A mutant of isopropanol dehydrogenase with high catalytic activity and its application
By substituting amino acids for the active sites of isopropanol dehydrogenase, a highly catalytically active isopropanol dehydrogenase mutant is obtained, which solves the problem of low catalytic efficiency in the prior art, and achieves efficient regeneration and cost reduction of coenzyme NADH.
Patent Information
- Application Number
- CN202411383113.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-30
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2044-09-30
AI Technical Summary
In the existing coenzyme regeneration system involving isopropanol dehydrogenase, the catalytic efficiency is low, which affects the efficiency and cost of the biocatalytic method.
By substituting amino acids for the active sites of isopropanol dehydrogenase, a highly catalytically active isopropanol dehydrogenase mutant is obtained, specifically mutants such as I18L, A91G, I143A, I18L/A91G, I18L/I143A, A91G/I143A, etc., to improve the regeneration efficiency of oxidative coenzyme NAD+ reduction to reduced coenzyme NADH.
The catalytic efficiency of mutant I18L/A91G/I143A is 2.1 times that of wild type, achieving efficient regeneration cycle of coenzyme NADH, simplifying the reaction system, and reducing production costs.
Smart Images

Figure CN119082063B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical fields of enzyme engineering and genetic engineering, and particularly relates to a mutant of isopropanol dehydrogenase with high catalytic activity and its application. Background Art
[0002] Isopropanol Dehydrogenase (IDH) is an oxidoreductase that uses oxidized coenzyme NAD + or NADP + as the acceptor and acts on the CH-OH group of the donor. It is mainly responsible for catalyzing the oxidative dehydrogenation reaction of isopropyl alcohol (IPA) in vivo or in biotechnological applications, and reducing NAD + or NADP + to NADH or NADPH.
[0003] In industrial technologies, the regeneration efficiency of coenzymes often affects the efficiency of biocatalysis and production costs. How to improve the efficient regeneration cycle of coenzymes during the reaction process is an important issue to be solved in biocatalysis. Currently, coenzyme regeneration systems include those involving glucose dehydrogenase, formate dehydrogenase, lactate dehydrogenase, etc. The most commonly used glucose dehydrogenase requires glucose as a hydrogen donor. Excessive accumulation of acidic substances generated after oxidation will lead to a decrease in enzyme activity in the reaction system, and the reaction system has a complex composition, high separation and purification costs, and low industrial application value. Isopropanol dehydrogenase has the following advantages: (1) Isopropanol, as a good cosolvent, can increase the solubility of hydrophobic substrates in the reaction system without the need to introduce additional cosolvents; (2) Compared with the coenzyme regeneration system of glucose dehydrogenase, the acetone generated by the reaction has a weaker impact on the enzyme activity in the reaction system, and there is no need to adjust the pH, simplifying the process, the reaction system is relatively simple, and the separation and purification costs are relatively low; (3) The by-product acetone has a relatively low boiling point and is easy to remove, and acetone has certain industrial value and can be recycled to reduce production costs. Therefore, developing a coenzyme regeneration system involving isopropanol dehydrogenase has certain industrial application prospects. However, in the existing coenzyme regeneration systems involving isopropanol dehydrogenase, the catalytic efficiency in the coenzyme regeneration system that oxidizes isopropanol and reduces the oxidized coenzyme NAD + to generate NADH is low. Summary of the Invention
[0004] Object of the Invention: The first object of the present invention is to solve the problem of low catalytic efficiency in the coenzyme NADH regeneration system involving isopropanol dehydrogenase. By rationally designing the amino acids in the substrate-binding pocket of isopropanol dehydrogenase and performing molecular modification, a class of mutants that oxidize isopropanol and reduce the oxidized coenzyme NAD +Isopropanol dehydrogenase mutants with high catalytic activity and improved catalytic efficiency in the coenzyme regeneration system for generating NADH; The second object of the present invention is to provide the application of the isopropanol dehydrogenase mutant in reducing oxidized coenzyme NAD + to reduced coenzyme NADH.
[0005] Technical solution: The isopropanol dehydrogenase mutant with high catalytic activity of the present invention is a mutant in which at least one amino acid among the three positions of the 18th, 91st, and 143rd positions of the amino acid sequence shown in SEQ ID No. 1 is replaced; the isoleucine Ile at the 18th position is mutated to leucine Leu, the alanine Ala at the 91st position is mutated to glycine Gly, and the isoleucine Ile at the 143rd position is mutated to alanine Ala.
