A molecular marker closely linked to pepper resistance to pmmov and use thereof

Abstract

This invention discloses a molecular marker closely linked to PMMoV resistance in chili peppers and its application. The molecular marker disclosed in this invention is a nucleotide in the chili pepper genome corresponding to positions 53-65 of SEQ ID No. 1 in the sequence listing, which is TTTTTTTTTTTTT or TTTTTTTTTT. Experiments have shown that homozygous chili peppers with nucleotides corresponding to positions 53-65 of SEQ ID No. 1 in the sequence listing as TTTTTTTTTTTTT, and heterozygous chili peppers with nucleotides corresponding to TTTTTTTTTTTTT and TTTTTTTTTT, are PMMoV resistant, while homozygous chili peppers with nucleotides corresponding to positions 53-65 of SEQ ID No. 1 in the sequence listing are PMMoV susceptible. This indicates that the molecular marker of this invention can be used in chili pepper breeding.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically a molecular marker tightly linked to the anti-PMMoV activity of chili peppers and its applications. Background Technology

[0002] Chili pepper (Capsicum annuum L.) is a herbaceous plant belonging to the genus Capsicum in the family Solanaceae. According to the Food and Agriculture Organization of the United Nations (FAO; https: / / www.fao.org / home / zh), the cultivated area of ​​chili peppers and sweet peppers in China in 2022 was approximately 7.60 × 10⁻⁶. 5 China accounts for approximately 27.33% of the global cultivated area, making it the country with the largest cultivation area for chili peppers and bell peppers worldwide; its total fresh chili pepper production is approximately 1.68 × 10⁻⁶. 7 It accounts for approximately 31.29% of global production, making it the world's largest producer.

[0003] Multiple viruses have been detected in chili pepper production, including 33 viruses such as Tobacco Mosaic Virus (TMV), Chili Pepper Mild Mottle Virus (PMMoV), Cucumber Mosaic Virus (CMV), Potato Virus Y (PVY), Tomato Spotted Fusarium Virus (TSWV), Tomato Mottled Mosaic Virus (ToMMV), Broad Bean Wilt Virus (BBWV), and Tobacco Etching Virus (TEV). Co-infection with multiple viruses is also observed. In recent years, among chili pepper virus disease detection in 16 provinces (municipalities and autonomous regions) in China, the top five viruses with the highest detection rates are PMMoV, CMV, BBWV, TEV, and TSWV, with detection rates of 24.76%, 19.05%, 12.38%, 12.38%, and 10.48%, respectively. Although physical and chemical methods, along with strict production and cultivation management, can achieve some control effects, they cannot completely eliminate the occurrence of PMMoV, and the control costs are high. Therefore, breeding PMMoV-resistant chili pepper varieties is the most effective approach.

[0004] To date, while researchers have precisely mapped the PMMoV resistance gene L3 in peppers and developed co-segregation markers, and also mapped the TMV resistance gene L4 in peppers, developing tightly linked markers, practical assisted selection breeding has revealed that genes in this region exhibit tight linkage and exchange imbalance. Pepper disease resistance breeding typically requires continuous artificial inoculation and identification to screen resistant parents and develop high-generation inbred lines. This process is complex, tedious, and prone to seed-borne transmission. Constructing a mapping population to locate the PMMoV resistance gene and developing molecular markers tightly linked to PMMoV resistance can improve the efficiency of molecularly assisted selection breeding for PMMoV resistance in peppers, shorten the breeding cycle, and contribute to the development of new PMMoV-resistant pepper varieties. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to detect PMMoV resistance in chili peppers.

[0006] To address the aforementioned technical problems, this invention first provides the application of a molecular marker for PMMoV resistance in chili peppers or a substance for detecting the PMMoV resistance molecular marker in the detection or auxiliary detection of PMMoV resistance in chili peppers.

[0007] The molecular marker for the PMMoV resistance of chili peppers is the nucleotide in the chili pepper genome corresponding to positions 53-65 of SEQ ID No. 1 in the sequence listing, which is TTTTTTTTTTTTT or TTTTTTTTTT.

[0008] In the above applications, the substance used to detect the molecular marker of PMMoV resistance in the chili pepper may include a primer pair capable of amplifying a DNA fragment containing positions 53-65 of SEQ ID No. 1 in the sequence listing.

[0009] Specifically, the primer pair may consist of two single-stranded DNA molecules as shown in SEQ ID No. 3 and 4 in the sequence listing.

[0010] The substance used to detect the molecular marker of PMMoV resistance in chili peppers may consist solely of the primer pair.

