Method for improving meat quality of mutton sheep by SNP molecular marker site of FASN gene

Abstract

The application belongs to the technical field of molecular biology, and particularly relates to a method for improving meat quality of mutton sheep by using a SNP site of a FASN gene. The method for improving meat quality of mutton sheep by using the SNP site of the FASN gene comprises the following steps: detecting whether a g.50277076C>T site mutation exists in a FASN gene in a genome of a mutton sheep to be detected; selecting a mutton sheep individual with a genotype of TT type to perform artificial insemination or intrabreed. The application uses the above-mentioned molecular marker as a reliable marker of meat quality of Mongolian sheep, establishes a technical system for DNA detection of the genotype, improves selection intensity, and accuracy and efficiency of breeding, and improves meat quality of the Mongolian sheep.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology, and particularly relates to a method for improving meat quality of mutton sheep by using a FASN gene g.50277076C>T site. BACKGROUND

[0002] Mongolia sheep, also known as Mongolia system sheep, mainly come from Inner Mongolia Autonomous Region, and is a rough wool type sheep local breed with the most sub-species and the widest distribution in China. The meat quality of Mongolia sheep has the advantages of delicious and tender taste, light mutton smell, strong adaptability and the like. Fatty acid is an important factor affecting the meat quality, nutritional value and flavor of mutton sheep, and can affect the fat saturation, storage stability and flavor of mutton.

[0003] Fatty acid synthase (FASN) is a fatty acid synthase gene, which plays an important role in fat generation and is also a necessary metabolic enzyme and multifunctional enzyme in the fatty acid synthesis process. Its main function is to catalyze palmitate to be synthesized into long-chain saturated fatty acid in the presence of NADPH. In some cancer cell lines, it has been found that this protein is fused with estrogen receptor-alpha (ER-alpha), in which the N-terminal of Fas is fused with the C-terminal of ER-alpha in frame.

[0004] Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by change of a single nucleotide, and has the advantages of large number, large density and high genetic stability, and is therefore widely applied. These genetic markers are associated with growth traits, so that breeding selection at the DNA level can be realized, human influence can be effectively avoided, the accuracy of breeding selection can be improved, excellent individuals with excellent traits can be identified at an early stage, excellent backup parents can be screened, the breeding cycle can be shortened, and the breeding process can be greatly accelerated. SUMMARY

[0005] The application aims to provide an application of a SNP molecular marker of a FASN gene.

[0006] The application aims to provide a method for improving meat quality of mutton sheep by using a SNP molecular marker of a FASN gene.

[0007] The application detects whether a C→T mutation exists at position 50277076 in the non-coding region of the FASN gene in the genome of Mongolian sheep, determines the genotype of the individual Mongolian sheep at the site, detects single nucleotide polymorphism of FASN gene g.50277076C>T, compares the polymorphism of FASN gene g.50277076C>T in Mongolian sheep breeds, and determines that g.50277076C>T is a molecular marker related to the meat quality of Mongolian sheep.

[0008] The FASN gene g.50277076C>T site is related to the content of SFA, C18:1n9c, C20:3n3 and PUFA in the muscle of Mongolian sheep, the C17:0 level of TT genotype sheep is significantly lower than that of CT and CC genotype sheep (P<0.01), the SFA level of TT genotype sheep is significantly lower than that of CT and CC genotype sheep (P<0.05); the C18:1n9c level of TT genotype sheep is significantly higher than that of CT and CC genotype sheep (P<0.01), and the C20:3n3 and PUFA levels of TT genotype sheep are significantly higher than those of CT and CC genotype sheep (P<0.05).

[0009] C12:0 is a saturated fatty acid and an important component of mutton. It helps to provide energy and may support muscle growth and cell function. However, excessive intake of C12:0 fatty acids can lead to an increase in body fat content in humans. C18:1 is an unsaturated fatty acid and an important component of mutton, which can be used as energy storage and transmission. SFA is the total saturated fatty acid, which mainly provides energy and is an important component of mutton. Excessive intake of SFA has an impact on blood fat levels in humans. Therefore, controlling the intake of C12:0, C18:1 and SFA is crucial for maintaining human health.

[0010] In specific selection applications, for example, in sheep selection, ram individuals carrying the TT genotype of the g.50277076C>T site should be selected as much as possible.

