An enzyme cascade reaction system for the detection of nucleic acids and protein molecules and its application
By leveraging the synergistic effect of BER and Argonaute endonucleases in an enzyme cascade reaction system, the immediate detection of nucleic acid and protein biomarkers without pre-amplification is achieved, solving the problems of complexity and equipment dependence in existing detection methods and providing a rapid, sensitive, and low-cost detection solution.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ZHEJIANG UNIV
- Filing Date
- 2024-08-08
- Publication Date
- 2026-05-26
AI Technical Summary
Existing nucleic acid and protein detection methods are complex, time-consuming, and instrument-dependent. Furthermore, the CRISPR/Cas system exhibits accessory cleavage activity on non-specific targets, limiting its widespread use in diagnostics.
An enzyme cascade reaction system, combining BER endonucleases and Argonaute endonucleases such as APE1 and PfAgo, enables the instantaneous detection of nucleic acid and protein biomarkers without pre-amplification, and generates multiple fluorescence signals amplified through the synergistic enzyme activity of the probes.
It enables rapid, low-cost, and highly sensitive detection within 45 minutes without the need for complex equipment, making it suitable for on-site testing in resource-constrained environments and applicable to nucleic acid and protein biomarkers.
Smart Images

Figure CN119082268B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection technology, and in particular to an enzyme cascade reaction system for the detection of nucleic acids and protein molecules and its applications. Background Technology
[0002] Biomarkers (including nucleic acids and proteins) provide comprehensive diagnostic information and play a crucial role in improving the clinical management of complex diseases, including risk assessment, early detection, treatment, and surveillance. Gold standard methods such as polymerase chain reaction (PCR) and reverse transcription polymerase chain reaction (RT-PCR) are used to detect nucleic acid biomarkers, while immunological methods are widely used to detect protein biomarkers. However, these methods are typically complex, time-consuming (4–6 hours), and instrument-dependent, leading to a growing demand for faster, more accurate, and user-friendly diagnostic tools.
[0003] Simple and portable point-of-care testing (POCT) can be performed in resource-constrained locations or when needed in general, and is crucial in disease control, food safety, and environmental surveillance. Programmable nucleases with sequence-specific catalytic properties, particularly clustered regularly spaced short palindromic repeats (CRISPR) / CRISPR-associated proteins (Cas) systems, have attracted considerable attention due to their potential in molecular diagnostics. The unique characteristic of some Cas proteins exhibiting accessory cleavage activity on non-specific targets has facilitated the development of CRISPR-based point-of-care testing (POC) platforms, such as SHERLOCK and DETECTR, which offer high specificity and sensitivity. However, challenges facing CRISPR / Cas systems, including dependence on protospacer adjacent motifs (PAMs) and the increased costs and instability associated with guide RNAs, may hinder their widespread use in diagnostics.
[0004] Argonautes, similar to Cas proteins, are also programmable nucleases. Eukaryotic Argonautes (eAgos) play a crucial role in the RNA interference (RNAi) pathway, participating in various cellular processes such as transcription and post-transcriptional gene silencing, and host defense mechanisms. Prokaryotic Argonautes (pAgos) are widely used in molecular detection. Most pAgos use short DNA guides (gDNA) and can cleave complementary strands between the 10th and 11th bases from the 5' end of the guide without requiring a protospacer adjacent motif (PAM). However, it has been reported that mesophilic pAgos (CbAgo, CpAgo, and IbAgo) lack the ability to digest high-GC-content dsDNA targets due to their inability to unwrap dsDNA, which may limit their application in nucleic acid detection. In contrast, recent research advances on thermophilic pAgos (PfAgo and TtAgo) have given them an important place in nucleic acid detection and made them a focus of biosensor research. Taking advantage of their heat resistance, thermophilic pAgo overcame the challenge of opening the double helix of double-stranded DNA (dsDNA). However, their current applications are limited to the detection of nucleic acids after amplification. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide an enzyme cascade reaction system and its application for the detection of nucleic acids and protein molecules. By utilizing the synergistic enzyme activity of APE1 and PfAgo in the enzyme cascade reaction system, the immediate detection of nucleic acid and protein biomarkers without pre-amplification can be achieved within 45 minutes.
