Application of Maize ZmER1 Gene in Improving Resistance to Maize Ear Rot

Abstract

The present invention relates to the field of genetic engineering breeding and molecular breeding, and specifically discloses a new gene for resistance to ear rot ZmER1 and its application in regulating resistance to corn ear rot. ZmER1 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by it is shown in SEQ ID NO.2. The present invention identifies a group of SNP molecular markers significantly associated with corn ear rot resistance through genome-wide association analysis, and uses CRISPR / Cas9 gene editing technology to knock out the SNP markers in corn. ZmER1 Gene knockout mutants with two different mutation types were created Direction1‑1 and Direction1‑2 Compared with the wild type, the mutants showed reduced ear rot resistance, indicating ZmER1 The gene can positively regulate corn ear rot resistance. The invention lays a theoretical foundation for studying the molecular mechanism of corn ear rot resistance, and at the same time provides new molecular markers and gene resources for molecular design breeding to cultivate new excellent corn germplasm with ear rot resistance characteristics.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering breeding and molecular breeding, and specifically relates to a group of SNP markers, corn ZmER1 Genes and their use in providing resistance to ear rot in maize. Background Art

[0002] Corn is the world's largest food crop. Ear rot is a common fungal infectious disease in major corn-producing areas around the world. Corn ear rot, also known as corn kernel and ear rot, is a common fungal infectious disease in corn-producing areas around the world. The main pathogens include Fusarium spp. Fusarium verticillioides , Fv), Fusarium graminearum ( F. graminearum , Fg) and Aspergillus flavus ( Aspergillus flavus , Af), etc., and the corresponding ear rot types are Fusarium ear rot (FER), Graminearum ear rot (GER) and Aspergillus ear rot (AER), among which Fusarium oxysporum is the most prevalent in the world (Logrieco et al. 2002). Most pathogenic fungi can secrete mycotoxins, such as Fv, Fg, and Af, which can secrete fumonisins, zearalenone, and aflatoxin, respectively. On the one hand, the occurrence of ear rot will cause corn production to decrease, seriously threatening global food security; on the other hand, the fungal toxins secreted by ear rot will cause lesions in human and livestock organs, and even induce cancer and death (Yang et al. 2020). According to statistics, the economic losses caused by ear rot in global corn production can reach billions of dollars each year (Wu et al. 2012). In addition, the current prevention and control of corn ear rot is mainly based on chemical control. The large-scale use of chemical agents has increased environmental pollution and also led to increased carbon emissions (Chen et al. 2009).

[0003] The genetic mechanisms regulating fungal infection and mycotoxin accumulation may be quite different. For example, Maschietto et al. (2017) detected 15 loci regulating FER and 17 loci regulating fumonisin accumulation using the same genetic population, and only 8 loci were shared by the two, indicating that the genetic regulatory genes and regulatory mechanisms of the two are significantly different. Currently, few genes regulating corn ear rot resistance have been cloned, and transcription factor encoding genes have not been reported.

[0004] Flavonoids contain a variety of compounds, and their synthesis and metabolism involve a large number of substance synthesis-related genes and regulatory genes. It has been reported that a variety of flavonoids can regulate plant growth and development and interactions with microorganisms (Dong and Lin, 2021; Wang et al. 2022). For example, tangeretin among flavonoids can regulate rice blast resistance by inhibiting fungal ferroptosis (Liang et al. 2021), and shinonin among flavonoids has been shown to inhibit the growth of Fv and Fg under in vitro conditions (Förster et al. 2022). Under low-dose conditions, three flavonoids, apigenin, luteolin and quercetin, have inhibitory effects on Af growth and aflatoxin accumulation (Köllner, 2022). eQTL (expressedQuantitativeTraitLoci) analysis has shown that genes in the flavonoid biosynthesis pathway are significantly correlated with Af infection in corn kernels (Castano-Duque et al. 2022). Using genetic materials with different kernel color, it was demonstrated that flavonoid pigments, especially tannin red, have a significant inhibitory effect on fumonisin (Pilu et al. 2011). Also using genetic materials with different kernel color, it was found that tannin red can regulate the thickness of corn kernel pericarp and inhibit the accumulation of fumonisin (Landoni et al. 2020).

[0005] In maize, flavonoid biosynthesis is regulated by the MYB transcription factor encoding R2R3. ZlP ( pericarp color1 ) gene regulation (Grotewold et al., 1994; Coe et al. 1988). ZlP There are multiple alleles whose allelic variation affects the pigmentation pattern of corn ears (Brinks & Styles, 1966; Cocciolone et al. 2001), among which P1-rr (red skin / red cob), P1-wr (white rind / red cob), P1-rw (red rind / white cob) and P1-ww (white fruit skin / white cob) alleles have been studied more. ZnP1 Allele discovery ZlP There are abundant copy number variations, such as P1-rr have ZlP Single gene copy P1-wr By ZlP Six copies of tandem repeats are composed, and the difference in gene expression is mainly caused by P1-wr Relative to P1-rrThis is caused by DNA hypermethylation (Chopra et al. 1998).

[0006] In summary, previous research results show that there is a certain relationship between flavonoid content and fungal toxin accumulation, but ZnP1 Whether resistance to corn ear rot can be directly regulated is still unclear and requires further study.