[0011] The SNP molecular marker of the FASN gene according to the specific embodiment of the application is used in improving the meat quality of Mongolian sheep, and the SNP molecular marker includes g.50277076C>T.

[0012] The SNP molecular marker of the FASN gene according to the specific embodiment of the application is used in improving the meat quality of Mongolian sheep, and the SNP molecular marker includes g.50277076C>T.

[0013] The nucleotide sequence of the specific primer of the g.50277076C>T molecular marker is as follows:

[0014] SEQ ID NO.1:

[0015] F: ACGTTGGATGTCAGAGTGACCGAAGTACG;

[0016] SEQ ID NO. 2:

[0017] R: ACGTTGGATGCAACTTCCGTTCCGTGCTC;

[0018] SEQ ID NO. 3:

[0019] E: CAAGGACGCCCGTTCCGTTTCCAC.

[0020] The application further provides application of the specific primer of the SNP molecular marker of the FASN gene in improving meat quality of mutton sheep, and the SNP molecular marker comprises g.50277076C>T.

[0021] The nucleotide sequence of the specific primer of the g.50277076C>T molecular marker is as follows:

[0022] F: ACGTTGGATGTCAGAGTGACCGAAGTACG;

[0023] R: ACGTTGGATGCAACTTCCGTTCCGTGCTC;

[0024] E: CAAGGACGCCCGTTCCGTTTCCAC.

[0025] This invention relates to the application of specific primers for the SNP molecular marker of the FASN gene in improving the meat quality of Mongolian sheep, as described in a specific embodiment of the invention. The improvement in meat quality is achieved by increasing the content of beneficial saturated fatty acids and unsaturated fatty acids. Specifically, the improvement in meat quality is manifested in the following ways: the C17:0 level of TT genotype sheep at the g.50277076C>T locus is significantly lower than that of CT and CC genotype sheep (P<0.01); the SFA level of TT genotype sheep is significantly lower than that of CT and CC genotype sheep (P<0.05); the C18:1n9c level of TT genotype sheep is significantly higher than that of CT and CC genotype sheep (P<0.01); and the C20:3n3 and PUFA levels of TT genotype sheep are significantly higher than those of CT and CC genotype sheep (P<0.05). This balances the intake of these four fatty acids by consumers and maintains human blood lipid levels. Maintaining a moderate intake of fatty acids ensures the tenderness and taste of lamb while avoiding adverse effects on human health. Adjusting the content of SFA, C18:1n9c, C20:3n3, and PUFA can improve the taste and texture of lamb, making it more tender and juicy, and helping to enhance the nutritional value of meat products.

[0026] The present invention also provides a method for improving the quality of mutton, the method comprising the following steps:

[0027] S1. Extract genomic DNA from the sheep to be tested;

[0028] S2. Using the sheep genomic DNA extracted in step S1 as a template, PCR amplification was performed using specific primers to obtain the amplification product, wherein...

[0029] The specific primer sequences for the g.50277076C>T molecular marker are as follows:

[0030] F:ACGTTGGATGTCAGAGTGACCGAAGTACG;

[0031] R:ACGTTGGATGCAACTTCCGTTCCGTGCTC;

[0032] E:CAAGGACGCCCGTTCCGTTTCCAC.

[0033] S3. Detect the presence of a C>T mutation at nucleotide 50275859 in the non-coding region of the FASN gene in the genomic DNA of the sheep sample:

[0034] If the 50277076th nucleotide of the non-coding region of the FASN gene is C, the homozygous genotype is CC; if the 50277076th nucleotide is T, the homozygous genotype is TT; and the heterozygous genotype is CT.

[0035] Select meat sheep individuals carrying the TFSN gene g.50277076C>T locus with the TT genotype and perform artificial insemination or natural mating.

[0036] According to a specific embodiment of the present invention, in step S2, matrix-assisted laser desorption / ionization time-of-flight mass spectrometry is used to perform genotyping on nucleotide 50277076 of chromosome 11 of the FASN gene of the sheep to be tested, and to determine its base type.

[0037] According to a specific embodiment of the present invention, in the method for improving the quality of mutton meat, in step S2, the reaction procedure of the PCR method is as follows: the PCR amplification reaction conditions are: 94℃ for 120 seconds, 94℃ for 20 seconds, 47.1℃ for 30 seconds, 72℃ for 60 seconds, 45 cycles, and the final extension condition is 72℃ for 180 seconds, and cycling at 4℃.