[0006] The present invention solves the above-mentioned technical problems by adopting the following technical solutions:
[0007] This invention provides an enzyme cascade reaction system for the detection of nucleic acids and protein molecules, including BER endonuclease (base excision repair endonuclease) and Argonaute endonuclease.
[0008] As one of the preferred embodiments of the present invention, the BER endonuclease is one or more of APE1, FEN1, Fpg, UDG, and T7endonuclease, more preferably APE1.
[0009] As one of the preferred embodiments of the present invention, the Argonaute endonuclease is one or more of pfAgo, CpAgo, CbAgo, TtAgo, RasAgo, MjAgo, and NgAgo, more preferably pfAgo.
[0010] The present invention also provides a method for detecting target DNA or RNA nucleic acid molecules in a sample, using the above-mentioned enzyme cascade reaction system, comprising the following steps:
[0011] (1) Contact the sample with the following substances first: BER endonuclease, single-stranded DNA probe P1;
[0012] (2) Contact and mix the Argonaute endonuclease, two exogenous single-stranded DNA probes P2 and P3 with the reaction solution of step (1);
[0013] (3) Measure the detection signal generated by the enzyme cascade reaction system cutting three single-stranded DNA probes to detect the target DNA or RNA of the sample.
[0014] As one of the preferred embodiments of the present invention, the sample is DNA or RNA molecules from serum, plasma, tissue, oropharyngeal swabs, urine, or feces.
[0015] As one of the preferred embodiments of the present invention, the single-stranded DNA probes P1, P2, and P3 are probes designed for the target DNA or RNA molecules in the sample.
[0016] As one of the preferred embodiments of the present invention, the single-stranded DNA probe P1 is modified with AP.
[0017] As one of the preferred embodiments of the present invention, the BER endonuclease specifically cleaves the AP site of the single-stranded DNA probe P1 and generates ssDNA with a 5' phosphate group modified at the cleavage site, namely gDNA1; at the same time, during the process of the BER endonuclease specifically cleaving the single-stranded DNA probe P1, a first fluorescent signal to be detected is generated.
[0018] As one of the preferred embodiments of the present invention, the Argonaute endonuclease uses gDNA1 as a guide DNA to specifically recognize single-stranded DNA probe P2, and cuts the single-stranded DNA probe P2 at a position 10-11 from the 5' end of the gDNA1 to generate gDNA2 and generate a second fluorescent signal to be detected.
[0019] As one of the preferred embodiments of the present invention, the Argonaute endonuclease again utilizes gDNA2 to specifically recognize the single-stranded DNA probe P3, and cuts the single-stranded DNA probe P3 at a position 10 to 11 from the 5' end of the gDNA2, generating a third fluorescent signal to be detected.
[0020] As one of the preferred embodiments of the present invention, when used for miR-21 detection:
[0021] The base sequences of the single-stranded DNA probes P1, P2, and P3 are shown in SEQ ID NO. 1 to 3, respectively.
[0022] When the BER endonuclease cuts probe P1, the resulting gDNA1 has the base sequence shown in SEQ ID NO.4.
[0023] The Argonaute endonuclease cuts probe P2 to produce gDNA2, the base sequence of which is shown in SEQ ID NO. 5.
[0024] In summary, the principle of nucleic acid molecular detection in this invention is as follows: Figure 1 As shown, it can be summarized into the following processes:
[0025] (1) Probe P1 specifically binds to target DNA or RNA to form a double-stranded conformation. BER endonuclease (taking APE1 as an example) specifically cleaves the AP site of P1 and produces gDNA1.
[0026] (2) gDNA1 in reaction (1) further serves as a guide DNA-specific recognition probe P2, guiding Argonaute endonuclease (taking pfAgo as an example) to specifically cleave probe P2;
[0027] (3) The newly generated gDNA2 in reaction (2) serves as the guide DNA, which further triggers the probe P3 to be cleaved by the Argonaute endonuclease (i.e., pfAgo);
[0028] (4) Achieve triple signal release and be detected.
