Primer pair for identifying thousand-grain weight of wheat grains, identification method and application thereof
By providing primer pairs for wheat grains with a thousand grain weight and their identification methods, using KASP reaction and fluorescence quantitative PCR technology, the problem of rapid, accurate and high-throughput identification of wheat grains with a thousand grain weight in the prior art is solved, and the rapid screening of wheat varieties with a thousand grain weight is achieved, and the breeding years are shortened.
Patent Information
- Application Number
- CN202411347714.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-26
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2044-09-26
AI Technical Summary
The prior art is difficult to quickly, accurately and with high throughput to identify the weight of wheat grains of 1,000 grains, resulting in a longer period of breeding of high-yield wheat varieties.
Primer pairs for identifying wheat grains with 1,000 grain weight and their identification methods are provided. Through KASP reaction and fluorescence quantitative PCR technology, wheat varieties with 1,000 grain weight are rapidly screened.
It has achieved rapid and accurate identification of the weight of wheat grains of 1,000 grains, shortened the breeding years, and effectively screened out wheat varieties with high grains of 1,000 grains.
Smart Images

Figure CN119061185B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and particularly relates to a primer pair for identifying the thousand-grain weight of wheat grains, and an identification method and application thereof. Technical Background
[0002] Wheat is the world's largest cultivated grain crop and my country's third-largest. Increased wheat production in my country is primarily due to increased yields per unit area. Therefore, increasing yields per unit area through genetic improvement is one of the most effective measures to boost wheat production.
[0003] Wheat yield is affected by three factors: the number of ears per unit area, the number of grains per ear, and the thousand-grain weight. Among them, the thousand-grain weight of wheat grains is an important factor in determining wheat yield, one of the important indicators for evaluating the quality of varieties, and one of the main targets of high-yield wheat breeding.
[0004] Competitive allele-specific polymerase chain reaction (KASP) is a SNP-based gel-free fluorescent polymerase chain reaction genotyping technology. Its basic principle is to accurately determine the biallelicity of SNP sites based on the specific matching of primer terminal bases. KASP technology has the following characteristics: (1) It is based on conventional PCR and fluorescence detection, and has low equipment requirements. Ordinary molecular laboratories can fully meet the requirements of conducting experiments and have good compatibility. (2) KASP meets the requirements of low-, medium-, and high-throughput genotyping in experimental operation. Compared with other technologies, it has certain flexibility and is easier to achieve high-throughput and automated detection. (3) KASP uses universal probes that can be used in conjunction with various gene-specific primers, without the need to synthesize probes for each specific site, which greatly reduces the reagent cost of the experiment. Studies have shown that the commercial service cost of KASP technology is about 80% lower than that of TaqMan probe method. (4) KASP technology has high accuracy, with a detection rate of up to 99.5%, which is consistent with the accuracy of conventional qPCR detection. Therefore, this technology has been widely used in areas such as molecular marker-assisted crop breeding, germplasm resource identification, genetic map construction, and seed purity testing. Therefore, establishing a rapid, accurate, and high-throughput method for identifying or assisting with the identification of wheat thousand-grain weight could shorten the time required to breed high-yield wheat varieties. Summary of the Invention
[0005] In order to overcome the defects and shortcomings of the prior art, one of the objects of the present invention is to provide a primer pair for identifying the thousand-grain weight of wheat grains.
[0006] Another object of the present invention is to provide an identification method for identifying the thousand-grain weight of wheat grains.
[0007] Another object of the present invention is to provide a kit for identifying the thousand-grain weight of wheat grains and its application.
[0008] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions:
[0009] The present invention provides a primer pair for identifying the thousand-grain weight of wheat grains, comprising an upstream primer and a downstream primer:
[0010] The upstream primers include upstream primer 1 and upstream primer 2: upstream primer 1 is a nucleotide sequence as shown in SEQ ID No. 1, or a DNA molecule in which 1-3 nucleotides are substituted and / or deleted and / or added to the nucleotide sequence as shown in SEQ ID No. 1 and has the same function as the nucleotide sequence as shown in SEQ ID No. 1; upstream primer 2 is a nucleotide sequence as shown in SEQ ID No. 2, or a DNA molecule in which 1-3 nucleotides are substituted and / or deleted and / or added to the nucleotide sequence as shown in SEQ ID No. 2 and has the same function as the nucleotide sequence as shown in SEQ ID No. 2;
[0011] The downstream primer includes: a nucleotide sequence as shown in SEQ ID No. 3, or a DNA molecule having the same function as the nucleotide sequence shown in SEQ ID No. 3 after substitution and / or deletion and / or addition of 1-3 nucleotides.