[0038] The SAP digestion reaction conditions are: 37℃ for 40 minutes, 85℃ for 50 minutes, and cyclic at 4℃.

[0039] The PCR extension reaction conditions were: 94℃ for 30 seconds, 94℃ for 5 seconds, 52℃ for 5 seconds and 80℃ for 5 seconds, and finally 72℃ for 180 seconds, and cycled at 4℃.

[0040] According to a specific embodiment of the invention, a method for improving the meat quality of sheep using SNP molecular markers of the FASN gene is described. In step S1, the reaction system of the PCR method is a 384-well PCR plate with 38% reagent loss. Specifically, the PCR amplification reaction system consists of 927.5 μL of HPLC-grade water, 331.25 μL of 10×PCR Buffer (15 mM MgCl2), 172.25 μL of MgCl2 (25 mM), 53 μL of dNTPs (25 mM), and 530 μL of primer Mix (0.5 mM).

[0041] The SAP digestion reaction system consists of 810.9 μL of H2O, 90.1 μL of alkaline phosphatase buffer (SAP buffer), and 159 μL of SAP (1.7 U / μL).

[0042] The PCR extension reaction system consisted of 400.2 μL of H2O, 106 μL of 10×iPLEX Buffer plus, 106 μL of iPLEX terminator, 426.1 μL of primer mix (0.6-1.3 μM) and 21.7 μL of iPlex enzyme.

[0043] According to a specific embodiment of the present invention, the method for improving the meat quality of mutton is a Mongolian sheep.

[0044] The present invention also provides a kit for testing the quality of mutton meat, the kit comprising:

[0045] The specific primer sequences for the g.50277076C>T molecular marker are as follows:

[0046] F:ACGTTGGATGTCAGAGTGACCGAAGTACG;

[0047] R:ACGTTGGATGCAACTTCCGTTCCGTGCTC;

[0048] E:CAAGGACGCCCGTTCCGTTTCCAC.

[0049] Note: F: upstream primer; R: downstream primer; E: extension primer.

[0050] Specifically, using the genomic DNA of Mongolian sheep extracted in step S1 as a template, PCR amplification was performed with upstream and downstream primers, followed by single-base extension reaction using extension primers. Finally, after purification and spotting, the sample was analyzed by mass spectrometry.

[0051] According to the specific embodiments of the invention, the method for improving the quality of mutton meat using SNP molecular markers of the FASN gene includes 15 saturated fatty acids and 12 unsaturated fatty acids that affect the quality of mutton meat. Specifically, these include butyric acid (C4:0), hexanoic acid (C6:0), decanoic acid (C10:0), undecanoic acid (C11:0), lauric acid (C12:0), tridecanoic acid (C13:0), myristic acid (C14:0), pentadecanoic acid (C15:0), palmitic acid (C16:0), heptadecanoic acid (C17:0), stearic acid (C18:0), icosanoic acid (C21:0), betaine acid (C22:0), triacrylic acid (C23:0), and tetracosanoic acid (C24:0). Myristenoic acid (C14:1), cis-10-heptadecenoic acid (C17:1), transoleic acid (C18:1n9t), oleic acid (C18:1n9c), cis-11-eicosenoic acid (C20:1n9), erucic acid (C22:1n9), linoleic acid (C18:2n6c), alpha-linolenic acid (C18:3n3), cis-8,8,11,14-eicosatetrienoic acid (C20:3n6), arachidonic acid (C20:4n6), cis-5,8,11,14,17-eicosapentaenoic acid (C20:5n3), cis-4,7,10,13,16,19-docosahexaenoic acid (C22:6n3), and saturated fatty acids. fatty acids (SFA), monounsaturated fatty acids (MUFA), polyunsaturated fatty acids (PUFA), unsaturated fatty acids (UFA), MUFA / SFA, PUFA / SFA, UFA / SFA, short-chain fatty acids (SCFA), medium-chain fatty acids (MCFA), long-chain fatty acids (MCFA), N6 series polyunsaturated fatty acids (n6-PUFA), N3 series polyunsaturated fatty acids (n3-PUFA), n-6 / n-3, essential fatty acids (EFA).

