A method for identifying long non-coding RNA interacting RNA molecules

Abstract

The present invention discloses a method for identifying long-chain non-coding RNA interacting RNA molecules, and relates to the field of biotechnology. The method for identifying long-chain non-coding RNA interacting RNA molecules of the present invention has the following advantages: (1) Compared with the lncRNA interacting RNA molecule identification method in the prior art, the sarID of the present invention does not rely on cross-linking and immunoprecipitation, avoiding the problems of high false positive rate, low specificity and resolution caused by cross-linking and immunoprecipitation. (2) The method for identifying long-chain non-coding RNA interacting RNA molecules of the present invention can be used to identify interacting RNA molecules of specific lncRNA molecules in living cells; (3) The method for identifying long-chain non-coding RNA interacting RNA molecules of the present invention simplifies the experimental process, can save time and reduce costs; (4) The method for identifying long-chain non-coding RNA interacting RNA molecules of the present invention can be extended to identify interacting RNA molecules of other types of RNA, and has a wide range of applications.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for identifying long-chain non-coding RNA interacting RNA molecules. Background Art

[0002] RNA molecules can not only carry genetic information, but also play catalytic and regulatory functions. Studies on the Human Genome Project have shown that protein coding sequences only account for 2% of the genome, while the remaining 98% are non-coding nucleic acid sequences. After transcription, non-coding nucleic acid sequences produce a large number of non-coding RNA (ncRNA) molecules. These molecules, which were considered "junk" RNA in the early days, were later confirmed to be molecules with important functions in cells and participated in the regulation of various physiological and pathological processes. Among these ncRNAs, about 80% are a type of gene called long non-coding RNA (lncRNA). lncRNA is a type of gene transcription product with a length greater than 200nt and no protein coding ability. lncRNA has an mRNA-like structure, and its expression has strong temporal and spatial specificity. Thanks to the rapid development of bioinformatics and gene functional omics, people have a deeper understanding of the function and mechanism of lncRNA. lncRNA molecules can interact with RNA, protein and DNA to regulate gene expression at the epigenetic modification, transcription and post-transcription levels, translation and post-translation levels, thereby participating in various life activities of organisms.

[0003] The mechanism of action of lncRNA is extremely complex. It can interact with different types of molecules in the cell, resulting in its diverse functions. For example, some lncRNAs can interact with chromatin, recruit proteins to bind to chromatin, and then activate or inhibit transcription. Some lncRNAs have protein binding domains, which can act as protein scaffolds to provide a "platform" for the formation and function of protein complexes. Some lncRNAs can also interact with RNA molecules containing microRNA complementary sequences, acting as adsorption sponges for microRNAs, thereby regulating the translation level of mRNA molecules. Despite this, there are still many molecular mechanisms of lncRNA action that have not been elucidated.

[0004] At present, the research on the mechanism of lncRNA mainly focuses on identifying their binding proteins and genomic binding sites. Little is known about the RNA molecules they bind to, especially RNA molecules other than microRNA. This situation is largely due to the lack of effective technical methods. At present, there are mainly the following methods to identify RNA molecules that bind to lncRNA:

[0005] 1. Combining biochemical crosslinking and subsequent high-throughput sequencing, RNA-RNA interactions can be detected on a genome-wide scale. However, these methods are inefficient and insensitive, making them unsuitable for identifying RNA interacting molecules of specific lncRNAs. For example: (1) CLASH (crosslinking, ligation and sequencing of hybrids): RNA-protein complexes are formed by crosslinking, and affinity chromatography is performed under denaturing conditions to capture interacting RNA-RNA hybrids using affinity-tagged proteins. After RNA is separated and purified, the corresponding sequence information can be obtained by combining sequencing technologies such as RNA-seq. As one of the experimental techniques for studying RNA-RNA molecular interactions, CLASH is mainly used to identify the interaction between miRNA and its target mRNA. Its disadvantages are: The limitation of CLASH is that it requires overexpression of a single RNA binding protein (RBP), which may destroy the RNA interaction network in the natural state in the cell. In addition, RNA proximal ligation in solution can also lead to a large number of false positives. Finally, due to the lack of a step to enrich chimeric RNA fragments, the proportion of effective sequencing data is low (2%). (2) RIC-Seq (RNA in situ conformation sequencing): This technology is mainly used to systematically analyze the in situ higher-order structure and target of RNA. After the cells are cross-linked with formaldehyde, micrococcal nuclease (MNase) is used to randomly cut the RNA, and the free 3' end after cutting is dephosphorylated to expose the hydroxyl group. The 3' end of the RNA is then labeled with pCp-biotin, and then the 3' end phosphate group in pCp-biotin is removed with FastAP alkaline phosphatase and the 5' end phosphate group is added with T4 polynucleotide kinase (PNK). RNA fragments are then obtained through proximal ligation. After enrichment and purification with streptavidin magnetic beads, sequencing analysis can be performed. RIC-seq can not only detect the higher-order structure of RNA, but also accurately identify the targets of various non-coding RNAs. Based on RIC-Seq, Capture RIC-Seq (CRIC-Seq) was further developed. By taking advantage of the characteristics of highly specific antibodies and adding an immunoprecipitation step, this technology can achieve high-throughput analysis of in situ RNA-RNA interaction sites mediated by specific RBPs. However, the disadvantages are: RIC-Seq and CRIC-Seq cannot avoid the false positive problem caused by cross-linking and proximal connection. The experimental steps are cumbersome, and the technology relies on the effective enrichment of magnetic beads, so some lncRNAs with low abundance may be missed.This technology is mainly used in the study of RNA structure and function, but it is currently extremely challenging to transform the RNA spatial location information obtained by RIC-Seq into a visualized RNA high-level structure, which limits the promotion of this technology to a certain extent. (3) MARIO (mapping RNA interactome in vivo): cells are double-crosslinked using chemical crosslinkers EGS and formaldehyde to fix protein-mediated RNA-RNA interactions, and then all proteins in the cell lysate are biotin-labeled, followed by enrichment with streptavidin magnetic beads for proximal ligation, library construction, and sequencing. Its disadvantages are: MARIO has many limitations: First, long-term EGS (45min) and formaldehyde (20min) cross-linking will induce large protein aggregates, resulting in spatial proximity of RNA under non-physiological conditions and the generation of false positives; second, the efficiency of protein biotinylation in cell lysate is low, resulting in many protein-RNA complexes that cannot be effectively enriched by magnetic beads; third, MARIO discards the insoluble chromatin portion in the cell lysis step, which will exclude many chromatin-related RNA-RNA interactions; fourth, MARIO also performs proximal ligation in solution rather than in situ, resulting in a large number of false-positive RNA-RNA interactions.

