest girth are several key indicators for measuring the growth status of beef cattle, which are positively correlated with production performance. And birth, weaning, 6 months old, and 12 months old are several key nodes in the growth process of beef cattle. Backfat thickness is also an important production trait, but it is negatively correlated with meat production rate. In production, the production performance and economic benefits of beef cattle can be improved by controlling and optimizing the backfat thickness of beef cattle. Therefore, studying the key indicators of the above growth traits and backfat thickness provides a scientific basis for determining the breeding goals of beef cattle and screening excellent individuals. Summary of the Invention

[0005] The object of the present invention is to provide a molecular marker related to beef cattle growth traits and its application. The method provided by the present invention can not only perform early selection on beef cattle, accelerate the beef cattle breeding process, and thus improve the production performance and economic benefits of beef cattle.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides an SNP molecular marker related to beef cattle growth traits. The SNP molecular marker is one or more of the T>G base mutation at the g.55675384 locus, the A>G base mutation at the g.55676112 locus, the G>A base mutation at the g.55680392 locus, the A>G base mutation at the g.55681592 locus, and the C>G base mutation at the g.55683268 locus in the ARS-UCD1.2 version of the beef cattle reference genome.

[0008] The present invention also provides an application of a molecular marker in the beef cattle ACOX1 gene in detecting beef cattle growth traits. The molecular marker is one or more of g.55675384C>T, g.55676112A>G, g.55680392G>A, g.55681592A>G, and g.55683268C>G;

[0009] The beef cattle growth traits are the weight, body height, rump height, body slant length, chest girth, and backfat traits of beef cattle; the detection stages of the weight, body height, rump height, body slant length, and chest girth are at birth, weaning, 6 months old, and 12 months old of beef cattle; the backfat thickness trait is the backfat thickness at 18 months old;

[0010] The CT genotype and TT genotype beef cattle of g.55675384C>T have significantly higher weaning weight, body slant length, and chest girth than the CC genotype, and significantly lower backfat thickness at 18 months old than the CC genotype;

[0011] The AA genotype and AG genotype beef cattle of g.55676112A>G have significantly higher weaning weight, rump height, body slant length, and chest girth, 6-month-old weight and body slant length, and 12-month-old body slant length than the GG genotype, and significantly lower backfat thickness at 18 months old than the GG genotype;

[0012] The GA genotype and AA genotype beef cattle of g.55680392G>A have significantly higher weaning weight, body height, rump height, body slant length, and chest girth, and 6-month-old body slant length than the GG genotype, and significantly lower backfat thickness at 18 months old than the GG genotype;

[0013] The weaning cross height, body length obliquely, and chest girth of beef cattle with the AG genotype and GG genotype of g.55681592A>G are significantly higher than those of the AA genotype at 6 months of age, and the backfat thickness at 18 months of age is significantly lower than that of the AA genotype;

[0014] The weaning weight, body length obliquely, and chest girth of beef cattle with the CG genotype and GG genotype of g.55683268C>G are significantly higher than those of the CC genotype at 6 months of age, and the backfat thickness at 18 months of age is significantly lower than that of the CC genotype.

[0015] The present invention also provides an application of a molecular marker in the ACOX1 gene of beef cattle in detecting the growth traits of beef cattle, characterized in that the molecular marker is a C>T base mutation at the 81st bp in the sequence shown in SEQ ID NO.1, an A>G base mutation at the 66th bp in the sequence shown in SEQ ID NO.2, a G>A base mutation at the 90th bp in the sequence shown in SEQ ID NO.3, an A>G base mutation at the 85th bp in the sequence shown in SEQ ID NO.4, or a C>G base mutation at the 101st bp in the sequence shown in SEQ ID NO.5.

[0016] The present invention also provides a method for detecting the growth traits of beef cattle, detecting the weight, body height, cross height, body length obliquely, chest girth, and backfat traits of beef cattle; the detection stages of the weight, body height, cross height, body length obliquely, and chest girth are at birth, weaning, 6 months of age, and 12 months of age of beef cattle; the backfat thickness trait is the backfat thickness at 18 months of age;

[0017] Detect one or more of the sites g.55675384, g.55676112, g.55680392, g.55681592, and g.55683268 in the ARS-UCD1.2 genome version of beef cattle;

[0018] Or one or more of the base types at the 81st bp in the sequence shown in SEQ ID NO.1, the base type at the 66th bp in the sequence shown in SEQ ID NO:2, the base type at the 90th bp in the sequence shown in SEQ ID NO:3, the base type at the 85th bp in the sequence shown in SEQ ID NO:4, and the base type at the 101st bp in the sequence shown in SEQ ID NO:5.