[0052] Among them, the FASN gene g.50277076C>T site was associated with the content of SFA, C18:1n9c, C20:3n3 and PUFA in the muscle of Mongolian sheep. The C17:0 level in TT genotype sheep was significantly lower than that in CT and CC genotype sheep (P<0.01), and the SFA level in TT genotype sheep was significantly lower than that in CT and CC genotype sheep (P<0.05). The C18:1n9c level in TT genotype sheep was significantly higher than that in CT and CC genotype sheep (P<0.01), and the C20:3n3 and PUFA levels in TT genotype sheep were significantly higher than those in CT and CC genotype sheep (P<0.05).

[0053] This invention utilizes the aforementioned molecular markers as reliable markers for improving the meat quality of Mongolian sheep, thereby increasing the intensity of selection and the accuracy and efficiency of breeding. It also confirms the genetic effect of the g.50277076C>T site in the FASN gene on improving the meat quality of Mongolian sheep.

[0054] The beneficial effects of this invention are:

[0055] This invention uses the FASN gene as a candidate gene in breeding markers and employs MassARRAY technology to genotype the FASN gene. By comparing the polymorphism of the FASN gene in Mongolian sheep, it confirms the genetic effect of the g.50277076C>T locus in the FASN gene on improving the meat quality of Mongolian sheep. Subsequently, breeding sheep carrying the TT genotype of the FASN gene g.50277076C>T locus are selected for artificial insemination or natural mating to improve the meat quality of their offspring. Attached Figure Description

[0056] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0057] Figure 1 This is a MassARRAY scatter plot of the g.50277076C>T site in the NC_040262.1 gene sequence of Mongolian sheep FASN. Detailed Implementation

[0058] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be described in detail below. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other implementation methods obtained by those skilled in the art without creative effort are within the scope of protection of this invention. Example 1: Obtaining the SNP detection fragment of the FASN gene in Mongolian sheep and establishing a method for detecting polymorphic sites.

[0059] 1. MassARRAY genotyping test

[0060] (1) Extraction and quality control of Mongolian sheep genomic DNA

[0061] All Mongolian sheep were castrated male lambs born in 2020 and aged 6 months. The Promega MagaZorb@DNAMini-Prep Kit (blood genomic extraction kit) was used; the usage instructions were found in the MagaZorb@technical manual.

[0062] ① Thaw the sample, add 350 μl of blood sample and 20 μl of proteinase K to a 2 ml centrifuge tube and mix well.

[0063] ② Add 200 μl of LysisBuffer solution to the centrifuge tube and shake to mix.

[0064] ③ Heat the centrifuge tube in a solid bath for 10 minutes, inverting and mixing during the process, until the liquid becomes clear and transparent.

[0065] ④ Remove the centrifuge tube, add 500 μl of Binding Buffer solution, and vortex to mix thoroughly.

[0066] ⑤ Add 20 μl of MagaZorb@Reagent solution to the centrifuge tube, vortex to mix thoroughly, and let stand for 15 seconds.

[0067] ⑥ Place the centrifuge tube on the adsorption rack and invert it repeatedly until the liquid becomes clear and the magnetic beads adhere to the centrifuge tube wall.

[0068] ⑦ Remove the supernatant, keep the magnetic beads, add Wash Buffer solution, and mix by inverting the container.

[0069] ⑧ Repeat steps ⑥ and ⑦ twice, discard the supernatant and keep the magnetic beads, open the centrifuge tube cap and let it air dry at room temperature for 1-2 minutes to allow the moisture to evaporate.

[0070] ⑨ Remove the centrifuge tube from the adsorption rack, add 50 μl of Elution Buffer solution, shake to mix, and let stand.

[0071] ⑩ Place the centrifuge tube on the adsorption rack, invert it so that the magnetic beads adhere to the centrifuge tube wall, remove the supernatant and transfer it to a new centrifuge tube, and detect the sample concentration and OD value.

[0072] The OD260 / OD280 of the extracted DNA solution should be between 1.7 and 2.0.