[0006] 2. In vitro methods for identifying specific lncRNA interacting molecules, such as RNA-RNA pulldown, also have great limitations. RNA-RNA pull-down is one of the main experimental methods for detecting the interaction between RNA and its target RNA. RNA-RNA pull-down uses in vitro transcription to label biotin RNA probes, which are then incubated with cytoplasmic extracts to form RNA-RNA complexes. The complex can bind to streptavidin-labeled magnetic beads to separate it from other components in the incubation solution. After the complex is eluted, qRT-PCR experiments are used to detect whether specific RNA interacts with the target RNA. Disadvantages: Due to the secondary structure of RNA, antisense oligonucleotides may not be able to bind to certain RNA sequences. Therefore, the design and validation of probes is a challenging and time-consuming step. Using in vitro transcribed RNA as "bait" cannot accurately restore the structure and modification of the RNA in vivo. In addition, in vitro identification methods also produce non-specific binding.

[0007] 3. In vivo methods, such as CHRIP and RAP, rely on cross-linking to promote effective separation, but cross-linking may introduce bias and obscure physiological interactions. (1) CHRIP (Chromatin Isolation by RNA Purification): By designing a biotin-labeled target RNA complementary probe set, which is combined with streptavidin magnetic beads, the target RNA is specifically bound while specifically capturing the DNA chromosome fragments that RNA binds to and regulates, as well as RNA-binding proteins (RBPs) involved in transcriptional regulation. (That is, the RNA complementary probe pulls the target nuclear RNA and the bound regulatory DNA and RBPs) Disadvantages: The operation process requires cross-linking, and the false positive problem caused by cross-linking cannot be avoided. (2) RAP (RNA Antisense Purification): The target RNA that is hybridized is captured by a biotin-labeled antisense oligonucleotide probe, and the endogenous RNA and the proteins and nucleic acids bound to it can be obtained after purification. (That is, the RNA complementary probe pulls the target RNA and the bound regulatory RNA and RPBs) Disadvantages: RAP is not suitable for the study of RNA with low expression levels. The operation process still requires cross-linking, and the false positive problem caused by cross-linking cannot be avoided.

[0008] 4. Recently developed HyPro-seq: HyPro target RNA proximity labeling (Hybridization-proximity labeling) is a spatial interaction omics research technology that provides strong support for studying the composition of biomolecular condensates. Traditional methods are difficult to study interactions at the spatial level and multivalent weak interactions, while HyPro target RNA proximity labeling technology relies on an enzyme with labeling function, catalase APEX2, which can biotinylate neighboring biomolecules at the living cell level. The HyPro enzyme is an active fusion protein composed of APEX2 and DIG binding protein connected by a short linker. DIG-binding protein is used to bind to DNA probes with DIG modification, and DIG-DNA probes are one or more complementary DNA sequences designed according to the target RNA; APEX2 is free in a certain spatial range, similar to the hook bait pulled by a fishing rod. Under the catalysis of H2O2, it can activate biotin and covalently link it to adjacent RNA and proteins. Therefore, this technology can specifically identify the target RNA and label the RNA and proteins in the adjacent area with biotin. These biotinylated RNA and proteins can be enriched by streptavidin-coupled magnetic beads, and then analyzed and identified by sequencing and mass spectrometry. Disadvantages: HyPro-seq uses the APEX2 enzyme to biotinylate RNA that co-localizes with the transcript of interest, but due to the high toxicity of H2O2, this method has great limitations in its application in vivo.

[0009] In summary, the existing in vitro and in vivo techniques for RNA binding to RNA all utilize affinity capture of target RNA, and the immunoprecipitation steps are cumbersome. The main defects of these techniques are high false positive rates, and specificity and resolution also need to be further improved. Summary of the invention

[0010] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a method for identifying long non-coding RNA-interacting RNA molecules.