[0006] Preferably, the mutant includes I18L, A91G, I143A, I18L / A91G, I18L / I143A, A91G / I143A or I18L / A91G / I143A.
[0007] The wild-type isopropanol dehydrogenase is the enzyme corresponding to NCBI Gene ID: WP_020944327.1, derived from Acetobacter pasteurianus, with the amino acid sequence of SEQ ID NO. 1 and the gene sequence of: SEQ ID NO. 2.
[0008] The mutant I18L means that the isoleucine Ile at the 18th position is mutated to leucine Leu.
[0009] The mutant A91G means that the alanine Ala at the 91st position is mutated to glycine Gly.
[0010] The mutant I143A means that the isoleucine Ile at the 143rd position is mutated to alanine Ala.
[0011] The mutant I18L / A91G means that the isoleucine Ile at the 18th position is mutated to leucine Leu and the alanine Ala at the 91st position is mutated to glycine Gly.
[0012] The mutant I18L / I143A means that the isoleucine Ile at the 18th position is mutated to leucine Leu and the isoleucine Ile at the 143rd position is mutated to alanine Ala.
[0013] The mutant A91G / I143A means that the alanine Ala at the 91st position is mutated to glycine Gly and the isoleucine Ile at the 143rd position is mutated to alanine Ala.
[0014] The mutant I18L / A91G / I143A means that the isoleucine (Ile) at position 18 is mutated to leucine (Leu), the alanine (Ala) at position 91 is mutated to glycine (Gly), and the isoleucine (Ile) at position 143 is mutated to alanine (Ala).
[0015] The encoding gene of the isopropanol dehydrogenase mutant of the present invention is obtained by the following method: using the recombinant plasmid pET22b-ApIDH derived from the wild-type isopropanol dehydrogenase gene of Acetobacter pasteurianus as a template, performing PCR amplification with site-directed mutagenesis primers, and screening for the target mutant gene.
[0016] The gene of the present invention is: the gene encoding the isopropanol dehydrogenase mutant protein.
[0017] The recombinant plasmid of the present invention is: the recombinant plasmid containing the gene.
[0018] Preferably, the expression vector of the recombinant plasmid is a PET series expression vector.
[0019] The recombinant bacterium of the present invention carries the gene of the mutant or the recombinant plasmid.
[0020] Preferably, the host is Escherichia coli.
[0021] The construction method of the recombinant bacterium includes the following steps:
[0022] (1) Construct the recombinant plasmid pET22b-ApIDH: ligate the isopropanol dehydrogenase gene ApIDH with the digested plasmid pET22b to obtain the recombinant expression vector pET22b-ApIDH;
[0023] (2) Construct the recombinant bacterium E.coli BL21(DE3) / pET22b-ApIDH: thermally transfer the constructed recombinant expression vector pET22b-ApIDH into the competent Escherichia coli BL21(DE3), and culture and screen to obtain the recombinant E.coli BL21(DE3) / pET22b-ApIDH.
[0024] The application of the isopropanol dehydrogenase mutant or the recombinant plasmid or the recombinant bacterium of the present invention in reducing the oxidized coenzyme NAD + to the reduced coenzyme NADH.
[0025] The application includes the following steps: using the isopropanol dehydrogenase mutant as a catalyst, isopropanol as a substrate, and catalyzing the oxidized coenzyme NAD + to be reduced to the reduced coenzyme NADH. The catalytic process is as follows:
[0026]
[0027] Preferably, the reaction temperature of the catalysis is 20-45°C, and the pH is 6-10.
[0028] Invention mechanism: Through in-depth and extensive research, the present invention provides an isopropanol dehydrogenase, a preparation method thereof, and an application thereof. Specifically, by amplifying the isopropanol dehydrogenase gene from Acetobacter pasteurianus and using rational design to perform directed evolution modification on it, an isopropanol dehydrogenase with significantly improved catalytic efficiency is finally obtained, thereby realizing the efficient regeneration cycle of reduced coenzyme NADH.
[0029] In the present invention, using the sequence and structure information of the publicly reported isopropanol dehydrogenase, through non-redundant retrieval in databases such as NCBI, and according to principles such as protein structure similarity, conserved site analysis, and host source diversity, some potential enzyme genes are screened out. These genes are functionally expressed in an Escherichia coli expression system and then purified to obtain pure enzymes. The preferred isopropanol dehydrogenase is derived from Acetobacter pasteurianus, which has certain catalytic activity and can catalyze the regeneration of reduced coenzyme NADH.