[0019] Preferably, for the base type at the g.55675384 site or the 81st bp in the sequence shown in SEQ ID NO.1, the weaning weight, body length obliquely, and chest girth of beef cattle with the CT genotype and TT genotype are significantly higher than those of the CC genotype, and the backfat thickness at 18 months of age is significantly lower than that of the CC genotype;

[0020] The base type at the g.55676112 locus or at the 66th bp in the sequence shown in SEQ ID NO:2. The weaning weight, hip height, body length and chest girth of beef cattle with AA and AG genotypes are significantly higher than those of GG genotype at birth, weaning, 6 months old and 12 months old. The body length at 6 months old is also significantly higher. The backfat thickness at 18 months old is significantly lower than that of GG genotype.

[0021] The base type at the g.55680392 locus or at the 90th bp in the sequence shown in SEQ ID NO:3. The weaning weight, body height, hip height, body length and chest girth of beef cattle with GA and AA genotypes are significantly higher than those of GG genotype at birth, weaning, 6 months old and 12 months old. The body length at 6 months old is also significantly higher. The backfat thickness at 18 months old is significantly lower than that of GG genotype. The base type at the g.55681592 locus or at the 85th bp in the sequence shown in SEQ ID NO:4. The hip height, body length and chest girth of beef cattle with AG and GG genotypes at weaning are significantly higher than those of AA genotype at birth, weaning, 6 months old and 12 months old. The body length at 6 months old is also significantly higher. The backfat thickness at 18 months old is significantly lower than that of AA genotype.

[0022] The base type at the g.55683268 locus or at the 101st bp in the sequence shown in SEQ ID NO:5. The weaning weight, body length and chest girth of beef cattle with CG and GG genotypes are significantly higher than those of CC genotype at birth, weaning, 6 months old and 12 months old. The body weight and body length at 6 months old are also significantly higher. The backfat thickness at 18 months old is significantly lower than that of CC genotype.

[0023] The present invention also provides a substance for detecting the single nucleotide polymorphism of SNP loci in beef cattle, including PCR primers for amplifying genomic DNA fragments containing the SNP loci or a kit containing the primers; the SNP loci are the C>T base mutation at the 81st bp in the sequence shown in SEQ ID NO.1, the A>G base mutation at the 66th bp in the sequence shown in SEQ ID NO.2, the G>A base mutation at the 90th bp in the sequence shown in SEQ ID NO.3, the A>G base mutation at the 85th bp in the sequence shown in SEQ ID NO.4 or the C>G base mutation at the 101st bp in the sequence shown in SEQ ID NO.5.

[0024] The present invention also provides the application of the above SNP molecular markers related to beef cattle growth traits or the above substances for detecting the single nucleotide polymorphism of SNP loci in beef cattle in beef cattle genetic breeding. The genetic breeding aims to improve the growth traits of offspring beef cattle, including the weight, body height, hip height, body length, chest girth and backfat traits of beef cattle; the detection stages of the weight, body height, hip height, body length and chest girth are at birth, weaning, 6 months old and 12 months old of beef cattle; the backfat thickness trait is the backfat thickness at 18 months old.

[0025] The present invention also provides a genetic breeding method for improving the growth traits of beef cattle, making corresponding selections according to the single nucleotide polymorphisms of SNP loci in beef cattle: for the successive selection and breeding of breeding cattle, individuals with CT and TT genotypes at the 81st bp in the sequence shown in SEQ ID NO.1 are selected, and CC genotype individuals are eliminated;

[0026] For the successive selection and breeding of breeding cattle, individuals with AA and AG genotypes at the 66th bp in the sequence shown in SEQ ID NO.2 are selected, and GG individuals are eliminated;

[0027] For the successive selection and breeding of breeding cattle, individuals with GA and AA genotypes at the 90th bp in the sequence shown in SEQ ID NO.3 are selected, and GG genotype individuals are eliminated;

[0028] For the successive selection and breeding of breeding cattle, individuals with AG and GG genotypes at the 85th bp in the sequence shown in SEQ ID NO.4 are selected, and AA genotype individuals are eliminated;

[0029] For the successive selection and breeding of breeding cattle, individuals with CG and GG genotypes at the 101st bp in the sequence shown in SEQ ID NO.5 are selected, and CC genotype individuals are eliminated.

[0030] Preferably, the beef cattle growth traits are the weight, body height, cross height, body slant length, chest girth and backfat traits of beef cattle; the detection stages of the weight, body height, cross height, body slant length and chest girth are at birth, weaning, 6 months old and 12 months old of beef cattle; the backfat thickness trait is the backfat thickness at 18 months old.