[0011] To achieve the above object, the technical solution adopted by the present invention is:

[0012] In a first aspect, the present invention provides a method for identifying long non-coding RNA interacting RNA molecules, comprising the following steps:

[0013] (1) Design sgRNA targeting the target lncRNA;

[0014] (2) constructing lentiviral vectors expressing dPSPS protein and MCP-APOBEC1 fusion protein respectively;

[0015] (3) Infecting target cells with lentivirus expressing sgRNA, dPSPS protein, and MCP-APOBEC1 fusion protein, and screening the target cells to construct a stable expression cell line;

[0016] (4) inducing the stable expression cell line and extracting cellular RNA;

[0017] (5) Performing sequencing analysis on the RNA of step (4) to identify RNA with a C to U mutation site, and determining the lncRNA interacting RNA.

[0018] The inventors of this application have provided a method for identifying long non-coding RNA interacting RNA molecules through a large number of experiments, called sarID (sgRNA scaffold assisted RNA-RNA interaction detection). The sarID of the present invention combines RNA targeting based on Cas13, modification of sgRNA, and proximal RNA editing. This method is simple and effective, avoiding the defects caused by cross-linking and immunoprecipitation (IP) operations, and the identified molecules are RNA molecules that interact with specific lncRNAs in the natural state of living cells.

[0019] After a large number of experiments, the inventors of this application screened out a truncated dpspCas13b (dPSPS) with higher affinity for the target transcript (lncRNA). Through the exploration of the labeling position, it was found that inserting the MS2 aptamer into the sgRNA tetraloop region can effectively recruit additional protein effectors for the Cas13-sgRNA complex, and this modification does not affect the RNA binding function of dCas13. Finally, using APOBEC1 for C→U editing, a dCas13-guided proximal labeling method was successfully created.

[0020] The present invention stably expresses truncated dpspCas13b driven by an inducible promoter, modified sgRNA, and MCP-fused APOBEC1 in cells through lentivirus. By guiding the dCas13 complex to target lncRNA, the recruited APOBEC1 will mediate C→U editing in the proximal transcript, thereby marking the interacting transcript as a C→U site. After adding doxycycline (Dox) to induce dCas13 expression for 48 hours, RNA was extracted from the cells and RNA-seq was performed. After removing the editing sites and known single nucleotide polymorphisms (SNPs) present in the control group cells, the SAILOR analysis method was used to identify and quantify the C→U editing sites in the transcripts.

[0021] As a preferred embodiment of the method for identifying long non-coding RNA interacting RNA molecules of the present invention, in step (1), the sgRNA includes a Guide sequence and a functional sequence; the functional sequence is shown in SEQ ID NO.1.

[0022] As a preferred embodiment of the method for identifying long non-coding RNA interacting RNA molecules of the present invention, the Guide sequence is complementary to the target lncRNA.

[0023] As a preferred embodiment of the method for identifying long non-coding RNA interacting RNA molecules of the present invention, in step (2), the nucleotide sequence of the backbone plasmid expressing the dPSPS protein is shown as SEQ ID NO.2; the amino acid sequence of the dPSPS protein is shown as SEQ ID NO.3, and the nucleotide sequence is shown as SEQ ID NO.4.

[0024] As a preferred embodiment of the method for identifying long non-coding RNA interacting RNA molecules of the present invention, in step (2), the backbone plasmid expressing the MCP-APOBEC1 fusion protein includes a CMV promoter sequence, a 3X Flag tag and a Hygromycin screening marker; the amino acid sequence of the MCP protein is shown in SEQ ID NO.5, and the nucleotide sequence is shown in SEQ ID NO.6; the amino acid sequence of the APOBEC1 protein is shown in SEQ ID NO.7, and the nucleotide sequence is shown in SEQ ID NO.8.

[0025] As a preferred embodiment of the method for identifying long non-coding RNA interacting RNA molecules of the present invention, in step (3), the screening uses puromycin, blasticidin and hygromycin.

[0026] As a preferred embodiment of the method for identifying long non-coding RNA-interacting RNA molecules of the present invention, in step (4), doxycycline is used to induce the expression of dPSPS protein in the stable cell line.

[0027] In a second aspect, the present invention further provides a kit for detecting long non-coding RNA-interacting RNA molecules, the kit comprising sgRNA targeting a target lncRNA, a dPSPS protein expression plasmid, and an MCP-APOBEC1 fusion protein expression plasmid;

[0028] The sgRNA includes a Guide sequence and a functional sequence; the functional sequence is shown in SEQ ID NO.1; the amino acid sequence of the dPSPS protein is shown in SEQ ID NO.3; the amino acid sequence of the MCP protein is shown in SEQ ID NO.5; and the amino acid sequence of the APOBEC1 protein is shown in SEQ ID NO.7.

[0029] In a third aspect, the present invention applies the method for identifying long non-coding RNA interacting RNA molecules to study or identify lncRNA interacting RNA molecules in cells.

[0030] In a fourth aspect, the present invention uses the kit to study or identify lncRNA-interacting RNA molecules in cells.

[0031] As a preferred embodiment of the application of the present invention, the cells are living cells.