[0030] Beneficial effects: Compared with the prior art, the present invention has the following remarkable advantages: (1) By mutating the active site of isopropanol dehydrogenase, the finally obtained mutant improves the regeneration efficiency of oxidized coenzyme NAD + reduced to reduced coenzyme NADH; (2) The catalytic efficiency of the mutant I18L / A91G / I143A is 2.1 times that of the wild-type isopropanol dehydrogenase. Description of the drawings
[0031] Figure 1 Comparison diagram of the relative activities of the isopropanol dehydrogenase mutants in Examples 1-7 for catalyzing the reduction of oxidized coenzyme NAD + to reduced coenzyme NADH;
[0032] Figure 2 Comparison diagram of the relative activities of the isopropanol dehydrogenase mutant (I18L / A91G / I143A) for catalyzing the reduction of oxidized coenzyme NAD + to reduced coenzyme NADH at different temperatures;
[0033] Figure 3 Comparison diagram of the relative activities of the isopropanol dehydrogenase mutant (I18L / A91G / I143A) for catalyzing the reduction of oxidized coenzyme NAD + to reduced coenzyme NADH at different pH values. Detailed implementation manners
[0034] The technical solution of the present invention will be further described below in conjunction with embodiments.
[0035] Example 1
[0036] 1. Construction of isopropanol dehydrogenase mutant plasmid
[0037] (1) Obtaining of pET22b-ApIDH
[0038] The wild-type gene of isopropanol dehydrogenase from Acetobacter pasteurianus was synthesized by GenScript (Suzhou) Co., Ltd. and constructed on the pET22b vector (the pET22b vector was provided by GenScript), and the vector was transformed into E. coli DH5α strain (purchased from Sangon Biotech (Shanghai) Co., Ltd.). The recombinant bacterium E. coli DH5α / pET22b-ApIDH was inoculated into a 5 mL test tube with a medium loading volume and cultured at 37 °C and 220 rpm for 12 h. After the culture was completed, the cells were centrifuged at 12,000 rpm for 1 min and the cells were collected. Using a high-purity plasmid miniprep kit, the plasmid was extracted from E. coli DH5α / pET22b-ApIDH as a template for iterative mutation to construct the plasmid pET22b-ApIDH mutant.
[0039] (2) Construction of recombinant Escherichia coli E. coli BL21(DE3) / pET22b-ApIDH mutant
[0040] The gene mutation was carried out by the method of whole plasmid PCR to obtain the target mutant gene. Taking I18L as an example, the required primers were specifically designed, and other mutants were designed according to this principle and single-point iterative mutation was carried out.
[0041] I18L upstream primer: GCAAACGGTCTCGGTAAAGCG
[0042] I18L downstream primer: CGCTTTACCGAGACCGTTTGC
[0043] The PCR system is shown in Table 1.
[0044] Table 1 PCR reaction system
[0045]
[0046] The PCR reaction conditions are shown in Table 2.
[0047] Table 2 PCR reaction conditions
[0048]
[0049]
[0050] After the PCR amplification was completed, the amplification products were detected by 0.9% agarose gel electrophoresis. The results showed that the amplification products were single bands, with sizes of about 6000 bp. The amplification products were purified and recovered using a DNA recovery and purification kit.
[0051] The purified gene fragment was digested with DpnI to remove the template and then recombined with recombinase. The recombinant products were transformed into E. coli DH5α competent cells and spread on the surface of LB solid medium containing 100 μg / mL ampicillin. They were cultured at 37 °C for 12 h, and single colonies were picked into LB liquid culture. Positive transformants successfully constructed were identified by PCR method, and the correctness of the mutation sites was verified by sequencing. After verification, after adding sterile glycerol with a final concentration of 25% to a part, they were numbered and stored at -80 °C for later use. Plasmids were extracted from a part of the bacteria using a plasmid extraction kit, and the recombinant plasmids were stored in a -20 °C refrigerator.
[0052] The successfully sequenced recombinant expression plasmid pET22b was transferred into E. coli BL21(DE3) (E. coli, purchased from Sangon Biotech (Shanghai) Co., Ltd.) as the expression host to construct the recombinant mutant expression strain E. coli BL21(DE3) / pET22b-ApIDH.