[0007] The present invention uses CRISPR / Cas9 (Clustered, Regularly Interspaced, Short Palindromic Repeats-associated Endonuclease 9) gene editing technology to create two different types of mutations. ZmER1 Knockout mutants Zmer1-1 and Zmer1-2 The present invention treats wild type and Zmer1 Analysis of the area of ​​ear rot in the mutant revealed ZmER1 The gene deletion makes the plant more susceptible to infection by Fusarium spp. ZmER1 Genes play an important role in enhancing corn ear rot resistance. Sequence comparison revealed that ZmER1 Gene and ZlP The gene nucleotide sequences are highly consistent. The invention provides new gene resources for the mining of corn ear rot resistance related genes and the breeding of new corn ear rot resistance varieties. Summary of the invention

[0008] The technical problem to be solved by the present invention is to provide a new SNP marker SNP1-50 and a new gene for corn ear rot resistance ZmER1 and its application in regulating corn ear rot resistance. The location of SNP1-50 on chromosome 1 of corn is shown in Table 1. ZmER1 The nucleotide sequence of the gene is shown in SEQ ID NO.1. ZmER1 The amino acid sequence encoded by the gene is shown in SEQ ID NO.2. ZmER1 Positive regulation of corn ear rot resistance.

[0009] In corn, SNPs, namely SNP1-50, can be used to select corn resistant to ear rot through molecular marker-assisted selection or whole genome selection.

[0010] Knockout in corn ZmER1 The gene makes corn sensitive to ear rot stress and reduces its ability to resist ear rot.

[0011] exist ZmER1CRISPR / Cas9 vector targets (MT1 and MT2) were designed at the third exon of the gene, and the DNA sequences of the targets are shown in SEQ ID NO.3 and SEQ ID NO.4; finally, two mutants of different editing types were obtained. ZmER1-1 and ZmER1-2 , all showed a susceptible phenotype to ear rot.

[0012] The purpose of the present invention is to study ZmER1 The application of this technology in corn ear rot stress provides new germplasm resources for the cultivation of corn resistant to ear rot. The specific technical solution is as follows:

[0013] 1. Identification of genetic loci for ear rot resistance, the identification method is genome-wide association analysis, the population used is 1223 maize inbred lines composed of SS, NSS, PA, PB, and TSPT subpopulation materials. The model used for genome-wide association analysis is EMMAX (Efficient Mixed-Model Association eXpedited), and the threshold is <1E -10 .

[0014] 2. Corn B73 ZmER1 Sequence analysis of the gene ZmER1 The nucleotide sequence encoded by the gene is shown in SEQ ID NO: 1. ZmER1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 2. Select appropriate sites for gene editing target design.

[0015] 3. Construct a gene editing vector and introduce it into the callus tissue of the corn inbred line X249 using the Agrobacterium-mediated method. After obtaining the T1 generation positive plants, the changes in their resistance to ear rot were investigated by inoculating Fusarium spp. into the ears.

[0016] The present invention uses genome-wide association analysis to identify SNP markers significantly associated with corn ear rot resistance and uses CRISPR / Cas9 technology to identify SNP markers significantly associated with corn ear rot resistance. ZmER1 The third exon of the gene was edited by site-directed gene editing, and two mutants of the gene with different editing types were obtained. Both mutants showed a phenotype that was susceptible to ear rot. ZmER1 Genes positively regulate ear rot resistance in corn. The results not only reveal ZmER1 Its function in corn ear rot stress also provides new molecular markers and gene resources for breeding corn resistant to ear rot.

[0017] Based on this, the present invention identified a group of SNP combinations significantly associated with corn ear rot resistance, a new SNP combination associated with corn ear rot resistance ZmER1Gene, using CRISPR / Cas9 technology, which is currently widely used in gene editing, to create corn ZmER1 The mutants of the gene were identified and their ability to resist ear rot stress was evaluated, providing new molecular markers and gene resources for the breeding of corn resistant to ear rot. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Manhattan plot of maize ear rot phenotypic association analysis. (A) Results of ear rot association analysis using BLUP values ​​from 9 environments; (B) LD Block analysis of the Chr1_47833646-48395513 bp interval. Red dots indicate SNP sites that are significantly associated with ear rot resistance.

[0019] Figure 2 Analysis of the significant association SNP haplotypes on maize chromosome 1. (A) Zm00001eb014430 Comparative analysis of the unit type formed by the gene promoter SNP and the ear rot resistance phenotype; (B) Comparative analysis of the Chr1_48033453 site SNP and the ear rot resistance phenotype; (C) Comparative analysis of the Chr1_48033464 site SNP and the ear rot resistance phenotype; (D) Comparative analysis of the Chr1_48033557 site SNP and the ear rot resistance phenotype; (E) Comparative analysis of the Chr1_48034381 site SNP and the ear rot resistance phenotype.

[0020] Figure 3 Maize inbred line B73 ZmER1 Comparative analysis of the gene location interval with other different maize inbred lines pan-genome. B73 has 8 ZmER1 Gene, maize inbred line Oh7B has 3 ZmER1 Gene, maize inbred line Mo18W has no ZmER1 The red boxes show the 8 genes in the B73 genome. ZmER1 Genes and other corresponding regions in the genome of different maize inbred lines.

[0021] Figure 4 corn pCas9-ZmER1 Vector map. From the left border to the right border of T-DNA are herbicide resistance genes Bar Expression cassette; Nuclease encoding gene Cas9 expression cassette; ZmER1 Expression cassette for gene target 2 (MT2); ZmER1 Expression cassette for gene target 1 (MT1).

[0022] Figure 5 Two CRISPR / Cas9 knockout lines Zmer1-1 and Zmer1-2 Gene sequence variation analysis. The base variation sites are indicated in red font. ZmER1-1 and ZmER1-2 The missing bases are indicated by short red lines. Zmer1-2 The 1 bp deletion and 1 bp insertion positions are marked with red triangle symbols.