[0031] Preferably, the beef cattle breed in the present invention is Charolais cattle.

[0032] Advantages of the present invention:

[0033] (1) The present invention discovers molecular markers associated with beef cattle growth traits in the third intron of the beef cattle ACOX1 gene. The molecular markers contain SNP loci of g.55675384C>T, g.55676112A>G, g.55680392G>A, g.55681592A>G or g.55683268C>G; the haplotypes composed of the above SNP loci can be used as molecular markers for beef cattle growth traits.

[0034] (2) The present invention verifies the influence effect of SNP molecular markers on the weight, body height, cross height, body slant length, chest girth of beef cattle at birth, weaning, 6 months old and 12 months old, and the backfat thickness trait is the backfat thickness at 18 months old, and can apply it to improve the growth performance of offspring, thereby increasing the market competitiveness of breeding enterprises.

[0035] (3) The present invention provides a new molecular marker for molecular marker-assisted breeding of beef cattle growth traits, realizing early selection of beef cattle growth traits and shortening the breeding process; the detection method is rapid, accurate, and not affected by breeding environmental conditions factors. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0037] Figure 1 It is a schematic flowchart of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0038] The present invention provides a molecular marker related to beef cattle growth traits, and the molecular marker is one or more of the C>T base mutation at position 55675384, the A>G base mutation at position 55676112, the G>A base mutation at position 55680392, the A>G base mutation at position 55681592, and the C>G base mutation at position 55683268 of the ARS-UCD1.2 version of the beef cattle genome.

[0039] The above 5 SNP molecular markers of the present invention are located in the third intron of the ACOX1 gene, and the nucleotide sequences of the molecular markers are as shown in SEQ ID NO.1-5:

[0040] g.55675384C>T nucleotide sequence:

[0041] TAAGTAAATGTCCTTTCTCATAATGCCTATGGGCACTGCAGATCCTG GTCATGGGACAGTTTTATGAACACCCCACCAGGNACCCCAGGATGGTC AGACCTGAGGGAAGGTGTCCTAAGGGAAGAAAGATC(SEQ IDNO.1)

[0042] g.55676112A>G nucleotide sequence:

[0043] AGCGGGACTGGAAATAGAGCAACTTGTACAGGATGACGATTTGAC TACTTAAATTCTGAGACTTTNGAACATTGGTCAACAGTGATTATCTCAC GTTCTTACAGAATTAGC(SEQ ID NO.2)

[0044] g.55680392G>A nucleotide sequence:

[0045] TGAAATGACCAAAATTAGGTGAGGAATGTGGATTAACACTGGATGTTTTATAGACAAATAGAAAAGTTTTCCAACCCAGAAACATTAGTNTTAGATCCTGGAAAAATTTTTTCCAAGAGAACTTTTGTGTTTTTCCGTCTCAACTTTTCA (SEQ ID NO.3)

[0046] g.55681592A>G nucleotide sequence:

[0047] ACTAAATTCAGTAGACTTCTAAAGGTGGCTTTGGCCAAAGTTTAGTAAAAATAAGATAAGTTGTACTTCCAGGTAATTGATTTCNCATTCTGTATGTACCACTTTTCTTTTTTTCTTTGCATCCCCGACCTGCCTTTCTCTGTGAACTGGATGGGGCTCAAGCTG (SEQ ID NO.4)

[0048] g.55683268C>G nucleotide sequence:

[0049] GAAATTAGCACACTAACAACTTAGAGATGATTTTAAAAGGGCAGTTAACTTCCATGTTAAAGTCATAGCCTGTGATCTCAGGCAACTGATTCTTATCTGTNTTTACATTTTCTTTTGGTTGATGTAAATAAATGTTCCCTATCTACTGCTGTGCAGTAAAT (SEQ ID NO.5)

[0050] The process schematic diagram of the present invention is as Figure 1 shown. By extracting the genomic DNA of Charolais cattle herd, through whole-genome resequencing and SNPs quality control and filtering, 4,088,633 high-quality SNPs are obtained. Using the obtained SNPs to calculate, the gene frequencies and allele frequencies of 5 SNP sites in the third intron of the ACOX1 gene after genotyping in the Charolais cattle population are obtained, and it is judged that the above 5 SNP sites are in Hardy-Weinberg equilibrium state.