[0073] (2) PCR amplification:

[0074] Primers were designed based on the genomic sequence of the Mongolian sheep FASN gene (GenBank ID: NC_040262.1) to amplify fragments at polymorphic sites. The primers are as follows:

[0075] Amplified fragment sequence of g.50277076C>T site

[0076] F:5'-ACGTTGGATGTCAGAGTGACCGAAGTACG-3';

[0077] R:5'-ACGTTGGATGCAACTTCCGTTCCGTGCTC-3';

[0078] E:5'-CAAGGACGCCCGTTCCGTTTCCAC-3'.

[0079] Note: F: upstream primer; R: downstream primer; E: extension primer

[0080] The above primers were used to perform PCR amplification on Mongolian sheep genomic DNA. The PCR amplification reaction system and conditions are shown in Table 1, the SAP digestion system and conditions are shown in Table 2, and the extension reaction system and conditions are shown in Table 3. (In this experiment, "well" refers to the number of combinations in multiplex PCR).

[0081] Table 1. PCR amplification reaction system and conditions

[0082]

[0083] Table 2 SAP Digestion System and Conditions

[0084]

[0085] Table 3. Extended Reaction System and Conditions

[0086]

[0087]

[0088] (3) Dilute the reaction product (total 9 μL) 3 times with deionized water, desalt it using resin for 20 minutes, then spot the sample onto a 384-well SpectroCHIP (Sequenom) chip, allow it to crystallize naturally, and finally use a MALDI-TOF mass spectrometer. Analyzer 4 (Agena Biosciences) detects and collects data.

[0089] The results are as follows Figure 1 As shown in the example, the yellow triangle represents a Mongolian sheep individual with the TT genotype (1 sheep), the green square represents a Mongolian sheep individual with the CT genotype (2 sheep), and the blue triangle represents a Mongolian sheep individual with the CC genotype (249 sheep).

[0090] The results (example) show that there are three genotypes at the g.50277076C>T site of the FASN gene: TT genotype (1 animal), CT genotype (2 animals), and CC genotype (249 animals).

[0091] Example 2: Detection of Polymorphic Distribution of Molecular Markers in Mongolian Sheep Population

[0092] The present invention uses the method shown in Example 1 to detect the polymorphism of the FASN gene g.50277076C>T site in the Mongolian sheep meat sheep breed population. The detection results are shown in Table 4.

[0093] Table 4. Distribution of dominant allele frequencies and allele frequencies of the FASN gene g.50277076C>T locus in Mongolian sheep population.

[0094]

[0095] As shown in Table 4, the g.50277076C>T locus exhibits two genotypes in most meat sheep populations: the CC genotype is more prevalent, while the TT genotype is less prevalent. The dominant allele for the g.50277076C>T locus in meat sheep populations is C.

[0096] Example 3: Association analysis and application of the molecular marker 3g.50277076C>T with fatty acids and fatty acid combinations of Mongolian sheep.

[0097] To determine whether the g.50277076C>T locus is related to the difference in fatty acid content in the longissimus dorsi muscle of Mongolian sheep, polymorphism detection was performed using the method established in Example 1. SPSS 19.0 software was used to analyze the correlation between the two genotypes of the g.50277076C>T locus and the fatty acid content in the longissimus dorsi muscle of Mongolian sheep.

[0098] The steps for extracting fatty acids:

[0099] (1) Tissue collection: Cut and weigh 1 gram of Mongolian sheep muscle tissue, place it in a sterilized and dried glass homogenizing tube with forceps, add a small amount of double-distilled water (less than 1 mL) and manually grind it into a homogenate. Pour the liquid in the homogenizing tube into a 10 mL centrifuge tube, rinse the homogenizing tube with deionized water and add it to the centrifuge tube together, minimizing sample loss during the transfer process. Then add 1.5 mL of chloroform-methanol solution with a ratio of 2:1, mix thoroughly and let stand.

[0100] (2) Centrifuge the centrifuge tube at 4℃, 4000rpm for 5 minutes, and transfer the chloroform layer to a pre-weighed 10mL centrifuge tube. Add 1.5mL of chloroform-methanol solution to the centrifuge tube, mix thoroughly and shake, and centrifuge at 4℃, 4000rpm for 5 minutes. Transfer the upper layer solution obtained by centrifugation to a new centrifuge tube, which is the fat extract.

[0101] (3) Place the 10mL centrifuge tube under the nitrogen blower and blow it until there is no liquid. Then weigh the 10mL centrifuge tube on the electronic balance.