[0032] Beneficial effects of the present invention: The present invention provides a method for identifying long-chain non-coding RNA interacting RNA molecules, which has the following advantages: (1) Compared with the lncRNA interacting RNA molecule identification method in the prior art, the sarID of the present invention does not rely on cross-linking and immunoprecipitation, avoiding the problems of high false positive rate, low specificity and resolution caused by cross-linking and immunoprecipitation. (2) The method for identifying long-chain non-coding RNA interacting RNA molecules of the present invention can be used to identify the interacting RNA molecules of specific lncRNA molecules in living cells; (3) The method for identifying long-chain non-coding RNA interacting RNA molecules of the present invention simplifies the experimental process, can save time and reduce costs; (4) The method for identifying long-chain non-coding RNA interacting RNA molecules of the present invention can be extended to identify the interacting RNA molecules of other types of RNA, and has a wide range of applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The expression strategy and analysis method of sarID, where a is the scheme of the sarID method; b is the schematic diagram of dPSPS, MCP-APOBEC1 and sgRNA expression vectors; c is the sarID RNA-seq and C-to-U editing analysis process.

[0034] Figure 2 This is the structural diagram of sgRNA.

[0035] Figure 3 This is a diagram of the Teton-3G vector structure.

[0036] Figure 4 sarID does not significantly affect the transcriptome of cells.

[0037] Figure 5 To identify transcripts interacting with NEAT1 in 293T cells using sarID.

[0038] Figure 6 Validation of NEAT1-interacting mRNA.

[0039] Figure 7 To identify the interacting RNAs of lncRNAXIST and MALAT1 in living cells using sarID.

[0040] Figure 8 To use sarID to identify the interacting RNAs of lncRNANBR2 and DANCR in living cells, and to investigate the repeatability of sarID. DETAILED DESCRIPTION

[0041] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention.

[0042] Example 1

[0043] like Figure 1 As shown, the present invention provides a method for identifying long non-coding RNA interacting RNA molecules (called sarID), and the method is specifically as follows:

[0044] 1. Design of guide RNA (sgRNA) and plasmid construction

[0045] 1.1sgRNA design and construction:

[0046] 1.1.1 Design and synthesize sgRNA containing the following structure: the sequence of the target lncRNA (Guide sequence) and the functional sequence; the functional sequence includes a direct repeat sequence (Direct repeat), 8 MS2 stem loop sequences and multiple connection sequences, and the nucleotide sequence of the functional sequence is shown in SEQ ID NO.1. The specific structure of sgRNA is as follows Figure 2 shown.

[0047] 1.1.2 Construction of sgRNA expression vector, double restriction digestion of PLKO.1-Puro vector and synthetic fragment at 37℃ for 1h. After separation and purification by agarose gel electrophoresis, the NEB endonuclease kit (NEB's R3552S and R3101S) was used to cut the gel and recover the digested vector. The enzyme digestion system is shown in Table 1.

[0048] Table 1

[0049]

[0050]

[0051] 1.1.3 Connect sgRNA to the restriction endonuclease vector (Takara's DNA Ligation Kit Ver.2.1, Cat. No. 6022). The reaction conditions are 16°C, 30 min. The connection system is shown in Table 2.

[0052] Table 2

[0053]

[0054] 1.1.4 Transformation: Add all the ligation products in step 1.1.3 to 50 μL stbl3 competent cells, mix well and place on ice for 20 min, heat activate at 42°C for 1 min, and place on ice for 2 min. Add 300 μL SOC medium and culture in a shaker at 37°C for 1 h.

[0055] 1.1.5 Plate coating: Take 100 μL of the bacterial solution cultured for 1 hour in step 1.1.3 and evenly inoculate it on the LB plate containing ampicillin, and place the plate in a 37°C incubator for overnight culture.

[0056] 1.1.6 Select a single colony on the plate and perform colony PCR. After 1% agarose gel electrophoresis, select the bacterial solution corresponding to the single bright band for sequencing confirmation.

[0057] 1.1.7 Use a plasmid extraction kit to extract the plasmid from the bacterial solution with the correct sequencing sequence, measure its concentration, and store it at -40℃ for later use.

[0058] 1.2 Construction of plasmid expressing dPSPS protein

[0059] The amino acid sequence of the dPSPS protein is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.4.

[0060] 1.2.1PCR amplification of dPSPS fragment;

[0061] The upstream primer for PCR amplification is cgacgcgtcttaagcgctagcATGAACATCCCCGCTCTGG; the downstream primer is ggcggccgcggtaccgctagcATCCTCTTTGGACACGATGTCG. The reaction system is shown in Table 3.

[0062] Table 3

[0063]

[0064] The reaction procedure is shown in Table 4.

[0065] Table 4

[0066]

[0067] 1.2.2 Perform agarose gel electrophoresis on the amplified PCR product and excise the gel for recovery.

[0068] 1.2.3 Connect dPSPS to Teton-3G vector (pCDH-CB-TRE3G-MCS-EF1a-3G-P2A-BSD) by Gibson Assembly. The nucleotide sequence of the Teton-3G vector is shown in SEQ ID NO.2 and the structure is shown in Figure 3 The reaction conditions were 37°C, 40 min. The reaction system was shown in Table 5.