[0023] Figure 6 corn ZmER1 wild type and ZmER1-1 and ZmER1-2 Analysis of mutant ear rot resistance. A) Transgenic receptor X249 and ZmER1-1 Ear phenotype; (B) after artificial inoculation with Fusarium spp. ZmER1- 1 Comparative statistical analysis of ear rot resistance phenotypes; (C) Transgenic receptor X249 and ZmER1- 2 (D) After artificial inoculation with Fusarium spp. ZmER1-2 Comparative statistical analysis of ear rot resistance phenotypes. DETAILED DESCRIPTION

[0024] Example 1 Association analysis of corn ear rot resistance and LDblock analysis of Chr1_47833646-48395513 bp interval

[0025] In this example, a maize inbred line population containing 1223 germplasms was used for genome-wide association analysis. The test materials were planted in Beijing Pinggu (2019PG), Shandong Zhucheng (2019ZC) and Henan Puyang (2019PY) in 2019, Beijing Pinggu (2020PG) and Shandong Zhucheng (2020ZC) in 2020, Beijing Pinggu (2021PG), Shandong Zhucheng (2021ZC) and Jilin Changchun (2021CC) in 2021, and Beijing Pinggu (2022PG) in 2022. The experimental scheme is to randomly select 30 individual plants for each inbred line variety on the 15th day after the pollination of the maize plant, and the first female ear of each individual plant is inoculated by injecting 2 ml of Fusarium pseudoverticularis suspension using the needle ear method. After the female ears are harvested, a phenotypic investigation is carried out, the resistance level is manually identified, and the ears are photographed using an instrument. The Mer_ana and SFB-software developed by the Chinese Academy of Agricultural Sciences are used to identify the characteristics of the ears infected by Fusarium spp. and calculate the proportion of susceptible area.

[0026] Genomic DNA of 1223 maize inbred line materials was extracted, library constructed, and sequenced. The cleanreads obtained after filtering were aligned to the B73 reference genome (Zm-B73-REFERENCE-NAM-5.0) using the MEM algorithm of the short sequence alignment software BWA. The initially filtered SNPs were filtered out using VCFtools (v0.1.16) software based on the SNP maximum missing rate (Max-missing), minimum (Min-alleles) or maximum allele variation site (Max-alleles), MAF, etc., and SNPs with missing rate lower than >10%, MAF<0.05, and containing two allele variations were retained, obtaining 6.84 million SNP markers.

[0027] GWAS analysis was performed based on 6.84 million high-quality SNP markers obtained by resequencing and ear rot resistance phenotype data. The EMMAX model was used, and the threshold P-value of significant association sites was ≤1E-10. The Manhattan plot of the association analysis of corn ear rot resistance was drawn using the R software CMplot package, as shown in the figure below: Figure 1 As shown in A.

[0028] In the nine environments and the association analysis using the best linear unbiased prediction (BLUP) value, a highly associated interval was identified in chromosome 1 at 46-49 Mb, among which Chr1_47833646-48395513 bp had a total of 50 significantly associated SNPs ( Figure 1 B, Table 1). The most significant association site in GWAS analysis was Chr 1_48033453 bp, located in the gene Zm00001eb014430 The lowest P-value was 7.17E -40 According to the results of 1223 inbred lines Zm00001eb014430 The SNP markers in the gene promoter region were analyzed and found Zm00001eb014430 There were 9 significantly associated SNP markers in the upstream region of the gene, which formed a variety of haplotypes. Among them, the material carrying the unit type Hap 3 showed higher FER resistance. For example, compared with Hap 1, the area of ​​Hap 3 spike infected by pathogens was reduced by 8.18% ( Figure 2 A). The SNPs at bases 48033453, 48033464, 48033557, and 48034381 on chromosome 1 were analyzed separately, and it was found that the corn inbred lines carrying T, G, T, and A type SNPs had smaller ear rot disease areas than the corn inbred lines carrying C, T, G, and C type SNPs at the corresponding sites ( Figure 2BE), indicating that the disease resistance SNP types at bases 48033453, 48033464, 48033557, and 48034381 are T, G, T, and A, respectively. Zm00001eb014430 This is the candidate gene for ear rot resistance in the 46-49 Mb association interval of chromosome 1 ZmER1 .

[0029] Table 1 50 SNPs significantly associated with ear rot traits in the Chr1_47833646-48395513 bp interval in maize