[0011] The present invention also provides a method for detecting PMMoV resistance in peppers, the method comprising: detecting nucleotides corresponding to positions 53-65 of SEQ ID No. 1 in the genomic DNA of the pepper to be tested; wherein the nucleotides corresponding to positions 53-65 of SEQ ID No. 1 in the genomic DNA are homozygous for PMMoV resistance or candidate PMMoV resistance, wherein the nucleotides corresponding to positions 53-65 of SEQ ID No. 1 in the genomic DNA are heterozygous for PMMoV resistance or candidate PMMoV resistance, wherein the nucleotides corresponding to positions 53-65 of SEQ ID No. 1 in the genomic DNA are heterozygous for PMMoV resistance or candidate PMMoV resistance, and wherein the nucleotides corresponding to positions 53-65 of SEQ ID No. 1 in the genomic DNA are homozygous for PMMoV susceptibility or candidate PMMoV susceptibility.

[0012] The present invention also provides another method for detecting PMMoV resistance in peppers, the method comprising: using the genomic DNA of the pepper to be tested as a template, performing PCR amplification using the primer pair to obtain PCR products; detecting the size of the obtained amplification products; wherein the pepper to be tested is PMMoV resistant or a candidate PMMoV resistant if the amplification product contains a 112bp DNA fragment and does not contain a 109bp DNA fragment; wherein the pepper to be tested is PMMoV resistant or a candidate PMMoV resistant if the amplification product contains two DNA fragments, 112bp and 109bp; and wherein the pepper to be tested is PMMoV susceptible or a candidate PMMoV susceptible if the amplification product contains a 109bp DNA fragment and does not contain a 112bp DNA fragment.

[0013] The present invention also provides a third method for detecting PMMoV resistance in peppers, the method comprising: using the genomic DNA of the pepper to be tested as a template, performing PCR amplification using the primer pair to obtain PCR products; detecting the sequence of the obtained amplification products; wherein the amplification products containing the DNA fragment shown in SEQ ID No. 1 and not the DNA fragment shown in SEQ ID No. 2 indicate that the pepper to be tested is PMMoV resistant or a candidate PMMoV resistant; wherein the amplification products containing both DNA fragments shown in SEQ ID No. 1 and SEQ ID No. 2 indicate that the pepper to be tested is PMMoV resistant or a candidate PMMoV resistant; and wherein the amplification products containing the DNA fragment shown in SEQ ID No. 2 and not the DNA fragment shown in SEQ ID No. 1 indicate that the pepper to be tested is PMMoV susceptible or a candidate PMMoV susceptible.

[0014] In the above method, the PCR amplification system using the primer pair can be as follows: 1 μL genomic DNA, 5 μL mix (2×3 GTaq Master Mix for PAGE, Vazyme), 3 μL ddH2O, and 0.5 μL each of the two primers (the concentration of each primer in the reaction system is 10 μM).

[0015] In the above method, the conditions for PCR amplification using the primer pair can be: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 sec, 53℃ annealing for 30 sec, 72℃ extension for 30 sec, 35 cycles, and a final extension at 72℃ for 5 min.

[0016] In the above method, the size of the amplified product can be detected by electrophoresis or by other methods such as sequencing, as long as the size of each DNA fragment of the amplified product can be detected. The sequence of the amplified product can be detected by sequencing.

[0017] The substance used to detect the molecular marker of PMMoV disease resistance in chili peppers is also within the scope of protection of this invention.

[0018] The application of the substance used to detect the molecular marker of PMMoV resistance in chili peppers in the preparation of products for detecting or assisting in the detection of PMMoV resistance in chili peppers is also within the scope of protection of this invention.

[0019] The application of the substance used to detect the PMMoV disease resistance molecular marker in chili peppers in chili pepper breeding is also within the scope of protection of this invention.

[0020] The application of the PMMoV disease resistance molecular marker in chili peppers in chili pepper breeding is also within the scope of protection of this invention.

[0021] Experiments have shown that in a population of 456 pepper F2 plants, homozygous plants with nucleotides TTTTTTTTTTTTT in their genomic DNA corresponding to positions 53-65 of SEQ ID No. 1 in the sequence listing are basically resistant to PMMoV; heterozygous plants with nucleotides TTTTTTTTTTTTT and TTTTTTTTT in their genomic DNA corresponding to positions 53-65 of SEQ ID No. 1 in the sequence listing are basically resistant to PMMoV; and homozygous plants with nucleotides TTTTTTTTTTT in their genomic DNA corresponding to positions 53-65 of SEQ ID No. 1 in the sequence listing are basically susceptible to PMMoV. The accuracy of identifying PMMoV resistance in peppers using the molecular markers of the present invention is 98.2%. This indicates that the molecular markers of PMMoV resistance in peppers of the present invention can be used to identify PMMoV resistance in peppers and for pepper hybridization breeding.