[0012] Furthermore, the nucleotide sequence of the amplified product of the primer pair is shown as SEQ ID No. 4.
[0013] The present invention also provides a kit for screening wheat varieties with high thousand-grain weight, which comprises the primer pair.
[0014] Furthermore, the molar ratio of the upstream primer 1, the upstream primer 2 and the downstream primer is 2:2:5.
[0015] Furthermore, in the kit, the molar ratio of the upstream primer 1 having a nucleotide sequence as shown in SEQ ID No. 1 to the upstream primer 2 having a nucleotide sequence as shown in SEQ ID No. 2 is 1:1.
[0016] The present invention also provides a method for identifying the thousand-grain weight of wheat grains using the primer pair, comprising the following steps:
[0017] (1) extracting genomic DNA of wheat to be tested, using it as a template, performing KASP reaction using the primer pair, and reading the fluorescence signal of the reaction product using a fluorescent quantitative PCR instrument;
[0018] (2) If the fluorescence signal reading result of the wheat to be tested shows Fam allele, the wheat to be tested is of aa genotype; if the fluorescence signal reading result of the wheat to be tested shows Hex allele, the wheat to be tested is of AA genotype.
[0019] Furthermore, in step (1), the PCR program in the KASP reaction is: denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 64°C-56°C for 1 min, 10 cycles; denaturation at 94°C for 20 s, annealing at 58°C for 1 min, 32 cycles.
[0020] Furthermore, the PCR reaction system in step (1) is: 0.25 μL of a 10 μM mixed primer consisting of upstream primer 1: upstream primer 2: downstream primer = 2:2:5; 2×PAMRS Pro SNP Gentyping PCR Mix 2.5 μL; 1.25 μL of water; 1 μL of a 100 ng / μL DNA template, and a total volume of 5 μL.
[0021] Furthermore, the thousand-grain weight of the wheat to be tested with the aa genotype is significantly higher than that of the wheat to be tested with the AA genotype.
[0022] The present invention also provides the application of the primer pair, the kit, or the identification method in breeding wheat varieties with high thousand-grain weight.
[0023] Furthermore, wheat varieties with the aa genotype are bred as high thousand-grain weight wheat varieties.
[0024] Compared with the prior art, the advantages and beneficial technical effects of the present invention are as follows: using the primer pair provided by the present invention, KASP analysis was performed on 377 wheat varieties, and the fluorescence reading results showed that the genotype of 359 wheat varieties was AA, and the genotype of 18 wheat varieties was aa, and the thousand-grain weight of the wheat to be tested with the aa genotype was significantly higher than that of the wheat to be tested with the AA genotype, which proves that the primers provided by the present invention can be used to identify or assist in the identification of wheat varieties with different thousand-grain weights, and can quickly screen wheat varieties with high thousand-grain weights, greatly shortening the breeding period; and the identification method provided by the present invention has simple steps, is reliable, and is practical, has important application value in wheat breeding, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 These are the KASP fluorescence detection results of the wheat varieties Xingmai 33 (Fam allele, genotype aa) and Taimai No. 1 (Hex allele, genotype AA), whose PCR product sequencing has been completed.
[0026] Figure 2 These are the KASP fluorescence detection results of 377 wheat varieties, among which the Fam allele control is the wheat variety Xingmai 33 (genotype aa), and the Hex allele control is the wheat variety Taimai No. 1 (genotype AA).
[0027] Figure 3 The statistical results of thousand-grain weight of wheat grains with different genotypes are shown in Figure 2. DETAILED DESCRIPTION
[0028] The present invention will be further described in detail below in conjunction with specific embodiments. The examples given are only for illustrating the present invention, not for limiting the scope of the present invention.
[0029] The experimental methods in the following examples are conventional methods unless otherwise specified.
[0030] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.
[0031] The 377 wheat varieties used in this study represent a natural population composed of wheat varieties collected from different provinces or wheat-growing regions in my country, as well as imported varieties that have significantly influenced the genetic background of Chinese wheat. These varieties represent the current genetic diversity of my country's wheat germplasm resources. The origins of the 377 wheat varieties are shown in Table 1.
[0032] 2×PAMRS Pro SNP Gentyping PCR Mix was a product of Wuhan Jingpeptide Biotechnology Co., Ltd.
[0033] Example 1: Determination of Thousand-Grain Weight Traits of Different Wheat Varieties
[0034] 1. Obtaining wheat grains
[0035] During the 2023–2024 wheat growing season, seeds of 377 wheat varieties were planted at the Experimental Demonstration Base of Shandong Academy of Agricultural Sciences, Licheng District, Jinan City, Shandong Province (117°04'E, 36°42'N) to obtain grains of different wheat varieties.