[0030] Serial number SNP Name Base position Minimum P value SNP Type Testing environment 1 chr1_snp_47833646 47833646 1.67E-23 A / G 2019PY, 2019PG,2020PG, 2020ZC,2021PG, 2021ZC,BLUP 2 chr1_snp_47833949 47833949 6.46E-21 T / G 2019PG, 2019PY,2020ZC, 2021PG,BLUP 3 chr1_snp_47834083 47834083 1.71E-15 A / C 2019PG, 2020ZC,BLUP 4 chr1_snp_47834369 47834369 3.50E-20 A / G 2020ZC, 2021PG,BLUP 5 chr1_snp_47834384 47834384 2.06E-20 T / C 2019PG, 2019PY,2020ZC, 2021PG,BLUP 6 chr1_snp_47834515 47834515 9.07E-20 C / T 2019PG, 2020ZC, 2021PG, BLUP 7 chr1_snp_47834855 47834855 8.70E-20 C / A 2019PG, 2020ZC, 2021PG, BLUP 8 chr1_snp_47834958 47834958 1.42E-14 G / A BLUP 9 chr1_snp_47835040 47835040 8.46E-20 A / G 2019PG, 2020ZC, 2021PG, BLUP 10 chr1_snp_47835468 47835468 4.46E-16 T / G 2019PG, 2020ZC,BLUP 11 chr1_snp_47835529 47835529 1.09E-24 G / T 2019PG, 2019PY,2020PG, 2020ZC,2021PG, 2021ZC,BLUP 12 chr1_snp_47835695 47835695 4.03E-19 T / C 2020ZC, 2021PG,BLUP 13 chr1_snp_47835718 47835718 3.89E-19 G / A 2020ZC, 2021PG,BLUP 14 chr1_snp_47835720 47835720 2.95E-18 G / T 2020ZC, 2021PG,BLUP 15 chr1_snp_47835858 47835858 8.89E-15 C / A BLUP 16 chr1_snp_47835891 47835891 9.56E-15 G / A BLUP 17 chr1_snp_47835994 47835994 1.70E-20 G / C 2019PG, 2019PY,2020ZC, 2021PG,BLUP 18 chr1_snp_47836112 47836112 1.15E-11 C / T BLUP 19 chr1_snp_47836286 47836286 1.28E-18 G / T 2020ZC, BLUP 20 chr1_snp_47836402 47836402 2.67E-21 T / C 2019PG, 2019PY,2020ZC, 2021PG,BLUP 21 chr1_snp_47836763 47836763 6.44E-20 A / T 2019PG, 2019PY,2020ZC, 2021PG,BLUP 22 chr1_snp_47836798 47836798 6.03E-14 C / T 2019PG, BLUP 23 chr1_snp_47836873 47836873 5.14E-20 T / A 2019PG, 2020ZC,2021PG, BLUP 24 chr1_snp_47837201 47837201 2.75E-20 C / T 2019PG, 2020ZC,2021PG, BLUP 25 chr1_snp_47854995 47854995 2.45E-39 C / T 2019PG, 2019PY,2019ZC, 2020PG,2020ZC, 2021CC,2021PG, 2021ZC,2022PG, BLUP 26 chr1_snp_47924208 47924208 7.44E-35 G / A 2019PG, 2019PY,2019ZC, 2020PG,2020ZC, 2021CC,2021PG, 2021ZC,2022PG, BLUP 27 chr1_snp_47926447 47926447 5.70E-12 G / A BLUP 28 chr1_snp_47926814 47926814 4.91E-35 G / A 2019PG, 2019PY,2019ZC, 2020PG,2020ZC, 2021CC,2021PG, 2021ZC,2022PG, BLUP 29 chr1_snp_48033414 48033414 4.35E-12 A / G BLUP 30 chr1_snp_48033453 48033453 7.17E-40 T / C 2019PG, 2019PY,2019ZC, 2020PG,2020ZC, 2021CC,2021PG, 2021ZC,2022PG, BLUP 31 chr1_snp_48033464 48033464 3.05E-39 G / T 2019PG, 2019PY,2019ZC, 2020PG,2020ZC, 2021CC,2021PG, 2021ZC,2022PG, BLUP 32 chr1_snp_48034381 48034381 7.55E-40 A / C 2019PG, 2019PY,2019ZC, 2020PG,2020ZC, 2021CC,2021PG, 2021ZC,2022PG, BLUP 33 chr1_snp_48034462 48034462 1.93E-17 C / T 2019PG, 2019PY,2020ZC, BLUP 34 chr1_snp_48034503 48034503 8.01E-22 G / T 2019PG, 2019PY,2020ZC, 2021PG,BLUP 35 chr1_snp_48034557 48034557 1.60E-21 T / C 2019PG, 2019PY,2020ZC, 2021PG,BLUP 36 chr1_snp_48034585 48034585 2.20E-17 T / C 2019PG, 2020ZC,BLUP 37 chr1_snp_48034681 48034681 1.87E-16 G / A 2019PG, 2020ZC,BLUP 38 chr1_snp_48039029 48039029 1.80E-32 A / G 2019PG, 2019PY,2019ZC, 2020PG,2020ZC, 2021CC,2021PG, 2022PG,BLUP 39 chr1_snp_48072690 48072690 1.96E-19 T / C 2019PG, 2019PY,2020ZC, 2021PG,BLUP 40 chr1_snp_48074130 48074130 1.84E-36 G / T 2019PG, 2019PY,2019ZC, 2020PG,2020ZC, 2021CC,2021PG, 2021ZC,2022PG, BLUP 41 chr1_snp_48180190 48180190 2.34E-35 T / C 2019PG, 2019PY,2019ZC, 2020PG,2020ZC, 2021CC,2021PG, 2021ZC,2022PG, BLUP 42 chr1_snp_48272315 48272315 9.59E-39 G / A 2019PG, 2019PY,2019ZC, 2020PG,2020ZC, 2021CC,2021PG, 2021ZC,2022PG, BLUP 43 chr1_snp_48338772 48338772 3.80E-15 A / G 2019PG, 2020ZC,2021PG, BLUP 44 chr1_snp_48369577 48369577 9.97E-34 C / T 2019PG, 2019PY, 2019ZC, 2020PG, 2020ZC, 2021CC, 2021PG, 2021ZC, 2022PG, BLUP 45 chr1_snp_48372189 48372189 2.44E-15 C / A 2019PG, 2021PG, BLUP 46 chr1_snp_48389174 48389174 1.16E-14 A / G 2019PG, 2021PG, BLUP 47 chr1_snp_48389228 48389228 6.38E-14 G / A 2019PG, 2021PG, BLUP 48 chr1_snp_48392075 48392075 5.18E-16 C / T 2019PG, 2020ZC, 2021PG, BLUP 49 chr1_snp_48392266 48392266 9.29E-14 C / A 2019PG, 2020ZC, 2021PG, BLUP 50 chr1_snp_48395513 48395513 3.40E-12 T / G BLUP