[0022] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0023] Figure 1 Amplification results of the molecular marker Chr-Indel-36 in resistant and susceptible parents. Note: R: resistant parent; S: susceptible parent; F1: generation of cross between the two parents.

[0024] Figure 2 Genetic distance between Chr-Indel-36 and pepper resistance to PMMoV (2.4 cM).

[0025] Figure 3 Validation results of molecular markers for PMMoV resistance in pepper from 58 known genotype materials. Note: R: resistant band; S: susceptible band; H: heterozygous band. Detailed Implementation

[0026] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are all commercially available. All quantitative experiments in the following examples were performed in at least three replicates, and the results were averaged. Unless otherwise specified, in the following examples, the first position of each nucleotide sequence in the sequence listing is the 5′ terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA / RNA.

[0027] Example 1: Obtaining the molecular marker Chr-Indel-36

[0028] 1. Targeting the construction of the target audience

[0029] In this embodiment, the inbred lines of the disease-resistant material 22C1696 and the disease-susceptible material 22C1692 were used as parents to construct an F2 genetic population of 456 plants.

[0030] The resistant material 22C1696 and the susceptible material 22C1692 are both described in the following literature: Li, Z., Jia, Z., Li, J., Kang, D., Li, M., Ma, S., Cheng, Q., Shen, H., & Sun, L. (2024). Development of a 45K pepper GBTS liquid-phase gene chip and its application in genome-wide association studies. Frontiers in plant science, 15, 1405-190.

[0031] When the pepper seedlings have grown to 4-5 true leaves, an artificial inoculation experiment with PMMoV is conducted. The PMMoV virus pepper leaves were previously isolated from our laboratory and stored in a freezer at -80℃ (the initial samples were taken from Shangzhuang Town, Haidian District, Beijing). 5-7 days after PMMoV inoculation, the inoculated leaves are observed to see if mottling occurs. Between days 14 and 21, the systemic leaves of the pepper plants are observed to see if symptoms such as mottling, yellowing, curling, and deformity occur. The resistance and susceptibility phenotypes of individual plants are statistically analyzed based on the severity of the symptoms.

[0032] 2. Molecular marker development and acquisition of Chr-Indel-36

[0033] Resequencing was performed on resistant and susceptible parents. Based on the resequencing results, an Indel marker was developed on chromosome 11. Polymorphism screening of the developed Indel marker was conducted using the resistant parent 22C1696, the susceptible parent 22C1692, and F1 cells. The results showed that the molecular marker Chr-Indel-36 exhibited stable polymorphism between the parents. Combined with the F1 cell detection results, Chr-Indel-36 was considered a co-dominant marker, and the amplified bands produced by this marker were clear and showed significant differences between the resistant and susceptible parents. Figure 1 The molecular marker Chr-Indel-36 is the nucleotide in the chili pepper genomic DNA corresponding to positions 53-65 of SEQ ID No. 1 in the sequence listing, which is TTTTTTTTTTTTT or TTTTTTTTTT.

[0034] The primers used to amplify the molecular marker Chr-Indel-36 are as follows:

[0035] Chr-Indel-36-F: GCATCAGAAAACTGAATTACCT (SEQ ID No. 3);

[0036] Chr-Indel-36-R: CCTTTCACCAACTGAGCTAAG (SEQ ID No. 4).

[0037] 3. Correlation analysis between molecular markers and PMMoV resistance

[0038] Genomic DNA was extracted from each plant in the F2 population and amplified by PCR using Chr-Indel-36-F and Chr-Indel-36-R, respectively.

[0039] The PCR reaction system (10 μl) consisted of: 1 μL genomic DNA, 5 μL mix (2×3G Taq Master Mix for PAGE, Vazyme), 3 μL ddH2O, 0.5 μL each of the two primers (each at a concentration of 10 μM in the reaction system), and a total amplification volume of 10 μL.

[0040] PCR amplification reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 sec, 53℃ annealing for 30 sec, 72℃ extension for 30 sec, 35 cycles, and a final extension at 72℃ for 5 min.