[0102] (4) Add 1 mL of n-hexane solution to the centrifuge tube, shake gently up and down for 30 seconds until the substance on the tube wall is fully dissolved, then add another 1 mL of n-hexane to dissolve it, and let it stand.

[0103] (5) Methylation of the sample: Dissolve the sample in 1 mL of n-hexane, then incubate at 70°C for 5 minutes. Add 3 mL of boron trifluoride methanol solution dropwise to induce methylation. Incubate again at 70°C for 2 minutes to accelerate the methylation of the fat. Immediately place the sample under a nitrogen evaporator to dry it. Draw up 1 mL of n-hexane to the final volume, then add a small amount of anhydrous copper sulfate granules to remove moisture and prevent damage to the gas chromatograph. Transfer the upper phase to a GC vial for analysis of methyl esters.

[0104] The mathematical model used is: Y ijklm =μ+G i +A j +F k +S l +S m +e ijklm ;

[0105] Among them, Y ijklm G represents the observed trait value, μ represents the mean value of the trait, and G represents the observed trait value. i As a genotype effect, A j For the age-related fixed effect, F k For the environmental effects of ranches, S l For the gender effect, S m For family effect, eijklm This is random error.

[0106] Association analysis of two genotypes at the g.50277076C>T locus with fatty acid content was conducted in a Mongolian sheep population. The statistical analysis results are shown in Table 5.

[0107] Table 5. Association analysis of the FASN gene g.50277076C>T site in Mongolian sheep with carcass traits.

[0108]

[0109] Note: Values ​​are expressed as mean ± standard deviation; values ​​with different superscripts in the same column are significantly different when P < 0.05 (a, b), and P < 0.01 (A, B).

[0110] As shown in Table 5, the g.50277076C>T locus contains three genotypes: CC, CT, and TT.

[0111] For g.50277076C>T, the C17:0 level in TT genotype sheep was significantly lower than that in CT and CC genotype sheep (P<0.01), and the SFA level in TT genotype sheep was significantly lower than that in CT and CC genotype sheep (P<0.05); the C18:1n9c level in TT genotype sheep was significantly higher than that in CT and CC genotype sheep (P<0.01), and the C20:3n3 and PUFA levels in TT genotype sheep were significantly higher than those in CT and CC genotype sheep (P<0.05).

[0112] Therefore, it can be concluded that the dominant genotype of the FASN gene g.50277076C>T site in the meat sheep population is TT.

[0113] According to the above-mentioned breeding experiment plan, when implementing molecular marker-assisted breeding aimed at improving the meat quality and meat production performance of Mongolian sheep, the g.50277076C>T gene on the FASN gene of the reserve rams can be detected. Meat sheep individuals carrying the TT genotype at the g.50277076C>T locus of the FASN gene can be selected first. Artificial insemination or natural mating can improve the meat quality of the offspring of Mongolian sheep.

[0114] This invention provides a method for improving the meat quality of offspring sheep, the specific method being as follows:

[0115] S1. Detect the presence of a C>T mutation at nucleotide 50275859 in the non-coding region of the FASN gene in the genomic DNA of the sheep sample:

[0116] To determine the genotype of individual Mongolian sheep at this locus, and to detect the single nucleotide polymorphism of the FASN gene g.50277076C>T locus, so as to compare the polymorphism of the FASN gene g.50277076C>T locus in Mongolian sheep breeds;

[0117] If the 50275859th nucleotide in the non-coding region of the FASN gene is C, the homozygous genotype is CC; if the 50275859th nucleotide is T, the homozygous genotype is TT; and the heterozygous genotype is GC.

[0118] S2. Select meat sheep individuals carrying the FASN gene g.50277076C>T locus with the TT genotype and perform artificial insemination or natural mating.

[0119] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. The use of reagents for detecting SNP molecular markers of the FASN gene in improving the meat quality of mutton sheep, characterized in that, The SNP molecular marker is g.50277076C>T, the mutton sheep is Mongolian sheep, and the genomic sequence of the FASN gene is shown in GenBank ID NC_040262.

1.