[0031] Example 2 Analysis of structural variation of candidate gene sequences

[0032] According to the annotation of the B73 reference genome (Zm-B73-REFERENCE-NAM-5.0) in the MaizeGDB database (https: / / www.maizegdb.org / ), the 47833646-48395513 base interval on chromosome 1 that was significantly associated with corn ear rot was Zm00001eb014430 Right now ZmER1 In addition to genes, it also contains 7 highly consistent protein-coding genes distributed in tandem, namely Zm00001eb014280 , Zm00001eb014290 , Zm00001eb014320 , Zm00001eb014350 , Zm00001eb014370 , Zm00001eb014390 , Zm00001eb014420 ( Figure 3 ).in, Zm00001eb014280 and Zm00001eb014290 In the database (https: / / www.maizegdb.org / ), they are annotated as ZmP1 The gene encoding protein sequence differs by only one amino acid residue. The MatGAT2.01 software was used to analyze the consistency of the above 8 gene sequences and found Zm00001eb014280 and Zm00001eb014290 , Zm00001eb014320 , Zm00001eb014350 , Zm00001eb014370 , Zm00001eb014390 , Zm00001eb014420 , Zm00001eb014430 The DNA sequence identities were 99.6%, 99.9%, 100%, 99.7%, 99.9%, 99.7%, and 99.8%, respectively (Table 2), and the protein sequence identities were 99.7%, 100%, 100%, 90.6%, 100%, 99.7%, and 100%, respectively (Table 3). Zm00001eb014320 , Zm00001eb014350 , Zm00001eb014390 ,Zm00001eb014430 and Zm00001eb014280 The encoded protein sequences are completely identical (Table 3). The decrease in protein sequence identity between Zm00001eb014370 and Zm00001eb014280 is due to Zm00001eb014370 Compared with other genes, there is a base deletion in the coding region causing a frameshift mutation. ZmP1 The gene has copy number variation in different corn varieties. The above sequence analysis shows that Zm00001eb014280 , Zm00001eb014290 , Zm00001eb014320 , Zm00001eb014350 , Zm00001eb014370 , Zm00001eb014390 , Zm00001eb014420 , Zm00001eb014430 The sequences are highly consistent and appear in tandem, and are presumed to be ZmP1 Using MaizeGDB database to analyze different maize inbred lines ZmP1 The copy number of maize inbred line B73 was found to have 8 ZmP1 Gene, maize inbred line Oh7B has genes and 3 ZmP1 Gene, maize inbred line Mo18W has no ZmP1 Gene( Figure 3 ), further indicating that ZmP1 There is abundant copy number variation in different maize inbred lines.

[0033] same, Zm00001eb014280 and Zm00001eb014290 , Zm00001eb014320 , Zm00001eb014350 , Zm00001eb014370 , Zm00001eb014390 , Zm00001eb014420 for Zm00001eb014430 Different copies of ZmER1 There is abundant copy number variation in different maize inbred lines, and there is reason to believe that Zm00001eb014280, Zm00001eb014290, Zm00001eb014320, Zm00001eb014350, Zm00001eb014390, Zm00001eb014420 and Zm00001eb014430 have consistent functions. Zm00001eb014430 As ZmER1 Standard sequence analysis.

[0034] Table 2 Consistency analysis of 8 candidate genes in the association interval based on DNA sequences (%)

[0035] 1 2 3 4 5 6 7 1. Zm00001eb014280 2. Zm00001eb014290 99.6 3. Zm00001eb014320 99.9 99.7 4. Zm00001eb014350 100 99.6 99.9 5. Zm00001eb014370 99.7 99.5 99.8 99.7 6. Zm00001eb014390 99.9 99.7 100 99.9 99.8 7. Zm00001eb014420 99.7 99.9 99.6 99.7 99.4 99.6 8. Zm00001eb014430 99.8 99.4 99.7 99.8 99.5 99.7 99.5

[0036] Table 3 Consistency analysis of 8 candidate genes in the association interval based on amino acid sequences (%)

[0037] 1 2 3 4 5 6 7 1. Zm00001eb014280 2. Zm00001eb014290 99.7 3. Zm00001eb014320 100 99.7 4. Zm00001eb014350 100 99.7 100 5. Zm00001eb014370 90.6 90.4 90.6 90.6 6. Zm00001eb014390 100 99.7 100 100 90.6 7. Zm00001eb014420 99.7 100 99.7 99.7 90.4 99.7 8. Zm00001eb014430 100 99.7 100 100 90.6 100 99.7

[0038] Example 3: Creation using CRISPR / Cas9 method ZmER1 Mutants

[0039] To make it clear ZmER1 The mutant plays a role in corn response to ear rot. The present invention uses CRISPR / Cas9 gene site-directed editing method to mutate and knock out the function of the gene in corn. The present invention selects corn inbred line X249 as the receptor material for gene editing. ZmER1 The conserved region of the gene, located in the 3rd exon, MT1 and the sequences shown in MT2 serve as the target region for CRISPR / Cas9 gene editing.

[0040] MT1 (SEQ ID NO.3): GAGCGCCGACAGGCGGCG

[0041] MT2 (SEQ ID NO.4): CTGCTGCTTGTTGGGCTGGT

[0042] 1、ZmER1 Construction of CRISPR / Cas9 gene editing vector

[0043] The gene editing vector of the present invention is pBUE411-MT1T2-Cas9 , the base vector of this vector is pBUE411- Cas9 , the intermediate carrier is pCBCmT1T2 , gRNA is provided. The present invention designs a target on a primer and then obtains MT-sgRNA by PCR and then connects it to a basic vector by enzyme cutting. The specific construction process is as follows.

[0044] (1) Design of target gRNA. ZmER1 The conserved gene sequence of the present invention is input into the website http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR for target design. The sgRNA backbone sequence of the present invention is obtained from the intermediate vector pCBCmT1T2 Directly amplified.