[0069] Table 5

[0070]

[0071]

[0072] 1.2.4 Transformation: Add all the ligation products in step 1.2.3 to 50 μL stbl3 competent cells, mix well and place on ice for 20 min, heat activate at 42°C for 1 min, and place on ice for 2 min. Add 300 μL SOC medium and culture in a shaker at 37°C for 1 h.

[0073] 1.2.5 Plate coating: Take 100 μL of the bacterial solution cultured for 1 hour in step 1.2.4 and evenly inoculate it on the LB plate containing ampicillin, and place the plate in a 37°C incubator for overnight culture.

[0074] 1.2.6 Select a single colony on the plate and perform colony PCR. After 1% agarose gel electrophoresis, select the bacterial solution corresponding to the single bright band for sequencing confirmation.

[0075] 1.2.7 Use a plasmid extraction kit to extract the plasmid from the bacterial solution with the correct sequencing sequence, measure its concentration, and store it at -40℃ for later use.

[0076] 1.3 Construction of plasmid expressing MCP-APOBEC1 fusion protein

[0077] The amino acid sequence of the 3xFlag MCP protein is shown in SEQ ID NO.5, and the nucleotide sequence is shown in SEQ ID NO.6; the amino acid sequence of the APOBEC1 protein is shown in SEQ ID NO.7, and the nucleotide sequence is shown in SEQ ID NO.8.

[0078] 1.3.1 Use PCR to amplify MCP and APOBEC1 fragments respectively.

[0079] Amplification primers are as follows:

[0080] 3xFlag MCP-F: attcgaatttaaatcggatccATGGACTACAAAGACCATGACGG;

[0081] 3xFlag MCP-R: ggtTCTAGAATCCGCGTAGATGCCG;

[0082] APO-F: tctacgcggattctagaACCGGTGGTGGCGGATCG;

[0083] APO-R: gatccttgcggccgcggatccTTACTTCAGGCCTGTGGCCC;

[0084] The specific operation steps are as shown in 1.2.1.

[0085] 1.3.2 Perform agarose gel electrophoresis on the amplified PCR products and recycle the gel.

[0086] 1.3.3 3xFlag MCP and APOBEC1 were sequentially connected to the same vector (pCDH-CMV-MCS-EF1α-Hygro, with CMV promoter sequence, 3X Flag tag and Hygromycin selection marker, purchased from System Biosciences) by homologous recombination. The reaction conditions were 37°C, 40 min. The reaction system is shown in Table 6.

[0087] Table 6

[0088]

[0089]

[0090] 1.3.4 Transformation: Add all the ligation products in step 1.3.3 to 50 μL stbl3 competent cells, mix well and place on ice for 20 min, heat activate at 42°C for 1 min, and place on ice for 2 min. Add 300 μL SOC medium and culture in a shaker at 37°C for 1 h.

[0091] 1.3.5 Plate coating: Take 100 μL of the bacterial solution cultured for 1 hour in step 1.3.4 and evenly inoculate it on the LB plate containing ampicillin. Place the plate in a 37°C incubator and culture overnight.

[0092] 1.3.6 Select a single colony on the plate and perform colony PCR. After 1% agarose gel electrophoresis, select the bacterial solution corresponding to the single bright band for sequencing confirmation.

[0093] 1.3.7 Use a plasmid extraction kit to extract the plasmid from the bacterial solution with the correct sequencing sequence, measure its concentration, and store it at -40℃ for later use.

[0094] 2. Preparation of Lentiviral Packaging Plasmid

[0095] 2.1 The psPAX2 and pMD2G plasmids were transferred into stbl3 competent cells, and then inoculated into 200 mL of LB medium containing ampicillin (the final concentration of ampicillin was 100 mg / L), and cultured at 37°C for 12 to 16 h.

[0096] 2.2 Collect the culture medium in a 50 mL centrifuge tube, centrifuge at 5000 rpm for 5 min, discard the supernatant, and use the precipitate for plasmid extraction.

[0097] 2.3 Measure the plasmid concentration, mix the lentiviral packaging plasmids in a ratio of psPAX2:pMD2G of 3:1, and store at -40℃ for later use.

[0098] 3. Infecting Cells

[0099] 3.1 Inoculate HEK-293T cells in a 6 cm cell culture dish. When the cell density reaches 90% on the second day, discard the complete medium for cell growth (DMEM containing 10% FBS), add 1 mL of 37°C DMEM containing 5% FBS, and place in a 37°C incubator for 30 min.

[0100] 3.2 Add 1 μg each of sgRNA, dPSPS protein expression plasmid, and MCP-APOBEC1 fusion protein expression plasmid to a 1.5 mL EP tube. Then add 3 μL of packaging plasmid (psPAX2: pMD2G = 3:1), add Opti-MEM to a total volume of 100 μL, mix thoroughly, and let stand at room temperature for 5 minutes.

[0101] 3.3 Take 24 μL PEI into a 1.5 mL EP tube and add Opti-MEM to make the total volume 100 μL. Mix thoroughly and let stand at room temperature for 5 minutes.

[0102] 3.4 After fully mixing the mixed plasmid solution in step 3.2 and the PEI dilution solution in step 3.3, let stand at room temperature for 15 minutes.