[0051] Through the correlation analysis between the molecular markers of the present invention and growth traits, the statistical results of the g.55675384C>T locus are as follows: the weaning weight, body length obliquely, and chest girth of beef cattle with CT genotype and TT genotype are significantly higher than those with CC genotype, while the backfat thickness at 18 months of age is significantly lower than that of CC genotype (P<0.05);

[0052] For the g.55676112A>G locus, the weaning weight, hip height, body length obliquely, and chest girth of beef cattle with AA genotype and AG genotype, the body weight and body length obliquely at 6 months of age, and the body length obliquely at 12 months of age are significantly higher than those with GG genotype, while the backfat thickness at 18 months of age is significantly lower than that of GG genotype (P<0.05);

[0053] For the g.55680392G>A locus, the weaning weight, body height, hip height, body length obliquely, and chest girth of beef cattle with GA genotype and AA genotype, and the body length obliquely at 6 months of age are significantly higher than those with GG genotype, while the backfat thickness at 18 months of age is significantly lower than that of GG genotype (P<0.05);

[0054] For the g.55681592A>G locus, the hip height, body length obliquely, and chest girth at weaning of beef cattle with AG genotype and GG genotype, and the body length obliquely at 6 months of age are significantly higher than those with AA genotype, while the backfat thickness at 18 months of age is significantly lower than that of AA genotype (P<0.05);

[0055] For the g.55683268C>G locus, the weaning weight, body length obliquely, and chest girth of beef cattle with CG genotype and GG genotype, the body weight and body length obliquely at 6 months of age are significantly higher than those with AA genotype, while the backfat thickness at 18 months of age is significantly lower than that of CC genotype (P<0.05).

[0056] It can be seen therefrom that the g.55675384C>T, g.55676112A>G, g.55680392G>A, g.55681592A>G, and g.55683268C>G loci in the third intron of the above ACOX1 gene can be used as new molecular markers for the genetic improvement of beef cattle growth traits.

[0057] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below in conjunction with the drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0058] The production processes, experimental methods, or detection methods involved in the embodiments of the present invention are all conventional methods in the prior art without special instructions, and their names and / or abbreviations are all conventional names in the field, which are very clear and definite in the relevant application fields. Those skilled in the art can understand the conventional process steps according to the name and apply the corresponding equipment, and implement them under conventional conditions or conditions recommended by the manufacturer.

[0059] In the embodiments of the present invention, there are no special restrictions on the sources of various instruments, equipment, raw materials or reagents used. They are all conventional products that can be obtained through regular commercial channels, or can be prepared according to conventional methods well-known to those skilled in the art.

[0060] Example 1 Whole-genome resequencing of beef cattle

[0061] (1) Collection of Charolais cattle blood samples and extraction of white blood cells

[0062] Taking 240 Charolais cattle born from 2013 to 2023 as the research objects, 5 mL of blood samples were collected from the jugular vein using a veterinary blood collection needle and placed in an EDTA anticoagulant tube, stored in a 4°C refrigerator, and white blood cells were extracted. At the same time, data on body weight, body height, rump height, body slant length, and chest girth of the Charolais cattle population at birth, weaning, 6 months old, and 12 months old, as well as backfat thickness data at 18 months old, were collected for later use.

[0063] The specific steps for extracting white blood cells are as follows:

[0064] ① Take 2 - 3 mL of blood sample into a 10 mL EP tube;

[0065] ② Add ultrapure water to the EP tube to make the total volume of the liquid 9 mL;

[0066] ③ Slowly invert the EP tube up and down 20 times and let it stand for 10 min;

[0067] ④ Place the EP tube in a centrifuge and centrifuge at 5000 rpm for 10 min;

[0068] ⑤ Slowly pour out the supernatant in the EP tube;

[0069] ⑥ Add ultrapure water again to make the total volume of the liquid 9 mL;

[0070] ⑦ Repeat steps ③, ④, and ⑤;

[0071] ⑧ Number the extracted white blood cells and place them in an -80°C refrigerator.

[0072] (2) Genomic DNA extraction

[0073] After extracting white blood cells from the Charolais cattle blood samples, use the Beijing Tianmo DNA extraction kit to extract the genomic DNA of the samples according to the manufacturer's instructions. After passing the quality inspection, store it in an -80°C refrigerator.