[0045] (2) Obtain MT-sgRNA by designing target sites on primers and PCR amplification. Primers ZmER1-MT1-F (SEQ ID NO.5) and primers ZmER1-MT2-R (SEQ ID NO.6) Amplification intermediate vector pCBCmT1T2 , used to obtain a fragment containing the first and second target sgRNAs. The PCR system and conditions are as follows: Template DNA (intermediate vector pCBCmT1T2≥30 ng / μL) 1.2 μL; Primer F / R: 1.2 μL each; Sterile ddH2O: 11.4 μL; 2X MCLAB enzyme (Product No.: I5HMb00): 15 μL. The temperature program of PCR is as follows: ① 98 ℃ 2min; ② 98 ℃ 10s; ③ 58 ℃ 30s; ④ 72 ℃ 30s; ⑤ 33 cycles from ② to ④; ⑥ 72 ℃ 5min; ⑦ 25 ℃ 10min. PCR products were recovered after agarose gel electrophoresis.

[0046] The base sequences of the primers required for vector construction are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0047] SEQ ID NO.5: 5'-AATAATGGTCTCAGGCGAAGAGCGCCGACAGGCGGCGGTTTTAGAGCTAGAAATAGC-3';

[0048] SEQ ID NO.6: 5'-ATTATTGGTCTCTAAACCTGCTGCTGTTGGGCTGGTTCGCTTCTTGGTGCCGC-3';

[0049] (3) Construct into backbone vector by enzyme digestion and ligation. pBUE411-Cas9 The vector and the recovered sgRNA fragment with target were used BsaI Digest and add T4 ligase to connect the vector and sgRNA fragment. The 15 μL enzyme digestion and ligation system is as follows: sgRNA fragment: 2 μL, pBUE411-Cas9 vector (≥60 ng / μL): 2 μL, 10 x NEB Buffer: 1.5 μL, BsaI Endonuclease (Product No.: #R3733S ): 1 μL, T4 ligase (Product No.: #M0202M ): 1 μL, sterile ddH2O: 6 μL.

[0050] Figure 4 Target genes are shown ZmER1 Targets (MT1 and MT2), marker genes Cas9 and bar With backbone carrier pBUE411-Cas9 Constructed expression vector pCas9-ZmER1 .

[0051] 2. Agrobacterium-mediated genetic transformation of maize

[0052] The transformation recipient is the maize inbred line X249, which has red fruit skin / red cob and belongs to P1-rr Allele type, carrying 1 ZmP1 copy.

[0053] The above constructed pCas9-ZmER1 The vector was transferred into Agrobacterium EHA105 by heat shock method, identified by PCR, and the bacterial solution was stored at -80℃ with glycerol. Freshly peeled immature embryos of inbred line X249 of about 1.5 mm were used as receptor materials. The peeled maize embryos were placed in a 2 mL plastic centrifuge tube containing 1.8 mL of suspension for no more than 1 h. About 100 immature embryos were placed in each centrifuge tube. The suspension was aspirated and the immature embryos were washed twice with new suspension. A small amount of suspension that could cover the immature embryos was retained at the bottom of the tube. Then, heat shock was performed at 43℃ for 2 min, followed by an ice bath for 1 min. The remaining washing solution at the bottom was aspirated with a pipette, and 1.0 mL of Agrobacterium infection solution was added. The tube was gently shaken for 30 s, and then left in the dark for 8 min. Next, the immature embryos and infection solution in the centrifuge tube were poured onto the co-culture medium, and the excess infection solution was aspirated with a pipette after shaking. All immature embryos were co-cultured in the dark at 23℃ for 3 days with the scutellum facing up. After the co-culture, the young embryos were transferred to the recovery medium with sterile tweezers and cultured at 28 ℃ for 14 days. During the process, it was necessary to remove the young shoots growing on the young embryos in time. After the recovery culture, the young embryos were placed on the screening medium containing 1.5 mg / L Bialaphos for 3 rounds of screening and culture, each round of screening for 2 weeks, and then transferred to the screening medium containing 2 mg / L Bialaphos for 2 rounds of screening and culture, each round of screening for 2 weeks. The resistant callus was transferred to the expansion medium and cultured in the dark at 28 ℃ for 2 weeks. Subsequently, the expanded resistant callus was transferred to the induction medium and cultured in the dark at 28 ℃ for 2 weeks. Then it was transferred to the differentiation medium at 25 ℃, 5000 lx, and light culture for 2 weeks. After the culture, the differentiated seedling clusters were separated into individual seedlings and placed in the rooting medium at 25 ℃, 5000 lx, and light culture until rooting; the seedlings were transferred to small nutrient pots for growth, and transplanted to the greenhouse after growth and survival, and the offspring seeds were harvested after 3-4 months.

[0054] 3. Detection of CRISPR / Cas9 mutation results in T0 generation plants

[0055] To determine the CRISPR / Cas9 mutation results of T0 plants, the following steps were taken:

[0056] The present invention adopts the CTAB method to extract DNA from corn leaves. The specific method is as follows: cut a seedling leaf of about 2 cm in length and put it into a 2 mL centrifuge tube filled with steel balls; immerse the centrifuge tube containing the leaf in liquid nitrogen for 5 minutes, and use a grinder to break the leaf sample; add 700 μL CTAB extraction buffer (containing 1% β-mercaptoethanol), shake vigorously to mix, preheat in a 65 ℃ constant temperature water bath for 20-30 min (take out and invert once during this period); after the centrifuge tube is cooled to room temperature, add 700 μL of chloroform: isoamyl alcohol (24:1) extraction solution, shake vigorously for 30 s and let it stand for a while at room temperature; centrifuge at 12000 rpm for 5 min at 4 ℃, take 500 μL of supernatant into a new 1.5 mL centrifuge tube; add an equal volume of isopropanol to the centrifuge tube containing the supernatant and shake gently to mix, let it stand at room temperature for about 10 min; then put the centrifuge tube containing the sample into a 4 ℃ centrifuge, centrifuge at 12000 rpm for 10 min, gently aspirate the supernatant, discard the supernatant, and retain the precipitate; add 800 μL of 75% ethanol, wash the precipitate twice, centrifuge at 10000 rpm for 5 min, and discard the supernatant; let the sample dry naturally at room temperature for 2-4 h, obtain DNA precipitate, add appropriate amount of sterile water to dissolve, shake slightly to fully dissolve DNA. DNA samples were stored at -20 ℃. DNA concentration was detected by Nanodrop and diluted to 10 ng / L for use as PCR template.