[0029] This nucleic acid detection method can detect pathogenic microorganisms, gene mutations, or disease-related DNA or RNA nucleic acid molecular markers.
[0030] The present invention also provides a method for detecting protein molecules in a sample, employing the above-mentioned enzyme cascade reaction system, comprising the following steps:
[0031] (1) The sample contains BER endonuclease protein molecules; First, the sample is brought into contact with the following substances: DNA probes S1, S2, and S3;
[0032] (2) Contact and mix the Argonaute endonuclease, DNA probe S4, and the reaction solution from step (1);
[0033] (3) Measure the detection signals generated by the enzyme cascade reaction system cutting DNA probes S2, S3, and S4 to detect protein molecules in the sample.
[0034] As one of the preferred embodiments of the present invention, the sample is a protein molecule from serum, plasma, tissue, oropharyngeal swab, urine, or feces.
[0035] As one of the preferred embodiments of the present invention, the DNA probes S1, S2, S3, and S4 are probes designed for the target protein molecules of the sample.
[0036] As one of the preferred embodiments of the present invention, the DNA probes S1, S2, and S3 are all Flap structural probes.
[0037] As one of the preferred embodiments of the present invention, the BER endonuclease specifically cleaves the DNA probe S2 and generates ssDNA with a 5' phosphate group modified, i.e., gDNA3; when the DNA probe S2 is cleaved, a first fluorescent signal to be detected is generated.
[0038] As one of the preferred embodiments of the present invention, the Argonaute endonuclease uses gDNA3 as a guide DNA to specifically recognize DNA probe S3, and cuts DNA probe S3 at a position 10 to 11 from the 5' end of gDNA3 to generate gDNA4 and generate a second fluorescent signal to be detected.
[0039] As one of the preferred embodiments of the present invention, the Argonaute endonuclease again utilizes gDNA4 to specifically recognize the DNA probe S4, and cuts the DNA probe S4 at a position 10 to 11 from the 5' end of gDNA4, generating a third fluorescent signal to be detected.
[0040] As one of the preferred embodiments of the present invention, when specifically used for the detection of FEN1 protein molecules:
[0041] The base sequences of the DNA probes S1, S2, S3, and S4 are shown in SEQ ID NO. 6 to 9, respectively.
[0042] The BER endonuclease cuts probe S2 to produce gDNA3, the base sequence of which is shown in SEQ ID NO.10.
[0043] The gDNA4 generated by the Argonaute endonuclease cutting probe S3 has the base sequence shown in SEQ ID NO. 11.
[0044] Detection principle as follows Figure 2 As shown, it includes the following processes:
[0045] (1) The BER endonuclease protein molecule (taking FEN1 as an example) specifically digests the probe S2 (FlapDNA probe) and produces gDNA3;
[0046] (2) gDNA3 in reaction (1) further acts as guide DNA, specifically recognizing probe S3 and guiding Argonaute endonuclease (taking pfAgo as an example) to specifically cut probe S3 to produce gDNA4;
[0047] (3) The newly generated gDNA4 in reaction (2) serves as the guide DNA, which further triggers the probe S4 to be cleaved by the Argonaute endonuclease (i.e., pfAgo);
[0048] (4) Achieve triple signal release and detection.
[0049] Furthermore, this invention can also be used for the detection of APE1 protein molecules, in which case the aforementioned probes P2 and P3 can also be used, and the detection principle is as follows: Figure 2 As shown.
[0050] The protein molecular detection method of this invention can detect pathogenic microorganisms, gene mutations, or disease-related protein molecular markers.
[0051] In addition, the present invention also provides an application of the above-mentioned enzyme cascade reaction system in the preparation of reagent products for detecting target nucleic acids and target proteins in samples.