[0074] (3) Whole-genome resequencing and SNPs detection and filtering

[0075] The qualified DNA was sent to the BGI Genomics platform for whole-genome resequencing with a sequencing depth of 10 to obtain the original off-machine data. The Fastp software was used to filter the original data, and the filtering criteria were as follows: reads sequences with adapters; reads with a certain proportion of N (N represents undetermined base information) bases (default 5bp); reads with more than 40% of low-quality bases (quality value ≤ 20); sliding window quality trimming: with a 4bp sliding window size, trimming was performed for those with an average quality lower than 20. Clean reads were obtained after quality control by the above steps. The BWA software was used to align the clean reads to the beef cattle reference genome (GCF_002263795.1_ARS-UCD1.2_genomic.fna). The BAM file of the initial alignment result was obtained, sorted using the Samtools software, and duplicate reads were marked using Picard. Then, the GATK4.2.0.0 software toolkit was used to detect SNP sites, and the Plink software was used to filter the SNP sites (geno 0.1--maf0.05--hwe 1e-06). Finally, the Beagle version 5.4 software was used for genotype imputation, and ultimately 4,088,633 high-quality SNPs were obtained for subsequent analysis.

[0076] Example 2 Detection of Polymorphism Distribution of Molecular Markers in Beef Cattle Populations

[0077] (1) Genotype Frequency and Allele Frequency Analysis

[0078] The genotype frequencies and allele frequencies of 5 SNP sites in the third intron of the ACOX1 gene after genotyping in the Charolais cattle population were calculated. The specific formulas and methods were as follows:

[0079] Genotype frequency = number of individuals with the genotype / total number of samples in the measured population;

[0080] Allele frequency = frequency of homozygous genotype of the allele + frequency of heterozygous genotype of the gene / 2.

[0081] (2) Hardy-Weinberg Equilibrium Test

[0082] Hardy-Weinberg equilibrium is a situation where in an ideal population (not affected by specific disturbing factors such as non-random mating, selection, migration, mutation, or limited population size), after multiple generations, the gene frequencies and genotype frequencies will remain constant and be in a stable equilibrium state.

[0083] p 2 represents the frequency of homozygotes of an allele (such as Y), q 2represents the frequency of homozygotes for another allele (such as y), and 2pq represents the frequency of heterozygotes (such as Yy). If a population reaches genetic equilibrium, its genotype frequencies should conform to (p + q) 2 = p 2 + 2pq + q 2 = 1. According to the theoretical values, actual values can be calculated for chi-square tests to determine whether each gene is in Hardy-Weinberg equilibrium in the population. The detection formula is as follows:

[0084] χ 2 = ∑(Oi - Ei) 2 / Ei

[0085] where O represents the observed value of the gene frequency, E represents the expected value of the gene frequency, and χ 2 is the obtained chi-square test value. Compare the calculated chi-square value with the corresponding chi-square table. If the P-value range is greater than 0.05, it indicates that this locus conforms to Hardy-Weinberg equilibrium; if it is less than 0.05, this locus deviates from Hardy-Weinberg equilibrium.

[0086] The detection results are shown in Table 1: All 5 SNP loci showed three genotypes in the beef cattle population. g.55675384C>T was dominated by the heterozygous type CT, and allele T was the dominant allele; g.55676112A>G was dominated by the heterozygous type AG, and allele A was the dominant allele; g.55680392G>A was dominated by the heterozygous type GA, and allele A was the dominant allele; g.55681592A>G was dominated by the heterozygous type AG, and allele G was the dominant allele; g.55683268C>G was dominated by the heterozygous type CG, and allele G was the dominant allele; and through chi-square tests, it was found that these 5 SNP loci all conformed to Hardy-Weinberg equilibrium (P > 0.05)

[0087] Table 1 Genotype frequencies and allele frequencies of SNP loci in the ACOX1 gene in the beef cattle population

[0088]

[0089]

[0090] Note: The numbers in parentheses are the number of cattle

[0091] Example 3 Association analysis and application of molecular markers with growth and backfat thickness traits

[0092] (1) Association analysis of genotypes with growth and backfat thickness traits

[0093] The association analysis between genotypes and growth and backfat thickness traits was calculated using a self-written SAS program language with a fixed linear model. Through multiple regression and variance analysis of the traits, the fixed effects for subsequent analysis were determined. Several models with all possible combinations of fixed effects were tested, and the significance of each effect was systematically evaluated. Each non-significant effect was removed from the model in a stepwise manner. The final model is as follows:

[0094] Y ikjlm = μ + I i + A k + B j + C l + D m + E ikjlm

[0095] Y is the trait value, I is the fixed effect of genotype, A is the fixed effect of sire, B is the fixed effect of age, C is the fixed effect of sex, D is the random effect of animal, μ is the mean of a single trait, and E is the random error.