[0041] The amplified products were subjected to 7% non-denaturing polyacrylamide gel electrophoresis, stained with silver nitrate, and observed and photographed. The results showed that each plant in the F2 population exhibited three band patterns: a single band of 112 bp, a single band of 109 bp, and two bands of both 112 bp and 109 bp. Sequencing of the amplified products revealed that the sequence of the 112 bp band was SEQ ID No. 1, the sequence of the single 109 bp band was SEQ ID No. 2, and the sequences of the two bands of both 112 bp and 109 bp were both SEQ ID No. 1 and SEQ ID No. 2.

[0042] The relationship between PMMoV resistance in peppers and amplification products was analyzed. Results showed that in a population of 456 F2 plants, 141 plants had a single band of 112 bp amplification product, of which 139 showed PMMoV resistance and 2 showed PMMoV susceptibility; 112 plants had a single band of 109 bp amplification product, of which 111 showed PMMoV susceptibility and 1 showed PMMoV resistance; and 203 plants had two bands of amplification product (112 bp and 109 bp), of which 198 showed PMMoV resistance and 5 showed PMMoV susceptibility. The linkage distance between the molecular marker Chr-Indel-36 and PMMoV resistance in this invention was 2.4 cM. Figure 2 The molecular marker Chr-Indel-36 of this invention is a molecular marker for PMMoV resistance. The accuracy of identifying PMMoV resistance in peppers using the molecular marker Chr-Indel-36 is 98.2%. The molecular marker Chr-Indel-36 can be used to identify PMMoV resistance in peppers and for pepper hybridization breeding.

[0043] When evaluating the PMMoV resistance of individual plants, the grading method follows the "Specifications and Data Standards for the Description of Pepper Germplasm Resources," classifying grades 0 and 1 as resistant, and grades 3, 5, 7, and 9 as susceptible. The grading criteria are shown in the table below:

[0044] Level 0: Asymptomatic;

[0045] Grade 1: Inoculated leaves develop necrotic spots or a few young leaves show mosaic patterns;

[0046] Grade 3: A few leaves or the middle and upper leaves are variegated;

[0047] Level 5: Most leaves are mosaic or a few leaves are deformed;

[0048] Grade 7: Most leaves are mottled or deformed;

[0049] Level 9: The vast majority of leaves are either heavily mottled or deformed.

[0050] Specifically, the method for identifying PMMoV resistance in chili peppers based on PMMoV resistance molecular markers is as follows: Genomic DNA of the target chili pepper is amplified by PCR using Chr-Indel-36-F and Chr-Indel-36-R. The sequence or size of the amplified products is detected. Chili peppers whose amplified products contain the DNA fragment shown in SEQ ID No. 1 but not the DNA fragment shown in SEQ ID No. 2 are considered or candidate PMMoV resistant chili peppers. Chili peppers whose amplified products contain the DNA fragment shown in SEQ ID No. 2 but not the DNA fragment shown in SEQ ID No. 1 are considered or candidate PMMoV susceptible chili peppers. Chili peppers whose amplified products contain the DNA fragments shown in both SEQ ID No. 1 and SEQ ID No. 2 are considered or candidate PMMoV resistant chili peppers.

[0051] Example 2: Application of PMMoV disease resistance molecular markers in chili peppers

[0052] 1. Test materials

[0053] This embodiment utilizes 58 chili pepper varieties with known resistant and susceptible phenotypes (Table 1) to verify the molecular markers of PMMoV resistance in chili peppers. The varieties used can be obtained from the College of Horticulture, China Agricultural University.

[0054] Table 1. Molecular marker validation

[0055] Material Number Phenotype Belt Material Number Phenotype Belt 1 R H 30 S S 2 S S 31 S S 3 R R 32 S S 4 R R 33 S S 5 R R 34 S S 6 S S 35 S S 7 R R 36 S S 8 R R 37 R R 9 R S 38 R R 10 R R 39 S S 11 R R 40 S S 12 R S 41 S S 13 S S 42 S S 14 S S 43 R S 15 S S 44 S S 16 S S 45 S S 17 S R 46 S S 18 R S 47 S S 19 S R 48 R R 20 S S 49 S S 21 R H 50 S S 22 R H 51 R S 23 R H 52 R S 24 S S 53 S S 25 S S 54 R R 26 R S 55 R R 27 S S 56 R S 28 S S 57 S S 29 S S 58 R S

[0056] In Table 1, phenotype R indicates PMMoV resistance, phenotype S indicates PMMoV susceptibility; band R indicates that the amplification product contains a 112bp DNA fragment and does not contain a 109bp DNA fragment, band S indicates that the amplification product contains a 109bp DNA fragment and does not contain a 112bp DNA fragment, and band H indicates that the amplification product contains both 112bp and 109bp DNA fragments.