[0052] This invention develops an enzyme cascade reaction system called NAPTUNE (Nucleic acid and Protein Biomarkers Testing via Ultra-sensitive Nucleases Escalation), which enables the detection of nucleic acid and protein biomarkers without pre-amplification within 45 minutes through the use of tandem endonucleases. The designed NAPTUNE employs a synergistic effect of purine-free / pyrimidine-free BER endonucleases (e.g., APE1) and Argonaute endonucleases (e.g., pfAgo). First, APE1 itself can establish a positive feedback loop for the detection of target nucleic acids, exhibiting high specificity and exponential signal amplification. Simultaneously, the sequential cleavage products with 5-phosphate ends generated by APE1 cleavage act as guides for gDNA, activating the cis-cleavage system on PfAgo-mediated secondary and tertiary probes, thereby transforming APE1's target recognition ability into an "APE1-Argonaut" in-situ cascade amplified fluorescence signal mode. This groundbreaking approach leverages the synergistic enzymatic activity of BER and Argonaute endonucleases to pave the way for enhanced and efficient signal amplification processes, enabling highly sensitive, amplification-free, rapid, highly specific, single-tube, and on-site detection of nucleic acids, particularly non-coding RNA (ncRNA).
[0053] Furthermore, this invention validated NAPTUNE using RNA samples extracted from patient tissue. Using directly synthesized probes, we leveraged the in-situ cascade strategy essential to the NAPTUNE method to deploy them for detecting protein biomarkers (e.g., FEN1), further demonstrating the platform's programmability. The use of NAPTUNE is expected to significantly improve the ability to analyze nucleic acid and protein biomarkers in the field, even for individuals with minimal training, thereby significantly enhancing diagnostic accuracy and therapeutic efficacy in clinical applications.
[0054] The advantages of this invention compared to the prior art are:
[0055] (1) Rapid: When the test conditions are ready, the present invention only takes 30 to 60 minutes from receiving the sample to receiving the test results; in most cases, the instantaneous detection of nucleic acid and protein biomarkers that do not require pre-amplification can be achieved within 45 minutes.
[0056] (2) Low cost: The system and method of the present invention do not involve special materials or enzymes, and involve fewer materials and reagents, which can be used for micro-scale testing and analysis;
[0057] (3) High efficiency: This invention has extremely high sensitivity and can detect DNA or RNA at a concentration of 1 aM and protein molecular markers at a concentration of 1 U / L;
[0058] (4) Simple: There are no special complicated steps, no need for complicated equipment and laboratories, and on-site testing can be achieved simply by adding the sample. Attached Figure Description
[0059] Figure 1 This is a schematic diagram of the nucleic acid molecule detection principle based on the enzyme cascade reaction system of this invention;
[0060] Figure 2 This is a schematic diagram of the protein molecule detection principle based on the enzyme cascade reaction system of this invention;
[0061] Figure 3 This is a real-time fluorescence signal image from the feasibility analysis of miR-21 detection using NAPTURE in Experiment Example 1;
[0062] Figure 4 This is the fluorescence intensity graph from the NAPTURE sensitivity analysis of miR-21 in Experiment Example 2;
[0063] Figure 5 This is a fluorescence intensity graph of miR-21 in clinical samples detected by NAPTURE and qPCR in Experiment Example 3;
[0064] Figure 6This is the PAGE image from the feasibility analysis of NAPTURE detection for FEN1 in Experiment Example 4;
[0065] Figure 7 This is a graph showing the linear relationship between fluorescence intensity and FEN1 concentration in the NAPTURE sensitivity analysis of FEN1 in Experiment Example 5.
[0066] Figure 8 This is a NAPTURE assay of the FEN1 fluorescence intensity of a simulated clinical sample in Experiment Example 6 (in the figure, "***" indicates P<0.001). Detailed Implementation
[0067] The embodiments of the present invention are described in detail below. These embodiments are implemented based on the technical solution of the present invention, and provide detailed implementation methods and specific operation processes. However, the scope of protection of the present invention is not limited to the following embodiments.
[0068] This invention provides a NAPTURE system for the detection of nucleic acids and protein molecules, as well as a method for the detection of nucleic acids and protein molecules based on this system.
[0069] The NAPTURE system includes a BER endonuclease and an Argonaute endonuclease. The BER endonuclease is one or more of APE1, FEN1, Fpg, UDG, and T7 endonuclease, preferably APE1. The Argonaute endonuclease is one or more of pfAgo, CpAgo, CbAgo, TtAgo, RasAgo, MjAgo, and NgAgo, preferably pfAgo.