[0053] 2. Cultivation of isopropyl alcohol dehydrogenase mutant and preparation of crude enzyme solution
[0054] The successfully constructed recombinant mutant expression strain E. coli BL21(DE3) / pET22b-ApIDH was spread on a plate containing ampicillin with a final concentration of 100 μg / mL. Single colonies were picked and inoculated into 5 mL of resistant LB medium and cultured overnight at 37 °C at 200 rpm / min. They were transferred with an inoculation amount of 1% into 500 mL of resistant LB medium. When the OD 600 reached about 0.6, IPTG with a final concentration of 0.5 mM was added, and induction was carried out at 18 °C for about 14 h.
[0055] After centrifuging to obtain the bacterial cells, they were resuspended with buffer, and the cells were ultrasonically broken in an ice bath (working for 2 s, interval of 5 s, working time of 30 min). Centrifugation was carried out at 12,000 rpm / min at 4 °C for 20 min. After collecting the supernatant, it was filtered through a 0.22 μm aqueous filter head to obtain the crude enzyme solution for the reaction.
[0056] Example 2
[0057] For the A91G mutant, on the basis of Example 1, in step (2), the primers were changed and the other conditions remained unchanged. The primers are as follows:
[0058] A91G upstream primer: GTTAACAACGGGGGTATCGCG
[0059] A91G downstream primer: CGCGATACCCCCGTTGTTAAC.
[0060] Example 3
[0061] Based on Example 1, for the I143A mutant, in step (2), change the primers and keep the other conditions unchanged. The primers are as follows:
[0062] I143A upstream primer: CTGTCTAGCGCGGAAGGTCTGATC
[0063] I143A downstream primer: GATCAGACCTTCCGCGCTAGACAG.
[0064] Example 4
[0065] Based on Example 1, for the I18L / A91G mutant, use the plasmid obtained in Example 1 as the DNA template in step (2), change the primers and keep the other conditions unchanged. The primers are as follows:
[0066] I18L / A91G upstream primer: GTTAACAACGGGGGTATCGCG
[0067] I18L / A91G downstream primer: CGCGATACCCCCGTTGTTAAC.
[0068] Example 5
[0069] Based on Example 1, for the I18L / I143A mutant, use the plasmid obtained in Example 1 as the DNA template in step (2), change the primers and keep the other conditions unchanged. The primers are as follows:
[0070] I18L / I143A upstream primer: CTGTCTAGCGCGGAAGGTCTGATC
[0071] I18L / I143A downstream primer: GATCAGACCTTCCGCGCTAGACAG.
[0072] Example 6
[0073] Based on Example 1, for the A91G / I143A mutant, use the plasmid obtained in Example 2 as the DNA template in step (2), change the primers and keep the other conditions unchanged. The primers are as follows:
[0074] A91G / I143A upstream primer: CTGTCTAGCGCGGAAGGTCTGATC
[0075] A91G / I143A downstream primer: GATCAGACCTTCCGCGCTAGACAG.
[0076] Example 7
[0077] Based on Example 1, for the I18L / A91G / I143A mutant, using the plasmid obtained in Example 4 as the DNA template in step (2), changing the primers, with other conditions remaining unchanged, the primers are as follows:
[0078] I18L / A91G / I143A upstream primer: CTGTCTAGCGCGGAAGGTCTGATC
[0079] I18L / A91G / I143A downstream primer: GATCAGACCTTCCGCGCTAGACAG.
[0080] Performance test
[0081] 1. Isopropanol dehydrogenase and its mutants catalyze the reduction of oxidized coenzyme NAD + to reduced coenzyme NADH
[0082] Cultivate the corresponding engineered bacteria expressing isopropanol dehydrogenase and its mutants according to the construction methods of Examples 1 to 7, and use the obtained crude enzyme solution as the catalyst.
[0083] The reaction system is: crude enzyme solution with OD 600 = 4, 5 mM oxidized coenzyme NAD + , 10 mM isopropanol, and the reaction buffer is 100 mM Tris-HCl buffer with pH = 8. Control the reaction temperature at 30 °C by water bath for 10 min, and use a microplate reader to detect the change in the absorbance value of the product NADH at 340 nm within 10 min to compare the relative activities.
[0084] The test results are shown in Table 3 and Figure 1 .
[0085] Table 3 Reduction of isopropanol dehydrogenase to generate reduced coenzyme NADH
[0086]
[0087]
[0088] By Figure 1It can be seen that the catalytic conversion rates of all mutants are higher than that of the wild-type isopropanol dehydrogenase. In particular, the catalytic efficiency of mutant I18L / A91G / I143A is 2.1 times that of the wild-type isopropanol dehydrogenase.