[0057] 2. Test Methods

[0058] Following the method in step 3 of Example 1, the genomic DNA of the above experimental materials was detected using primer pairs composed of Chr-Indel-36-F and Chr-Indel-36-R, and the PCR amplification system and conditions were the same as in Example 1.

[0059] The amplified products were subjected to 7% non-denaturing polyacrylamide gel electrophoresis, stained with silver nitrate, and then observed and photographed. The results are shown in Table 1. Figure 3 .

[0060] 3. Test Results

[0061] The results showed that the PMMoV resistance molecular marker was used to validate 58 chili pepper varieties with known resistant and susceptible phenotypes. The success rate of validation using the PMMoV resistance molecular marker was 82.76% for all 58 materials. This indicates that the marker has high accuracy in identifying PMMoV resistance in chili peppers, and can be used for rapid and accurate identification of PMMoV resistance in practical breeding applications.

[0062] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Application of substances that detect molecular markers of PMMoV resistance in peppers in the detection or auxiliary detection of PMMoV resistance in peppers; The nucleotide sequence of the molecular marker for the PMMoV resistance of the chili pepper is shown in SEQ ID No. 1 or SEQ ID No.

2.

2. The application according to claim 1, characterized in that: The substance used to detect the molecular marker of PMMoV resistance in chili peppers is a primer pair consisting of two single-stranded DNA molecules as shown in SEQ ID No. 3 and 4 in the sequence listing.

3. Methods for detecting PMMoV resistance in chili peppers include: The nucleotide sequence corresponding to positions 53-65 of SEQ ID No. 1 in the sequence listing is detected in the genomic DNA of the pepper to be tested. Peppers with a nucleotide sequence of TTTTTTTTTTTTT in their genomic DNA corresponding to positions 53-65 of SEQ ID No. 1 in the sequence listing are homozygous for PMMoV resistance or candidate PMMoV resistance. Peppers with a nucleotide sequence of TTTTTTTTTTTTT and TTTTTTTTTTT in their genomic DNA corresponding to positions 53-65 of SEQ ID No. 1 in the sequence listing are heterozygous for PMMoV resistance or candidate PMMoV resistance. Peppers with a nucleotide sequence of TTTTTTTTTTT in their genomic DNA corresponding to positions 53-65 of SEQ ID No. 1 in the sequence listing are homozygous for PMMoV susceptibility or candidate PMMoV susceptibility.

4. Methods for detecting PMMoV resistance in chili peppers include: Using the genomic DNA of the pepper to be tested as a template, PCR amplification was performed using the primer pair described in claim 2 to obtain PCR products. The size of the obtained amplification products was detected. If the amplification product was a 112bp DNA fragment, the pepper to be tested was PMMoV resistant or a candidate PMMoV resistant. If the amplification product was two DNA fragments, 112bp and 109bp, the pepper to be tested was PMMoV resistant or a candidate PMMoV resistant. If the amplification product was a 109bp DNA fragment, the pepper to be tested was PMMoV susceptible or a candidate PMMoV susceptible.

5. Methods for detecting PMMoV resistance in chili peppers include: Using the genomic DNA of the pepper to be tested as a template, PCR amplification was performed using the primer pair described in claim 2 to obtain PCR products. The sequences of the obtained amplified products were detected. Peppers to be tested whose amplified products are DNA fragments with nucleotide sequences as shown in SEQ ID No. 1 and do not contain the DNA fragment shown in SEQ ID No. 2 are resistant to PMMoV or are candidate resistant to PMMoV. Peppers to be tested whose amplified products are two DNA fragments with nucleotide sequences as shown in SEQ ID No. 1 and SEQ ID No. 2 are resistant to PMMoV or are candidate resistant to PMMoV. Peppers to be tested whose amplified products are DNA fragments with nucleotide sequences as shown in SEQ ID No. 2 and do not contain the DNA fragment shown in SEQ ID No. 1 are susceptible to PMMoV or are candidate susceptible to PMMoV.

6. The use of the substance for detecting the molecular marker of PMMoV resistance in chili peppers as described in claim 1 or 2 in the preparation of products for detecting or assisting in the detection of PMMoV resistance in chili peppers.

7. The application of the substance for detecting molecular markers of PMMoV resistance in chili peppers as described in claim 1 or 2 in the breeding of chili peppers for PMMoV resistance.

Images