[0036] 2. Measuring the thousand-grain weight of wheat grains of different wheat varieties
[0037] The national standard method "GB / T 5519-2008 Determination of 1000-grain weight of cereals and legumes" was used to measure the 1000-grain weight of different wheat varieties planted in the experimental demonstration base of Shandong Academy of Agricultural Sciences in Licheng District, Jinan City, Shandong Province from 2023 to 2024.
[0038] Each wheat variety was measured twice. The sample after the first measurement was mixed with the original sample to be tested, and then a second sample was taken for measurement. The two results were averaged to obtain the thousand-grain weight of different wheat varieties planted at the Experimental Demonstration Base of the Shandong Academy of Agricultural Sciences in Licheng District, Jinan City, Shandong Province, from 2023 to 2024.
[0039] The measurement results of 1000-grain weight of different wheat varieties in 2024 are shown in Table 1.
[0040] Table 1 Thousand-grain weight results of different wheat varieties and their corresponding genotypes
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051] Example 2: Correlation Analysis between KASP Fluorescence Detection Results and Wheat Thousand-Grain Weight
[0052] 1. Preparation of primer pairs
[0053] Primers were designed for detecting wheat thousand-grain weight, and the primer pairs were synthesized by Sangon Biotech (Shanghai) Co., Ltd.:
[0054] Upstream primer 1:
[0055] 5′-GAAGGTGACCAAGTTCATGCTACCCATCTTGTCTCTTCGATCAT-3′ (SEQ ID No. 1, wherein GAAGGTGACCAAGTTCATGCT is a universal tag sequence);
[0056] Upstream primer 2:
[0057] 5′-GAAGGTCGGAGTCAACGGATTACCCATCTTGTCTCTTCGATCAG-3′ (SEQ ID No. 2, wherein GAAGGTCGGAGTCAACGGATT is a universal tag sequence);
[0058] The 3' ends of the upstream primer 1 and the upstream primer 2 are alleles of the same SNP.
[0059] Downstream primer: 5'-CCACGGAGAAGAAGAGGACG-3' (SEQ ID No. 3, the reverse complementary sequence of positions 52-72 of SEQ ID No. 4).
[0060] The primer pairs were purified by HPLC.
[0061] When used, the molar ratio of upstream primer 1, upstream primer 2 and downstream primer is 2:2:5. The nucleotide sequence of the product amplified using the above primer pair is shown in SEQ ID No.4.
[0062] 2. Genotyping Methods
[0063] 1. Extraction of genomic DNA
[0064] Extracting genomic DNA from wheat leaves to be tested. In this embodiment, the wheat to be tested is the 377 wheat varieties listed in Table 1.
[0065] 2. Prepare PCR reaction system
[0066] The PCR reaction system (5 μL) is shown in Table 2.
[0067] Table 2 PCR reaction system
[0068]
[0069] 3. KASP and fluorescence detection and analysis
[0070] (1) Take the PCR reaction system of step 2 and place it on a 9600PCR Thermo Cycler instrument to perform PCR amplification reaction. The PCR program is as follows: denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 64°C-56°C (drop 0.8°C per cycle) for 1 min, 10 cycles; denaturation at 94°C for 20 s, annealing at 58°C for 1 min, 32 cycles.
[0071] (2) After completing step (1), use a fluorescence quantitative PCR instrument to read the fluorescence signal.
[0072] Some experimental results can be found in Figure 1(Fam allele is Xingmai 33, Hex allele is Taimai 1). The results showed that the fluorescence detection results of the two haplotype wheat varieties after KASP were divided into Fam allele and Hex allele.
[0073] Based on the fluorescence detection results of KASP, the following conclusions were drawn: KASP was performed using the genomic DNA of the wheat varieties Xingmai 33 and Taimai No. 1 with known target sequences as templates with the above-mentioned primer pairs and 2×PAMRS Pro SNP Gentyping PCR Mix. The fluorescence signal was read using a fluorescence quantitative PCR instrument, and then the following judgment was made: if the fluorescence detection result showed Famallele, the genotype of the wheat was aa; if the fluorescence detection result showed Hex allele, the genotype of the wheat was AA.
[0074] The genotypes of 377 wheat varieties were genotyped according to the above method, and the fluorescence detection results are shown in Figure 2 The two controls were wheat varieties whose PCR product sequencing had been completed: Xingmai 33 (Fam allele, genotype aa, marked with green dots) and Taimai No. 1 (Hex allele, genotype AA, marked with orange dots). The genotyping results are shown in Table 1 (Famallele indicates the wheat tested with the aa genotype, and Hex allele indicates the wheat tested with the AA genotype). The results showed that 359 wheat varieties had the AA genotype, and 18 wheat varieties had the aa genotype.