[0103] 3.5 Add the mixture in step 3.4 evenly into the HEK-293T cells. After culturing at 37°C for 5 h, discard the liquid in the culture dish and add 4 mL of complete culture medium preheated at 37°C.

[0104] 3.6 48 hours after transfection, collect the virus culture medium in a 15mL centrifuge tube and centrifuge at 3500rpm for 5 minutes. Take the supernatant, filter it through 0.45μm, and add it dropwise to HEK-293T cells with a density of about 60% for infection. At the same time, set up a blank control without adding virus culture medium. After 24 hours of infection, add 5mL of complete culture medium preheated at 37℃.

[0105] 3.7 After 48 hours, the cells were passaged and screened using complete medium containing a final concentration of 2 μg / mL puromycin, 20 μg / mL blasticidin, and 500 μg / mL hygromycin.

[0106] 4. Add DOX to induce and harvest cells for sequencing

[0107] 4.1 Add Doxcycline at a final concentration of 2 μg / mL to the stable strain after antibiotic selection and induce culture for 48 hours.

[0108] 4.2 Extract cellular RNA using TRIZOL method.

[0109] 4.3 Sequencing and analysis of RNA.

[0110] The specific analysis process is as follows Figure 1 c, specifically: the fastp tool (v0.22.0 version) was used to remove the adapter sequence and low-quality read fragments. In the read alignment stage, the STAR 2-pass mode (v2.7.8a version) was used to map the read fragments to the hg38 reference genome. After that, samtools was used to remove the unaligned read fragments, and the aligned read fragments were sorted according to the coordinates. Next, the featureCounts tool (v2.0.3 version) was used to quantify the gene-level expression, and edgeR was used to perform differential analysis on non-repeated samples. During the differential analysis, genes with count values ​​less than 5 in both the control group and the experimental group and genes with total count values ​​less than 15 were filtered out. The dispersion was calculated by the generalized linear model (glmLRT) to determine the degree of expression difference of each gene. Finally, genes with FDR<0.05 and |logFC|>1 were considered differentially expressed genes. The SAILOR tool (version 1.2.0) was used to identify C-to-U editing sites, hg38 was used as the reference genome, and the default parameter "ct:true" was set. To ensure accuracy, we excluded known SNPs (dbSNP, version v151) and sites with betaScore lower than 0.5. Subsequently, the annotator tool (version v0.14.2) was used to provide annotation information for the identified sites. Next, the bedtools software was used to filter out the SNP sites in the control group that corresponded to the experimental group. This filtering process was based on multiple criteria, including: betaScore>0.99, mutation read count>1, editing rate>0.05, and total read count>10. In addition, GO and pathway enrichment analysis was performed using an online tool (https: / / www.bioinformatics.com.cn / ).

[0111] Example 2: Evaluation of sarID method performance

[0112] 1. NEAT1 is a long non-coding RNA molecule, and its mechanism of action involves a variety of biological processes. This example uses the sarID method of Example 1 to identify RNA molecules that interact with NEAT1 and evaluate the performance of the sarID method.

[0113] The target sequence for NEAT1 (GGUUUUCAGAUCACACAUGUAGUAAAGGCA) was predicted by online software (https: / / cas13design.nygenome.org / ), and an artificial sequence that did not target any gene was used as a control target sequence (GUAAUGCCUGGCUUGUCGACGCAUAGUCUG). According to the target sequence, the primer sequence (NEAT1-F: CACCGGTTTTCAGATCACACATGTAGTAAAGGCA; NEAT1-R: CAACTGCCTTTACTACATGTGTGATCTGAAAACC) was synthesized and cloned into the expression plasmid of the modified sgRNA. After lentivirus infection of 293T cells using the method of Example 1, the cells were screened with complete medium containing a final concentration of 2 μg / mL puromycin, 20 μg / mL Blasticidin and 500 μg / mL Hygromycin to obtain a stable cell line. After the stable cell lines were induced with Doxcycline at a final concentration of 2 μg / mL for 48 h, the cells were collected, RNA was extracted, and RNA-seq sequencing and analysis were performed.

[0114] The results are as follows Figure 4 As shown, in this example, a sarID stable expression 293T cell line targeting lncRNA NEAT1 was constructed, and a sarID stable expression 293T cell line expressing non-target sgRNA was constructed as a control. Western blot detection showed that the expression of each component of sarID was normal, including the expression of dPSPS and MCP-APOBEC1, which were comparable and consistent in the control group and the experimental group ( Figure 4 a). RNA-seq differentially expressed gene analysis showed that in the Non control group and NEAT1 experimental group cells, after tetracycline induced sarID expression, the transcriptomes of the two cells did not change significantly, and did not cause large-scale changes in the transcriptome ( Figure 4 b and c), indicating that sarID overexpression does not affect the transcriptome.