[0057] Then according to ZmER1 ( Zm00001eb014330 ) PCR primers were designed based on the gene sequence.

[0058] Detection targets: MT1 and MT2; product size: 427 bp; primer sequences are shown in SEQ ID NO.7 and SEQ ID NO.8:

[0059] SEQ ID NO.7: ZmER1-1 -TF: 5'-TGGTCCCTGATGCCAGC-3';

[0060] SEQ ID NO.8: ZmER1-1 -TR: 5'- GGTCCCCGAGCTCTATCG-3'.

[0061] Amplify using the following PCR parameters:

[0062] Reaction system: 15 μL MIX conventional PCR system, 0.5 μL forward primer, 0.5 μL reverse primer, 1 μL DNA, 5.5 μL sterile ddH2O, 7.5 μL 2x taq mix (Product No.: 10103ES);

[0063] Reaction program: Conventional PCR: 58°C annealing, extension for 30s, 32 cycles.

[0064] The PCR product is then recovered and connected to the T vector for sequencing. By sequencing the DNA sequences of the target region of multiple independent positive transformation events in the T0 generation, it is determined whether gene editing has occurred in the target region.

[0065] Two events were obtained using X249 as the transgenic plant recipient. ZmER1-1 middle, ZmER1-1 The mutation site is located in exon 3. ZmER1 181 bp of bases were deleted and 66 bp of bases were inserted at 433-613 bp of the CDS sequence; ZmER1-2 The mutation site is located in exon 3. ZmER1 The CDS sequence has a 1 bp deletion at 435 bp and a 1 bp insertion at 599 bp ( Figure 5 ).

[0066] 4. Genotyping of F2 plants

[0067] Since the T0 generation corn plants grown in the greenhouse often have uncoordinated development of female ears and male ears, in order to breed T0 generation plants and pass on the obtained gene editing type, the present invention uses wild-type pollen of the corn inbred line X249 as the above-obtained Zmer1-1 and Zmer1-2 The T0 generation plants are pollinated to obtain F1 generation seeds. The grown plants are F1 generation plants, and self-pollination is used to obtain mutants with homozygous genetic background.

[0068] The F2 progeny obtained from self-crossing of F1 plants include two types of segregation: Cas9 - positive plants (transgenic plants), the other is Cas9 -Negative plants (non-transgenic plants). In order to avoid the continuous editing of the X249 wild-type allele introduced by cross pollination by sgRNA and Cas9, thereby causing complexity in mutation types, we need to select plants from the F2 generation that do not contain the X249 wild-type allele through genotyping. Cas9 Gene, but contains T0 generation mutation type plants. After self-pollination, these plants can obtain pure and non-transgenic gene-edited seeds. The genotyping steps of F2 generation plants are as follows.

[0069] After extracting leaf DNA using the CTAB method described above, first use Cas9 The specific primers of the gene were used for PCR amplification, and the base sequences were shown in Cas9-F (SEQ ID NO.9) and Cas9-R (SEQ ID NO.10):

[0070] SEQ ID NO.9: 5'-CCCGGACAATAGCGATGT-3';

[0071] SEQ ID NO. 10: 5'-GAGTGGGCCGACGTAGTA-3'.

[0072] The PCR reaction system is the same as above; the reaction procedure is: conventional PCR: 58℃ annealing, extension 30s, 32 cycles. After the PCR products were subjected to agarose gel electrophoresis, the Cas9 -Positive plants and Cas9 -Negative plants.

[0073] Further targeting Cas9 - Positive plants, detection ZmER1 The target sites of the genes MT1 and MT2 were PCR amplified using the above primers. ZmER1-TF and ZmER1-TR ; After the PCR product is purified, it is connected to the T vector and sequenced; the genetic status of the T0 generation mutation type is determined based on the sequencing results.

[0074] Example 4 Corn ZmER1 Screening of mutants for ear rot resistance

[0075] Gene-edited corn mutant materials were used to screen for ear rot resistance, with the wild type X249 as a control.

[0076] 1. Planting and inoculation of corn genetic materials

[0077] Select the wild type with full growth and uniform grain size. Zmeer1-1 and Zmer1-2 The mutant seeds were inoculated with a randomized block design, with 1 row plot, 6 m row length, 0.6 m row spacing, and 0.2 m plant spacing. The field management was the same as the local field management measures. F. verticillioides, The first female ear of each plant was selected and injected with 2 ml of fungal suspension by needle puncture method.

[0078] 2. Phenotypic observation

[0079] Wait for wild type, Zmer1-1 and Zmer1-2 After the female ears of the mutant plants were harvested, the phenotype was investigated, the resistance level was manually identified, and the ear photos were scanned with instruments. The Mer_ana and SFB-software developed by the Chinese Academy of Agricultural Sciences were used to identify the characteristics of the ears infected by Fusarium spp. and calculate the percentage of susceptible area. At least 30 biological replicates were performed for each type of plant.