[0075] 3. Correlation analysis between genotype and wheat 1000-grain weight
[0076] The thousand-grain weight of wheat grains of genotype AA and genotype aa were statistically analyzed. The results are shown in Figure 3 The results showed that the thousand-grain weight of wheat varieties with the aa genotype was significantly higher than that of wheat varieties with the AA genotype (P<0.05).
[0077] Example 3: Application of the primers in breeding high 1000-grain weight wheat varieties
[0078] The application of the present invention in breeding high 1000-grain weight wheat varieties comprises the following steps:
[0079] 1. Extract the genomic DNA of the wheat to be tested, use it as a template, use the primer pair to perform KASP reaction, and read the fluorescence signal of the reaction product.
[0080] The primer pair includes an upstream primer and a downstream primer; the upstream primer includes upstream primer 1 and upstream primer 2: the upstream primer 1 is the nucleotide sequence shown in SEQ ID No.1, the upstream primer 2 is the nucleotide sequence shown in SEQ ID No.2, and the downstream primer is the nucleotide sequence shown in SEQ ID No.3.
[0081] The PCR reaction program in the KASP reaction was as follows: denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 64°C-56°C (drop 0.8°C per cycle) for 1 min, 10 cycles; denaturation at 94°C for 20 s, annealing at 58°C for 1 min, 32 cycles.
[0082] The PCR reaction system was as follows: 0.25 μL of a 10 μM primer mixture consisting of upstream primer 1:upstream primer 2:downstream primer = 2:2:5; 2×PAMRS Pro SNP Gentyping PCR Mix 2.5 μL; 1.25 μL of water; and 1 μL of a 100 ng / μL DNA template, for a total volume of 5 μL.
[0083] 2. If the fluorescent signal reading result of the wheat to be tested shows the Fam allele, the wheat to be tested has the aa genotype; if the fluorescent signal reading result of the wheat to be tested shows the Hex allele, the wheat to be tested has the AA genotype. The 1000-grain weight of the wheat to be tested with the aa genotype is significantly higher than that of the wheat to be tested with the AA genotype. The wheat variety with the aa genotype is selected as a wheat variety with high 1000-grain weight.
[0084] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein with equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.
Claims
1. A method for identifying the thousand-grain weight of wheat grains using primer pairs, characterized in that: The following steps are involved: (1) Extract the genomic DNA of the wheat to be tested, use it as a template, use the primer pair to perform the KASP reaction, and read the fluorescence signal of the reaction product; The primer pair includes an upstream primer and a downstream primer: the upstream primer includes an upstream primer 1 and an upstream primer 2: the upstream primer 1 is a nucleotide sequence as shown in SEQ ID No. 1; the upstream primer 2 is a nucleotide sequence as shown in SEQ ID No. 2; the downstream primer is a nucleotide sequence as shown in SEQ ID No. 3; (2) If the fluorescence signal reading result of the wheat to be tested shows Fam allele, the wheat to be tested is of aa genotype; if the fluorescence signal reading result of the wheat to be tested shows Hex allele, the wheat to be tested is of AA genotype, Zhengmai 379 is of the aa genotype, Taimai No. 1 is of the AA genotype, and the thousand-grain weight of the wheat to be tested with the aa genotype is significantly higher than that of the wheat to be tested with the AA genotype.
2. The identification method according to claim 1, characterized in that: The nucleotide sequence of the product amplified using the primer pair is shown in SEQ ID No.
4.
3. The identification method according to claim 1, characterized in that: The molar ratio of the upstream primer 1, the upstream primer 2 and the downstream primer is 2:2:
5.
4. The identification method according to claim 1, characterized in that: The PCR reaction program in the KASP reaction in step (1) is: denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 64°C-56°C for 1 min, 10 cycles; denaturation at 94°C for 20 s, annealing at 58°C for 1 min, 32 cycles.
5. The identification method according to claim 1, characterized in that: The PCR reaction system in step (1) is: 0.25 μL of a 10 μM primer mixture consisting of upstream primer 1: upstream primer 2: downstream primer = 2: 2: 5; 2.5 μL of 2× PAMRSPro SNP Gentyping PCR Mix; 1.25 μL of water; 1 μL of DNA template 100 ng / μL, and a total volume of 5 μL.
6. Use of the identification method according to claim 1 in breeding wheat varieties with high thousand-grain weight.
7. The use according to claim 6, characterized in that: The wheat varieties with aa genotype are bred as wheat varieties with high thousand-grain weight.
Citation Information
Patent Citations
Specific SNP for identifying traits of wheat grains, and applications thereof
CN107794307A
Specific SNP for identifying the traits of wheat grains, and applications thereof
CN107794308A