[0115] The results are as follows Figure 5As shown, RNA-seq sequencing showed that after overexpression of sarID targeting NEAT1, there were obvious C-to-U RNA editing events in the transcriptome ( Figure 5 a). Compared with the control group, the C-to-U editing ratio of cells in the NEAT1 experimental group was significantly increased ( Figure 5 b) In terms of the specific editing sites and the genes to which the sites belong, the NEAT1 experimental group also had little overlap with the Non control group, suggesting that these editing sites are not random but should be mediated by specific targeted sgRNAs ( Figure 5 c). The editing sites of NEAT1 are enriched in the 3'UTR region of the target RNA, suggesting that NEAT1 may regulate the target RNA by interacting with the 3'UTR of the target RNA ( Figure 5 d). Although the editing sites of NEAT1 are distributed throughout the genome ( Figure 5 e), but GO enrichment analysis and signaling pathway enrichment analysis found that the target RNA genes were significantly enriched in cell cycle, autophagy, Wnt pathway, TGFβ pathway and Hippo pathway ( Figure 5 f and Figure 5 g), which are also known signaling pathways regulated by NEAT1. These results suggest that NEAT1 may regulate these signaling pathways by interacting with proteins or miRNAs, and may also directly interact with the corresponding mRNAs to regulate mRNA expression, thereby achieving regulatory effects on related signaling pathways. In order to explore the reliability of sarID, the NEAT1 target RNA identified by sarID was verified by real-time RT-PCR after tRSA RIP ( Figure 6 a), 20 target RNAs were randomly selected for validation. NEAT1 was significantly enriched by immunoprecipitation, while the negative control GAPDH was not, indicating the validity of the experiment. Among the 20 target RNAs, 18 (90%) were significantly enriched ( Figure 6 b), preliminarily illustrates the reliability of sarID.

[0116] 2. XIST (X-Inactive Specific Transcript) is the earliest discovered long non-coding RNA, which is only expressed on the inactive X chromosome. MALAT1 is a long non-coding RNA, the full name of which is Metastasis-associatedlung adenocarcinoma transcript 1, also known as NEAT2, located on chromosome 11q13.1, with a length of 8779nt, and is one of the most conserved LncRNAs in mammals. This example uses the sarID method of Example 1 to identify the interacting RNA molecules of XIST and MALAT1.

[0117] The target sequences for XIST (AGUCUUAUGGAGUGGGCACUCCCUGCUGGA) and MALAT1 (GCCAACAGAACAGACAGACCUGAAGUCAAG) were predicted by online software (https: / / cas13design.nygenome.org / ). According to the target sequence, the primer sequence was synthesized and cloned into the expression plasmid of the modified sgRNA. After 293T cells were infected with lentivirus using the method of Example 1, the cells were screened with complete medium containing a final concentration of 2 μg / mL puromycin, 20 μg / mL Blasticidin and 500 μg / mL Hygromycin to obtain a stable cell line. After the stable cell line was induced and cultured for 48 hours at a final concentration of 2 μg / mL Doxcycline, the cells were collected, RNA was extracted, and RNA-seq sequencing and analysis were performed.

[0118] The results are as follows Figure 7 As shown, 515 C-to-U editing events were identified in 471 genes associated with XIST, and 462 C-to-U editing events were identified in 430 genes associated with MALAT1 ( Figure 7 a). The identified editing sites are mainly located in the 3′UTR region of the gene ( Figure 7 b). Among the genes identified to interact with XIST and MALAT1, only 65 / 471 (for XIST) and 41 / 430 ​​(for MALAT1) could be detected by the whole-genome RNA-RNA interaction method (for NEAT1, only 59 / 1665 could be detected in a similar manner) (whole-genome RNA-RNA data were obtained from the starbase database https: / / rnasysu.com / encori / ), indicating that sarID is more sensitive than existing whole-genome methods in detecting RNA interactions of specific lncRNAs. Notably, pathway enrichment analysis revealed that stress-induced cell death pathways were enriched in XIST-interacting genes, which is consistent with the role of XIST in regulating cell death in tumors ( Figure 7 c). In addition, MALAT1 is known to be involved in regulating the mTOR signaling pathway, and we successfully identified the enrichment of mTOR signaling pathway genes in the interacting genes of MALAT1 ( Figure 7 d). These results demonstrate the feasibility of sarID in identifying target RNAs of lncRNAs.

[0119] 3. The sarID method has demonstrated its ability and reliability in identifying RNA partners of lncRNAs, and was initially successful on highly abundant nuclear lncRNAs such as NEAT1, XIST, and MALAT1. To further validate the scope and reproducibility of sarID, especially for low-abundance lncRNAs in the cytoplasm, it was applied to NBR2 and DANCR.

[0120] The target sequences for NBR2 (AAUUACUGUGAUGCAAUAAGCCGCAACUGG) and DANCR 1 target sequences (AAGUCAAUUGAAAUACCAGCAACAGGACAU, and GGCCAAGUAAGUUUAUUAACCUGCCAGGCU) were predicted by online software (https: / / cas13design.nygenome.org / ). According to the target sequence, the primer sequence was synthesized and cloned into the expression plasmid of the modified sgRNA. After 293T cells were infected with lentivirus using the method of Example 1, the cells were screened with complete medium containing a final concentration of 2 μg / mL puromycin, 20 μg / mL Blasticidin and 500 μg / mL Hygromycin to obtain a stable cell line. After the stable cell line was induced and cultured for 48 hours at a final concentration of 2 μg / mL Doxcycline, the cells were collected, RNA was extracted, and RNA-seq sequencing and analysis were performed.