[0096] (2) Analysis of adding dominance effect values

[0097] Using SAS statistical software, the genetic effects of genotypes on growth traits were analyzed with a linear model, and the GLM procedure was used for the association analysis between markers and traits. The models used are as follows:

[0098] Model 1: Y = overall mean + genotype + farm environment effect + residual

[0099] Model 2: Y = overall mean + additive effect + dominance effect + farm environment effect + residual

[0100] Among them, Y is the phenotypic value of the trait, the additive effect = (homozygote 1 - homozygote 2) / 2, and 1, 0, -1 are used to represent homozygote 1, heterozygote, and homozygote 2 respectively; the dominance effect = heterozygote - (homozygote 1 + homozygote 2) / 2, and 1, -1, 1 are used to represent homozygote 1, heterozygote, and homozygote 2 respectively.

[0101] The statistical results of the g.55675384C>T locus are shown in Table 2: The weaning weight, body slant length, and chest girth of beef cattle with CT genotype and TT genotype are significantly higher than those with CC genotype, while the backfat thickness at 18 months of age is significantly lower than that of CC genotype (P < 0.05).

[0102] The statistical results of the g.55676112A>G locus are shown in Table 3: The weaning weight, rump height, body slant length, and chest girth of beef cattle with AA genotype and AG genotype, the body weight and body slant length at 6 months of age, and the body slant length at 12 months of age are significantly higher than those with GG genotype, while the backfat thickness at 18 months of age is significantly lower than that of GG genotype (P < 0.05).

[0103] The statistical results of the g.55680392G>A locus are shown in Table 4: The weaning weights, body heights, heights at the hip cross, body slant lengths, and chest circumferences of beef cattle with the GA genotype and the AA genotype were significantly higher than those of the GG genotype at 6 months of age, while the backfat thickness at 18 months of age was significantly lower than that of the GG genotype (P<0.05).

[0104] The statistical results of the g.55681592A>G locus are shown in Table 5: The heights at the hip cross, body slant lengths, and chest circumferences of beef cattle with the AG genotype and the GG genotype were significantly higher than those of the AA genotype at 6 months of age, while the backfat thickness at 18 months of age was significantly lower than that of the AA genotype (P<0.05).

[0105] The statistical results of the g.55683268C>G locus are shown in Table 6: The weaning weights, body slant lengths, and chest circumferences of beef cattle with the CG genotype and the GG genotype were significantly higher than those of the AA genotype at 6 months of age, while the backfat thickness at 18 months of age was significantly lower than that of the CC genotype (P<0.05).

[0106] Table 2 Association analysis of the g.55675384C>T locus with growth and backfat thickness traits in beef cattle

[0107]

[0108]

[0109]

[0110] Note: The numbers in parentheses are the number of cattle; the values in the table are expressed as mean ± standard error; for data in the same row with superscripts, different lowercase letters indicate significant differences (P<0.05), and the same letters or no letter annotation indicate no significant differences (P>0.05).

[0111] Table 3 Association analysis of the g.55676112A>G locus with growth and backfat thickness traits in beef cattle

[0112]

[0113]

[0114] Note: The numbers in parentheses are the number of cattle; the values in the table are expressed as mean ± standard error; for data in the same row with superscripts, different lowercase letters indicate significant differences (P<0.05), and the same letters or no letter annotation indicate no significant differences (P>0.05)

[0115] Table 4 Association analysis of the g.55680392G>A locus with growth and backfat thickness traits in beef cattle

[0116]

[0117]

[0118] Note: The numbers in () are the number of cattle; the values in the table are expressed as mean ± standard error; for the data in the same row with superscripts, different lowercase letters indicate significant differences (P < 0.05), and the same letters or no letter annotation indicate no significant differences (P > 0.05).

[0119] Table 5 Association analysis of g.55681592A>G locus with beef cattle growth and backfat thickness traits

[0120]

[0121]

[0122]

[0123] Note: The numbers in () are the number of cattle; the values in the table are expressed as mean ± standard error; for the data in the same row with superscripts, different lowercase letters indicate significant differences (P < 0.05), and the same letters or no letter annotation indicate no significant differences (P > 0.05).

[0124] Table 6 Association analysis of g.55683268C>G locus with beef cattle growth and backfat thickness traits

[0125]

[0126]

[0127]

[0128] Note: The numbers in () are the number of cattle; the values in the table are expressed as mean ± standard error; for the data in the same row with superscripts, different lowercase letters indicate significant differences (P < 0.05), and the same letters or no letter annotation indicate no significant differences (P > 0.05).

[0129] In summary, the g.55675384C>T, g.55676112A>G, g.55680392G>A, g.55681592A>G, and g.55683268C>G loci in the third intron of the above ACOX1 gene can be used as new molecular markers for genetic improvement of beef cattle growth traits.