[0070] In nucleic acid detection methods based on the NAPTURE system, the samples are DNA or RNA molecules from serum, plasma, tissue, oropharyngeal swabs, urine, or feces.
[0071] In protein molecule detection methods based on the NAPTURE system, the samples are BER endonuclease protein molecules, such as APE1 and FEN1, from serum, plasma, tissue, oropharyngeal swabs, urine, or feces.
[0072] Meanwhile, in the detection of nucleic acid molecules in the following examples, taking microRNA 21 (miR-21, a small molecular weight non-coding RNA) as an example, the probes P1 to P3 used have sequences as shown in SEQ ID NO. 1 to 3, and the gDNA1 and gDNA2 sequences generated during the detection process are shown in SEQ ID NO. 4 to 5 (see Table 1).
[0073] In the protein molecule detection of the following examples, taking FEN1 enzyme as an example, the probes S1 to S4 used are shown in SEQ ID NO. 6 to 9, and the gDNA3 and gDNA4 sequences generated during the detection process are shown in SEQ ID NO. 10 to 11 (see Table 1).
[0074] In addition, unless otherwise specified, all reagents and experimental methods used in the following examples are conventional reagents or methods in the art and will not be described again.
[0075] Table 1. This invention relates to probes and gDNA.
[0076] name Sequence (5'-3') Serial Number probe P1 TCAACAnCAGTCTGATAAGCTAT SEQ ID NO.1 probe P2 AAACATAGCTTATCAGACTGCCCAGC SEQ ID NO.2 probe P3 ATATCCGGCTGGACAGTCTGATATGA SEQ ID NO.3 gDNA1 CAGTCTGATAAGCTAT SEQ ID NO.4 gDNA2 TATCAGACTGCCCAGC SEQ ID NO.5 probe S1 GTCGAGAATCCTGCTGGG SEQ ID NO.6 probe S2 ATTTCGGCAGAGACCTAATATAAGCAAAAC SEQ ID NO.7 Probe S3 GTTTTGCTTATATTAGGTCTCCCAGCAGGATTCTCGAC SEQ ID NO.8 probe S4 ATATCCGGCTGGGAGACCTAATATGA SEQ ID NO.9 gDNA3 AGACCTAATATAAGCAAAAC SEQ ID NO.10 gDNA4 TATTAGGTCTCCCAGCAGGATTCTCGAC SEQ ID NO.11
[0077] Note: n represents the AP site.
[0078] Example 1: NAPTURE detection of miR-21 molecules:
[0079] (1) For a 20uL reaction system, 2μL of synthesized miR-21 (the sequence of miR-21 is “UAGCUUAUCAGACUGAUGUUGA”) or extracted RNA sample was reacted with 2μL of 1μM probe P1 at 90℃ for 1 minute, and then cooled to room temperature to obtain a double-stranded structure.
[0080] (2) The formed double-stranded structure was mixed with 6 μL of APE1 reaction solution (50 mM Tris / HCl pH 7.4, 100 mM KCl, 5 mM MgCl2, 2 mM ATP, 0.05 mg / mL BSA, 100 mU / mL APE1) and reacted at 42 °C for 20 minutes.
[0081] (3) After the APE1 reaction is completed, add 10 μL of pfAgo reaction solution (250 nM pfAgo protease, 200 nM probe P2, 200 nM probe P3, 20 mM HEPES pH 7.5, 250 mM NaCl, 0.5 mM MnCl2) to the mixture and react at 95 °C for 25 minutes.
[0082] (4) Record the fluorescence intensity of the final reaction solution using an ELISA reader, and detect the real-time fluorescence signal using a qPCR device (Bio-Rad, CFXconnect real-time system).
[0083] Example 2: NAPTURE detection of FEN1 protein molecules:
[0084] (1) Take 2 μL of each of the 2 μM probes S1, S2 and S3, and 38 μL of TE buffer, denature them at 90 °C for 1 min, and then cool them to room temperature to obtain the composite structure.