[0121] Initial checks confirmed that the sarID program did not affect the transcriptome. For NBR2, 787 C-to-U editing events were identified in 694 genes, and for DANCR, 679 editing events were identified in 575 genes ( Figure 8 a, c). Given that there is almost no overlap with the non-target control group, these editing sites and their associated transcripts should be the true targets of NBR2 and DANCR. Signaling pathway enrichment analysis revealed interesting phenomena. For example, NBR2-bound RNAs were enriched in energy stress-related pathways, including FOXO, AMPK, and autophagy, which is consistent with the known role of NBR2 in AMPK-regulated metabolic checkpoints (Liu, X. et al. LncRNA NBR2 engages a metabolic checkpoint by regulating AMPK under energy stress. Nat Cell Biol 18, 431-442. 2016) ( Figure 8b). Similarly, multiple metabolic pathways were found to be enriched in DANCR's partners, suggesting that DANCR may play a role in cellular metabolic regulation, a finding consistent with previous studies (Yuan, R. et al. New evidence for a role of DANCR in cancers: a comprehensive review. J Transl Med 22, 569.2024) ( Figure 8 d). To rigorously test the reproducibility of the sarID method, we repeated the experiment and analyzed it according to the published method (Brannan, K. We et al. Robust single-cell discovery of RNA targets of RNA-binding proteins and ribosomes. Nat Methods 18, 507-519. 2021). The edited reads per kilobase of transcripts per million mapped reads (EPKM) showed high reproducibility between replicates (R of NBR2). 2 =0.94, the two different sgRNAs targeting DANCR are R 2 =0.86 and R 2 =0.91; Figure 8 Remarkably, this reproducibility was maintained even when different sgRNAs targeting DANCR were used ( Figure 8 h). Together, these results highlight the robustness and reliability of the sarID approach in identifying interacting RNA partners of lncRNAs, even those that are low in abundance or localized in the cytoplasm.

[0122] The above results of sarID identifying the interacting RNAs of lncRNA NBR2 and DANCR with high reproducibility show that, in addition to high-abundance lncRNAs located in the nucleus, sarID can also be applied to medium- and low-abundance lncRNAs located in the cytoplasm. In addition, the reproducibility of the sarID method was demonstrated through biological replication and different sgRNAs for the same lncRNA.

[0123] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A method for identifying long non-coding RNA interacting RNA molecules for the purpose of non-disease diagnosis and treatment, characterized in that: The following steps are involved: (1) Design sgRNA targeting the target lncRNA; The sgRNA includes a Guide sequence and a functional sequence; the Guide sequence is complementary to the target lncRNA; the functional sequence is shown in SEQ ID NO.1; (2) constructing lentiviral vectors expressing dPSPS protein and MCP-APOBEC1 fusion protein respectively; The amino acid sequence of the dPSPS protein is shown in SEQ ID NO.3; The amino acid sequence of the MCP protein is shown in SEQ ID NO.5; The amino acid sequence of the APOBEC1 protein is shown in SEQ ID NO.7; (3) Infecting target cells with lentivirus expressing sgRNA, dPSPS protein, and MCP-APOBEC1 fusion protein, and screening the target cells to construct a stable expression cell line; (4) inducing the stable expression cell line and extracting cellular RNA; (5) Performing sequencing analysis on the RNA of step (4) to identify RNA with a C to U mutation site, and determining the target lncRNA interacting RNA.

2. The method for identifying long non-coding RNA interacting RNA molecules for the purpose of non-disease diagnosis and treatment according to claim 1, characterized in that: In step (2), the nucleotide sequence of the backbone plasmid expressing the dPSPS protein is shown as SEQ ID NO.2; the nucleotide sequence of the dPSPS protein is shown as SEQ ID NO.

4.

3. The method for identifying long non-coding RNA interacting RNA molecules for the purpose of non-disease diagnosis and treatment according to claim 1, characterized in that: In step (2), the backbone plasmid expressing the MCP-APOBEC1 fusion protein includes a CMV promoter sequence, a 3X Flag tag and a Hygromycin screening marker; the nucleotide sequence of the MCP protein is shown in SEQ ID NO.6; and the nucleotide sequence of the APOBEC1 protein is shown in SEQ ID NO.

8.

4. The method for identifying long non-coding RNA interacting RNA molecules for the purpose of non-disease diagnosis and treatment according to claim 1, characterized in that: In step (3), the screening uses puromycin, blasticidin and hygromycin.

5. The method for identifying long non-coding RNA interacting RNA molecules for the purpose of non-disease diagnosis and treatment according to claim 1, characterized in that: In step (4), doxycycline is used to induce the expression of dPSPS protein in the stable cell line.

6. A kit for detecting long non-coding RNA-interacting RNA molecules, characterized in that: The kit includes sgRNA targeting the target lncRNA, a dPSPS protein expression plasmid, and an MCP-APOBEC1 fusion protein expression plasmid; The sgRNA includes a Guide sequence and a functional sequence; the functional sequence is shown in SEQ ID NO.1; the amino acid sequence of the dPSPS protein is shown in SEQ ID NO.3; the amino acid sequence of the MCP protein is shown in SEQ ID NO.5; and the amino acid sequence of the APOBEC1 protein is shown in SEQ ID NO.

7.

7. Use of the kit according to claim 6 in studying or identifying lncRNA-interacting RNA molecules in cells for purposes other than diagnosis and treatment of diseases.

Images