[0089] 2. Optimal temperature for the mutant isopropanol dehydrogenase (I18L / A91G / I143A) to catalyze the reduction of oxidized coenzyme NAD + to reduced coenzyme NADH
[0090] Cultivate the corresponding engineered bacteria expressing isopropanol dehydrogenase and its mutants according to the construction in Example 7, and use the obtained crude enzyme solution as the catalyst.
[0091] The reaction system is: crude enzyme solution with OD600 = 4, 5 mM oxidized coenzyme NAD + , 10 mM isopropanol, and the reaction buffer is 100 mM Tris-HCl buffer with pH = 8. Control the reaction temperature at 20 °C, 25 °C, 30 °C, 35 °C, 40 °C, 45 °C through a water bath, react for 10 min, and use an enzyme-labeling instrument to detect the change in the absorbance value of the product NADH at 340 nm within 10 min to compare the relative activities. The test results are shown in Figure 2 .
[0092] It can be seen from Figure 2 that the best catalytic effect is observed at 30 °C, and the enzyme activity is good within the range of 20 - 45 °C.
[0093] 3. Optimal pH for the mutant isopropanol dehydrogenase (I18L / A91G / I143A) to catalyze the reduction of oxidized coenzyme NAD + to reduced coenzyme NADH
[0094] Cultivate the corresponding engineered bacteria expressing isopropanol dehydrogenase and its mutants according to the construction in Example 7, and use the obtained crude enzyme solution as the catalyst.
[0095] The reaction system is: crude enzyme solution with OD600 = 4, 5 mM oxidized coenzyme NAD + , 10 mM isopropanol, and the reaction buffer is 100 mM potassium phosphate buffer with pH = 6, 100 mM potassium phosphate buffer with pH = 6.5, 200 mM potassium phosphate buffer with pH = 7, 200 mM potassium phosphate buffer with pH = 7.5, 100 mM Tris-HCl buffer with pH = 8, 100 mM Tris-HCl buffer with pH = 8.5, 50 mM Tris-HCl buffer with pH = 9, 50 mM boric acid buffer with pH = 10. Control the reaction temperature at 30 °C through a water bath, react for 10 min, and use an enzyme-labeling instrument to detect the change in the absorbance value of the product NADH at 340 nm within 10 min to compare the relative activities. The test results are shown inFigure 3 。
[0096] It can be seen from Figure 3 that different pH values have a significant impact on the catalytic activity of ApIDH. The best catalytic effect was observed at pH 8.0. In addition, the enzyme catalytic activity is relatively high in the range of pH 7-9.
Claims
1. A mutant isopropanol dehydrogenase with high catalytic activity, characterized in that, The mutant is obtained by substituting at least one amino acid at positions 18, 91, and 143 in the amino acid sequence shown in SEQ ID No. 1; isoleucine (Ile) at position 18 is mutated to leucine (Leu), alanine (Ala) at position 91 is mutated to glycine (Gly), and isoleucine (Ile) at position 143 is mutated to alanine (Ala).
2. The isopropanol dehydrogenase mutant according to claim 1, characterized in that, The mutants are I18L, A91G, I143A, I18L / A91G, I18L / I143A, A91G / I143A, or I18L / A91G / I143A.
3. A gene encoding the isopropanol dehydrogenase mutant protein according to any one of claims 1 to 2.
4. A recombinant plasmid containing the gene according to claim 3.
5. The recombinant plasmid according to claim 4, characterized in that, The expression vector of the recombinant plasmid is a PET series expression vector.
6. A recombinant bacterium carrying the gene of the mutant according to claim 3 or the recombinant plasmid according to claim 4.
7. The recombinant bacterium according to claim 6, wherein The host is Escherichia coli.
8. Use of the isopropanol dehydrogenase mutant according to claim 1 or 2, the recombinant plasmid according to claim 4, or the recombinant bacterium according to claim 6 in reducing oxidized coenzyme NAD + to reduced coenzyme NADH.
9. The application according to claim 8, wherein The application includes the following steps: using an isopropanol dehydrogenase mutant as a catalyst, and using oxidized coenzyme NAD + and isopropanol as substrates to catalyze the formation of reduced coenzyme NADH and by-product acetone.
10. The application according to claim 9, wherein The reaction temperature catalyzed is 20 to 45 °C, and the pH is 6 to 10.
Citation Information
Patent Citations
2-xylitol dehydrogenase mutant and application thereof
CN117757765A
D-amino acid oxidase mutant and application thereof in preparation of L-glufosinate-ammonium
CN118652867A