[0085] (2) Add 2 μL of the purchased FEN1 enzyme or the obtained simulated sample solution to a solution containing 1 μL of the aforementioned composite structure probe, then add 7 μL of H2O and 1 μL of 10x ThermoPol reaction buffer, and react at 65°C for 20 min.
[0086] (3) After the reaction is complete, add 10 μL of pfAgo reaction solution (250 nM pfAgo protease, 250 nM probe S4, 20 mM HEPES pH 7.5, 250 mM NaCl, 0.5 mM MnCl2) to the mixture and react at 95 °C for 25 minutes.
[0087] (4) The final product bands were detected by non-denaturing polyacrylamide gel electrophoresis (PAGE) and the fluorescence intensity of the final reaction solution was read by an enzyme-linked immunosorbent assay (ELISA) reader.
[0088] Experimental Example 1: Feasibility Analysis of the NAPTURE Detection Method for miR-21 in this Invention:
[0089] To analyze the feasibility of NAPTURE detection of miR-21, probes P1–P3 labeled with FAM-BHQ1 were used to verify the signal amplification achieved by the APE1 and pfAgo reaction. Eight sets of experiments were designed for verification.
[0090] The results are as follows Figure 3 As shown: When Target (i.e., miR-21) and P1, APE1, pfAgo, P2, and P3 are all present, the final fluorescence signal is the strongest, indicating "tertiary signal amplification achieved by the APE1 reaction and pfAgo secondary cleavage"; when probe P3 is missing, the fluorescence signal weakens, indicating "when probe P3 is missing, pfAgo cannot undergo secondary cleavage, but secondary signal amplification is achieved by the APE1 reaction and pfAgo primary cleavage"; when probe P2 or pfAgo is missing, the fluorescence signal weakens further, indicating "even if probe P3 is present, but probe P2 or pfAgo is missing, the pfAgo reaction cannot occur, and only primary signal amplification is achieved by the APE reaction"; when Target or APE1 is missing from the system, the fluorescence signal is the same as the group with only probes P1, P2, and P3, with almost no fluorescence signal, indicating "without Target or APE1, the APE1 reaction will not occur, i.e., no signal is generated". The results show that NAPTURE utilizes the APE1 and pfAgo reaction to achieve triple signal amplification and can be used to detect miR-21.
[0091] Experimental Example 2: Sensitivity analysis of the NAPTURE method for detecting miR-21 in this invention:
[0092] To determine the sensitivity of NAPTURE for miR-21 detection, synthesized miR-21 was diluted to 0–10 pM, and NAPTURE reactions were performed using probes P1–P3 labeled with FAM-BHQ1. After the reaction, the intensity of the FAM fluorescence signal was detected using a microplate reader.
[0093] The results are as follows Figure 4 As shown in the figure. The test results show that the sensitivity for detecting miR-21 is as low as 1 aM. The results indicate that NAPTURE can be used for sensitive detection of miR-21.
[0094] Experimental Example 3: Clinical sample validation of the NAPTURE method for detecting miR-21 of this invention:
[0095] To explore the feasibility of NAPTURE in detecting miR-21 in actual samples, RNA was extracted from tissue samples of 30 children with neuroblastoma. The expression level of miR-21 in the RNA of the 30 samples was detected by real-time quantitative reverse transcription PCR (qPCR) and NAPTURE, respectively.
[0096] The results are as follows Figure 5 The results showed that the NAPTURE detection results had good consistency with the qPCR results, achieving a positive prediction rate of 95.3% and a negative prediction rate of 91.0%. These results demonstrate that the NAPTURE assay of this invention has the ability to accurately detect miR-21 in clinical samples.
[0097] Example 4: Feasibility analysis of the NAPTURE detection method for FEN1 in this invention:
[0098] To analyze the feasibility of NAPTURE detection of FEN1, we designed six sets of experiments to verify it using probe S2 labeled with Cy3, probe S3 labeled with Cy5, and probe S4 labeled with FAM.