[0130] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Use of a reagent for detecting molecular markers in the beef cattle ACOX1 gene in detecting the growth traits of beef cattle, characterized in that, The molecular marker is one or more of the T>G base mutation at the g.55675384 locus, the A>G base mutation at the g.55676112 locus, the G>A base mutation at the g.55680392 locus, the A>G base mutation at the g.55681592 locus, and the C>G base mutation at the g.55683268 locus in the ARS-UCD1.2 version of the beef cattle reference genome; The beef cattle growth traits are the body weight, body height, height at the hip cross, body slant length, chest girth, and backfat thickness traits of beef cattle; the detection stages of the body weight, body height, height at the hip cross, body slant length, and chest girth are at birth, weaning, 6 months of age, and 12 months of age of beef cattle; the backfat thickness trait is the backfat thickness at 18 months of age; the beef cattle are Charolais cattle; For the CT genotype and TT genotype of beef cattle with the T>G base mutation at the g.55675384 locus, the weaning weight, body slant length, and chest girth are significantly higher than those of the CC genotype, and the backfat thickness at 18 months of age is significantly lower than that of the CC genotype; For the AA genotype and AG genotype of beef cattle with the A>G base mutation at the g.55676112 locus, the weaning weight, height at the hip cross, body slant length, and chest girth, the body weight and body slant length at 6 months of age, and the body slant length at 12 months of age are significantly higher than those of the GG genotype, and the backfat thickness at 18 months of age is significantly lower than that of the GG genotype; For the AG genotype and AA genotype of beef cattle with the G>A base mutation at the g.55680392 locus, the weaning weight, body height, height at the hip cross, body slant length, and chest girth, and the body slant length at 6 months of age are significantly higher than those of the GG genotype, and the backfat thickness at 18 months of age is significantly lower than that of the GG genotype; For the AG genotype and GG genotype of beef cattle with the A>G base mutation at the g.55681592 locus, the height at the hip cross, body slant length, and chest girth at weaning, and the body slant length at 6 months of age are significantly higher than those of the AA genotype, and the backfat thickness at 18 months of age is significantly lower than that of the AA genotype; For the CG genotype and GG genotype of beef cattle with the C>G base mutation at the g.55683268 locus, the weaning weight, body slant length, and chest girth, and the body weight and body slant length at 6 months of age are significantly higher than those of the CC genotype, and the backfat thickness at 18 months of age is significantly lower than that of the CC genotype.

2. Use of a reagent for detecting molecular markers in the beef cattle ACOX1 gene in detecting the growth traits of beef cattle, characterized in that, The molecular marker is the C>T base mutation at the 81st bp in the sequence shown in SEQ ID NO.1, the A>G base mutation at the 66th bp in the sequence shown in SEQ ID NO.2, the G>A base mutation at the 90th bp in the sequence shown in SEQ ID NO.3, the A>G base mutation at the 85th bp in the sequence shown in SEQ ID NO.4, or the C>G base mutation at the 101st bp in the sequence shown in SEQ ID NO.5; the beef cattle are Charolais cattle; the beef cattle growth traits are the body weight, body height, height at the hip cross, body slant length, chest girth, or backfat thickness traits of beef cattle; the detection stages of the body weight, body height, height at the hip cross, body slant length, or chest girth are at birth, weaning, 6 months of age, or 12 months of age of beef cattle; the backfat thickness trait is the backfat thickness at 18 months of age.

3. A method for detecting the growth traits of beef cattle, characterized in that, Detect the traits of body weight, body height, withers height, body slant length, chest girth, and backfat thickness of beef cattle; the detection stages of body weight, body height, withers height, body slant length, and chest girth are at birth, weaning, 6 months of age, and 12 months of age of beef cattle; the backfat thickness trait is the backfat thickness at 18 months of age; Detect one or more of the loci g.55675384, g.55676112, g.55680392, g.55681592, and g.55683268 in the beef cattle genome version ARS-UCD1.2; Or one or more of the base types at the 81st bp in the sequence shown in SEQ ID NO.1, the base type at the 66th bp in the sequence shown in SEQ ID NO.2, the base type at the 90th bp in the sequence shown in SEQ ID NO.3, the base type at the 85th bp in the sequence shown in SEQ ID NO.4, and the base type at the 101st bp in the sequence shown in SEQ ID NO.5; The beef cattle are Charolais cattle.