[0080] The results showed that after artificial inoculation, Zmer1-1 Compared with the wild type, the diseased area increased by 18.72% ( Figure 6 A), the difference between the two is extremely significant (p<2.22 e-16 )( Figure 6 B). After artificial inoculation, Zmer1-2 Compared with the wild type, the diseased area increased by 23.68% ( Figure 6 C), the difference was extremely significant compared with the wild type (p<2.22 e-16 )( Figure 6 D). This indicates that loss of function increases susceptibility to ear rot. ZmER1 Can positively regulate ear rot resistance.

[0081] References

[0082] Brink R, and Styles D. 1966. A collection of pericarp factors. MaizeGenet. Coop. News Lett. 40, 149–160.

[0083] Castano-Duque L, Lebar MD, Carter-Wientjes C, Ambrogio D, RajasekaranK. 2022. Flavonoids Modulate Aspergillus flavus Proliferation and AflatoxinProduction. J Fungi (Basel). 8(11), 1211.

[0084] Chen Y, Zhou M. 2009. Characterization of Fusarium graminearum isolatesresistant to both carbendazim and a new fungicide JS399-19. Phytopathology.99, 441-446.

[0085] Chopra S, Athma P, Li XG and Peterson T. 1998. A maize Myb homolog isencoded by a multicopy gene complex. Mol. Gen. Genet. 260, 372–380.

[0086] Cocciolone SM, Chopra S, Flint-Garcia SA, McMullen MD, and Peterson,T. 2001. Tissue-specific patterns of a maize Myb transcription factor areepigenetically regulated. Plant J. 27, 467–478.

[0087] Coe EH, Neuffer MG, and Hoisingto DA. 1988. The genetics of corn. InCorn and Corn Improvement, G.F. Sprague and J. Dubley, eds (Madison, WI:American Society of Agronomy), pp. 81–258.

[0088] Dong N, Lin H. Contribution of phenylpropanoid metabolism to plantdevelopment and plant-environment interactions. J Integr Plant Biol 2021;63(1):180–209.

[0089] Förster C, Handrick V, Ding Y, Nakamura Y, Paetz C, Schneider B,Castro-Falcón G, Hughes CC, Luck K, Poosapati S, Kunert G, Huffaker A,Gershenzon J, Schmelz EA, Köllner TG. 2022. Biosynthesis and antifungalactivity of fungus-induced O-methylated flavonoids in maize. Plant Physiol.188(1), 167-190.

[0090] Grotewold E, Drummond BJ, Bowen B, and Peterson T. 1994. The myb-homologous P gene controls phlobaphene pigmentation in maize floral organs bydirectly activating a flavonoid biosynthetic gene subset. Cell. 76, 543–553.

[0091] Landoni M, Puglisi D, Cassani E, Borlini G, Brunoldi G, Comaschi C,Pilu R. 2020. Phlobaphenes modify pericarp thickness in maize andaccumulation of the fumonisin mycotoxins. Sci Rep. 10(1), 1417.

[0092] Logrieco A, Mulè G, Moretti A, Bottalico A. Toxigenic Fusarium speciesand mycotoxins associated with maize ear rot in Europe. Eur J Plant Pathol 2002;108(7):597–609.

[0093] Maschietto V, Colombi C, Pirona R, Pea G, Strozzi F, Marocco A,Rossini L, Lanubile A. 2017. QTL mapping and candidate genes for resistanceto Fusarium ear rot and fumonisin contamination in maize. BMC Plant Biol. 17(1), 20.

[0094] Pilu R, Cassani E, Sirizzotti A, Petroni K, Tonelli C. 2011. Effectof flavonoid pigments on the accumulation of fumonisin B1 in the maizekernel. J Appl Genet. 52(2), 145-52.

[0095] Wang L, Chen M, Lam PY, Dini-Andreote F, Dai L, Wei Z. 2022.Multifaceted roles of flavonoids mediating plant-microbe interactions.Microbiome. 10, 233.

[0096] Wu F, Guclu H. 2012. Aflatoxin Regulations in a Network of GlobalMaize Ttrade. PLoS One. 7, e45151.

[0097] Yang C, Song G, Lim W. 2020. Effects of Mycotoxin-Contaminated Feedon Farm Animals. Journal of Hazardous Materials. 389, 122087。

Claims

1. Corn ZmER1 The use of a gene in regulating corn ear rot resistance is characterized in that: ZmER1 Gene positively regulates corn ear rot resistance, inhibits ZmER1 The expression and / or activity of the gene will make corn sensitive to ear rot and reduce its ability to resist ear rot; ZmER1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. ZmER1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that Said ZmER1 The nucleotide sequence of the gene includes a nucleotide sequence in which one or more nucleotides are substituted in the nucleotide sequence shown in SEQ ID NO.1 and which encodes the same amino acid sequence as SEQ ID NO.

2.

3. The use according to claim 1, inhibiting ZmER1 Genetic methods include gene editing and RNA interference.

4. A method for creating a susceptible mutant to corn ear rot, characterized in that: The method is the gene editing method according to claim 3, which uses CRISPR / Cas9 gene editing technology to ZmER1 The gene was subjected to site-directed mutagenesis to obtain a corn mutant susceptible to ear rot.

5. The method according to claim 4, characterized in that: Corn ZmER1 CRISPR / Cas9 vector targets MT1 and MT2 were designed at the third exon of the gene, and the DNA sequences of the targets were shown in SEQ ID NO.3 and SEQ ID NO.

4.

6. Obtained by the method of claim 5 ZmER1 Mutant gene Direction1-1 and Direction1-2 , characterized in that, As shown in Figure 5, Direction1-1 The mutation site is ZmER1 181 bp of bases were deleted and 66 bp of bases were inserted at 433-613 bp of the CDS sequence; Direction1-2 The mutation site is ZmER1 There is a deletion of 1 base "G" at the 435th bp of the CDS sequence, and an insertion of 1 base "G" between 599 bp and 600 bp.

Images