[0099] The results are as follows Figure 6As shown: Group 1 (Flap group in the figure) displays the complex structure formed by probes S1, S2, and S3. Group 2 (Flap+FEN1 group in the figure) shows that in the presence of FEN1 enzyme, probe S2 is cleaved into short fragments, suggesting that the presence of FEN1 enzyme can mediate the cleavage of probe S2. After further addition of pfAgo, compared with Group 3 (Flap+pfAgo group in the figure), Group 4 (Flap+FEN1+pfAgo group in the figure) shows that when pfAgo is present... When FEN1 enzyme was added, S3 was further cleaved into short fragments, indicating that the presence of FEN1 enzyme can mediate the cleavage of probe S3 by pfAgo. Upon further addition of probe S4, compared with the fifth group (Flap+pfAgo+S4 group in the figure), the sixth group (Flap+FEN1+pfAgo+S4 group in the figure) showed that S4 was further cleaved into short fragments in the presence of probe S3, indicating that the presence of FEN1 enzyme can mediate a secondary cleavage of probe S4 by pfAgo. The results show that NAPTURE can achieve three-stage probe cleavage using the reaction between FEN1 and pfAgo and can be used to detect FEN1 enzyme.
[0100] Experimental Example 5: Sensitivity analysis of the NAPTURE detection method for FEN1 in this invention:
[0101] To determine the sensitivity of NAPTURE for FEN1 detection, the FEN1 enzyme was diluted to 0–300 mU / mL, and NAPTURE reactions were performed using probes S2–S4 labeled with FAM-BHQ1. After the NAPTURE reaction, the intensity of the FAM fluorescence signal was detected using a microplate reader.
[0102] The results are as follows Figure 7 As shown in the figure. The detection results show a linear relationship between the fluorescence signal intensity and the FEN1 concentration, with a sensitivity for FEN1 detection as low as 1 mU / mL. These results indicate that NAPTURE can be used for sensitive detection of FEN1.
[0103] Experimental Example 6: Validation of the present invention's NAPTURE detection method for FEN1 using simulated clinical samples:
[0104] To explore the feasibility of using NAPTURE to detect FEN1 enzyme in biological samples, NAPTURE was used to detect FEN1 levels in simulated clinical samples with FEN1 added to serum.
[0105] The results are as follows Figure 8 The results showed that FEN1 levels were significantly enhanced in the minimized samples compared to the control group (NC). This indicates that NAPTURE has the ability to accurately detect FEN1 in samples.
[0106] In summary, the novel enzyme cascade reaction system NAPTURE provided by this invention can be used for the detection of nucleic acids and protein molecules, and has the characteristics of high sensitivity, fast reaction, low cost, and on-site detection.
[0107] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. An enzyme cascade reaction system for the detection of nucleic acids and protein molecules, characterized in that, This includes a combination of BER endonucleases, Argonaute endonucleases, and specific probes; The BER endonuclease is selected from APE1 or FEN1; The Argonaute endonuclease is selected from pfAgo; When used for nucleic acid detection, the specific probe combination includes AP-modified single-stranded DNA probe P1, exogenous single-stranded DNA probes P2 and P3; after P1 specifically binds to the target nucleic acid molecule to form a double strand, it is cleaved by the BER endonuclease APE1 to produce gDNA1, gDNA1 guides the Argonaute endonuclease to cleave P2 to produce gDNA2, and gDNA2 guides the Argonaute endonuclease to cleave P3; the sequences of probes P1 to P3 are shown in SEQ ID NO. 1 to 3, respectively, and the sequences of gDNA1 and gDNA2 generated during the detection process are shown in SEQ ID NO. 4 to 5, respectively; When used for protein detection, the specific probe combination includes Flap structural DNA probes S1, S2, and S3 and exogenous DNA probe S4. S2 is cleaved by the BER endonuclease FEN1 to produce gDNA3. gDNA3 guides the Argonaute endonuclease to cleave S3 to produce gDNA4. gDNA4 guides the Argonaute endonuclease to cleave S4. The sequences of probes S1 to S4 are shown in SEQ ID NO. 6 to 9, respectively. The sequences of gDNA3 and gDNA4 generated during the detection process are shown in SEQ ID NO. 10 to 11, respectively.
2. The application of the enzyme cascade reaction system as described in claim 1 in the preparation of reagent products for detecting target nucleic acids and target protein molecules in samples.