2. The application of claim 1, characterized in that, The nucleotide sequence of the specific primer of the g.50277076C>T molecular marker is as follows: SEQ ID NO. 1: ACGTTGGATGTCAGAGTGACCGAAGTACG; SEQ ID NO. 2: ACGTTGGATGCAACTTCCGTTCCGTGCTC; SEQ ID NO. 3: CAAGGACGCCCGTTCCGTTTCCAC.

3. The application of the specific primers of the SNP molecular marker of the FASN gene in improving the meat quality of mutton sheep, characterized in that, The SNP molecular marker is g.50277076C>T; the mutton sheep is Mongolian sheep, and the genomic sequence of the FASN gene is shown in GenBank ID NC_040262.

1. The nucleotide sequence of the specific primer of the g.50277076C>T molecular marker is as follows: SEQ ID NO. 1: ACGTTGGATGTCAGAGTGACCGAAGTACG; SEQ ID NO. 2: ACGTTGGATGCAACTTCCGTTCCGTGCTC; SEQ ID NO. 3: CAAGGACGCCCGTTCCGTTTCCAC.

4. Use according to claim 3, characterized in that, The meat quality is the content of unsaturated fatty acids and the content of beneficial fatty acids.

5. A method of improving the meat quality of mutton sheep, characterised by, The method comprises the following steps: S1, extracting the genomic DNA of the mutton sheep to be tested; S2, using the genomic DNA of the mutton sheep extracted in step S1 as a template, performing PCR amplification with specific primers to obtain an amplification product, wherein, The nucleotide sequence of the specific primer of the g.50277076C>T molecular marker is as follows: SEQ ID NO. 1: ACGTTGGATGTCAGAGTGACCGAAGTACG; SEQ ID NO. 2: ACGTTGGATGCAACTTCCGTTCCGTGCTC; SEQ ID NO. 3: CAAGGACGCCCGTTCCGTTTCCAC. S3, detecting whether a C>T mutation exists at the 50275859th nucleotide in the non-coding region of the FASN gene in the genomic DNA of the mutton sheep to be tested: If the 50277076th nucleotide in the non-coding region of the FASN gene is C, the genotype of the homozygote is CC; if the 50275859th nucleotide is T, the genotype of the homozygote is TT; and the genotype of the heterozygote is CT; Selecting a mutton sheep individual carrying the FASN gene g.50277076C>T site genotype TT for artificial insemination or intrabreed; The mutton sheep is Mongolian sheep, and the genomic sequence of the FASN gene is shown in GenBank ID NC_040262.

1.

6. The method for improving the meat quality of mutton sheep according to claim 5, characterized in that, In step S2, the nucleotide at position 50277076 of the FASN gene on chromosome 11 of the meat sheep to be tested is genotyped by using matrix assisted laser desorption ionization time-of-flight mass spectrometry, and the base type of the nucleotide at position 50277076 is determined.

7. The method for improving the meat quality of mutton sheep according to claim 5, characterized in that, In step S2, the reaction procedure of the PCR method is as follows: the PCR amplification reaction condition is 94 DEG C for 120 seconds, 94 DEG C for 20 seconds, 47.1 DEG C for 30 seconds, 72 DEG C for 60 seconds, 45 cycles, the final extension condition is 72 DEG C for 180 seconds, and the temperature is cycled at 4 DEG C; The SAP digestion reaction condition is 37 DEG C for 40 minutes, 85 DEG C for 50 minutes, and the temperature is cycled at 4 DEG C; The PCR extension reaction condition is 94 DEG C for 30 seconds, 94 DEG C for 5 seconds, 52 DEG C for 5 seconds, 80 DEG C for 5 seconds, finally 72 DEG C for 180 seconds, and the temperature is cycled at 4 DEG C.

8. The method of improving the meat quality of mutton sheep according to claim 5, characterized in that, In step S2, the PCR amplification reaction system comprises 927.5 μL of HPLC grade water, 331.25 μL of 10x PCR Buffer buffer, 172.25 μL of MgCl2, 53 μL of dNTPs and 530 μL of primer Mix; The SAP digestion reaction system comprises 810.9 μL of H2O, 90.1 μL of alkaline phosphatase Buffer and 159 μL of SAP; The PCR extension reaction system comprises 400.2 μL of H2O, 106 μL of 10x iPLEX Buffer plus, 106 μL of iPLEX terminator, 426.1 μL of primer Mix and 21.7 μL of iPlex enzyme.

Images