4. The method according to claim 3, wherein For the base type at the g.55675384 locus or the 81st bp in the sequence shown in SEQ ID NO.1, the weaning body weight, body slant length, and chest girth of CT genotype and TT genotype beef cattle are significantly higher than those of CC genotype, and the backfat thickness at 18 months of age is significantly lower than that of CC genotype; For the base type at the g.55676112 locus or the 66th bp in the sequence shown in SEQ ID NO.2, the weaning body weight, withers height, body slant length, and chest girth, body weight and body slant length at 6 months of age, and body slant length at 12 months of age of AA genotype and AG genotype beef cattle are significantly higher than those of GG genotype, and the backfat thickness at 18 months of age is significantly lower than that of GG genotype; For the base type at the g.55680392 locus or the 90th bp in the sequence shown in SEQ ID NO.3, the weaning body weight, body height, withers height, body slant length, and chest girth, and body slant length at 6 months of age of AG genotype and AA genotype beef cattle are significantly higher than those of GG genotype, and the backfat thickness at 18 months of age is significantly lower than that of GG genotype; For the base type at the g.55681592 locus or the 85th bp in the sequence shown in SEQ ID NO.4, the withers height, body slant length, and chest girth at weaning, and body slant length at 6 months of age of AG genotype and GG genotype beef cattle are significantly higher than those of AA genotype, and the backfat thickness at 18 months of age is significantly lower than that of AA genotype; For the base type at the g.55683268 locus or the 101st bp in the sequence shown in SEQ ID NO.5, the weaning body weight, body slant length, and chest girth, and body weight and body slant length at 6 months of age of CG genotype and GG genotype beef cattle are significantly higher than those of CC genotype, and the backfat thickness at 18 months of age is significantly lower than that of CC genotype.

5. Use of a reagent for detecting molecular markers in the ACOX1 gene of beef cattle in beef cattle genetic breeding, characterized in that, The genetic breeding is to improve the growth traits of offspring beef cattle, including the traits of body weight, body height, withers height, body slant length, chest girth, and backfat thickness of beef cattle; the detection stages of body weight, body height, withers height, body slant length, and chest girth are at birth, weaning, 6 months of age, and 12 months of age of beef cattle; the backfat thickness trait is the backfat thickness at 18 months of age; the beef cattle are Charolais cattle; For the successive selection and breeding of breeding cattle, individuals with CT and TT genotypes at the 81st bp in the sequence shown in SEQ ID NO.1 are selected, and individuals with CC genotype are eliminated; For the successive selection and breeding of breeding cattle, individuals with AA and AG genotypes at the 66th bp in the sequence shown in SEQ ID NO.2 are selected, and individuals with GG genotype are eliminated; For the successive selection and breeding of breeding cattle, individuals with AG and AA genotypes at the 90th bp in the sequence shown in SEQ ID NO.3 are selected, and individuals with GG genotype are eliminated; For the successive selection and breeding of breeding cattle, individuals with AG and GG genotypes at the 85th bp in the sequence shown in SEQ ID NO.4 are selected, and individuals with AA genotype are eliminated; For the successive selection and breeding of breeding cattle, individuals with CG and GG genotypes at the 101st bp in the sequence shown in SEQ ID NO.5 are selected, and individuals with CC genotype are eliminated.

6. A genetic breeding method for improving the growth traits of beef cattle, characterized in that, Based on the SNP single nucleotide polymorphism of beef cattle, corresponding selections are made: For the successive selection and breeding of breeding cattle, individuals with CT and TT genotypes at the 81st bp in the sequence shown in SEQ ID NO.1 are selected, and individuals with CC genotype are eliminated; For the successive selection and breeding of breeding cattle, individuals with AA and AG genotypes at the 66th bp in the sequence shown in SEQ ID NO.2 are selected, and individuals with GG genotype are eliminated; For the successive selection and breeding of breeding cattle, individuals with AG and AA genotypes at the 90th bp in the sequence shown in SEQ ID NO.3 are selected, and individuals with GG genotype are eliminated; For the successive selection and breeding of breeding cattle, individuals with AG and GG genotypes at the 85th bp in the sequence shown in SEQ ID NO.4 are selected, and individuals with AA genotype are eliminated; For the successive selection and breeding of breeding cattle, individuals with CG and GG genotypes at the 101st bp in the sequence shown in SEQ ID NO.5 are selected, and individuals with CC genotype are eliminated; The beef cattle are Charolais cattle; the growth traits of the beef cattle are the traits of body weight, body height, rump height, body slant length, chest girth and back fat thickness of the beef cattle; the detection stages of the body weight, body height, rump height, body slant length and chest girth are at birth, weaning, 6 months old and 12 months old of the beef cattle; the back fat thickness trait is the back fat thickness at 18 months old.

Images