Molecular breeding method of bombyx mori variety resistant to pyrethroid pesticides

Abstract

The invention discloses a molecular breeding method of a bombyx mori variety resistant to pyrethroid pesticides, which adopts a strategy of combining genetic breeding and molecular marker-assisted breeding and has the following advantages: (1) the molecular marker breeding method is combined with production practice, and by means of molecular marking, hybridization, backcrossing, single-moth directional breeding and the like, the breeding efficiency of the bombyx mori variety resistant to the pyrethroid pesticides is improved; the 'Suhao * Chong' silkworm variety with stable hereditary characters and pyrethroid pesticide resistance is obtained; (2) the 'Suhao * Chong' silkworm variety with the pyrethroid pesticide resistance character bred by the method disclosed by the invention has the advantages that the economic benefit is obviously increased in the subsequent production practice, and the inheritable character is stable; and (3) the method disclosed by the invention can be popularized to introduction of the pyrethroid pesticide resistance character of bombyx mori of other practical varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular breeding, and relates to the introduction of pyrethroid pesticide-resistant traits into an economic silkworm variety "Suhao×Zhongye", and specifically is a molecular breeding method for pyrethroid pesticide-resistant silkworm varieties. Background Art

[0002] The quality of silk cocoons of silkworms is crucial to their economic value. In the process of selecting silkworm varieties, it is necessary to take into account both the quality of silk cocoons and the strength of the silkworm body to ensure that the selected varieties can have stable economic benefits. In the actual production and operation process, silkworm farmers often encounter incidents of silkworms not spinning cocoons due to trace pesticide poisoning. Pyrethroid insecticides have become one of the main culprits of pesticide pollution in mulberry gardens due to their long residual effect, which in turn causes silkworms to not spin cocoons or to spin thin cocoons.

[0003] Previous studies by our research group have found that the silkworm F7 has extremely high tolerance to pyrethroid insecticides, which is dominantly inherited. Compared with conventional varieties, its tolerance to pyrethroid insecticides can reach 100-120 times, making it an ideal material for breeding silkworm varieties resistant to pyrethroid pesticides.

[0004] In the molecular breeding process of animals and plants, the method of molecular marker-assisted breeding is widely used due to its advantages such as simple operation and short breeding cycle. However, whether molecular marker-assisted breeding can successfully improve variety traits while retaining the dominant traits of the original variety is a difficulty in practice. In addition, the selection of molecular markers and the specific amplification primers for detecting the molecular markers are the key to improving the efficiency of molecular marker-assisted breeding. In the prior art, there are many types of molecular markers related to excellent traits in model organisms, but very few of them are actually applied to production practice, and the stability and repeatability between different varieties of the same model organism are poor. Summary of the invention

[0005] Technical problem to be solved: In order to overcome the shortcomings of the prior art, the present invention adopts a strategy of combining genetic breeding with molecular marker-assisted breeding, and in combination with production practice, obtains a "Suhao × Zhongye" silkworm variety with stable genetic traits and resistance to pyrethroid pesticides through molecular marker-assisted breeding, hybridization, backcrossing, single-moth directional breeding and other methods; in view of this, the present invention provides a molecular breeding method for silkworm varieties resistant to pyrethroid pesticides.

[0006] Technical solution: A molecular breeding method for silkworm varieties resistant to pyrethroid pesticides, wherein the method uses the silkworm variety "Su Hao × Zhong Ye" as the female parent and the silkworm variety F7 as the male parent to obtain the G1 generation through hybridization, and then introduces the pyrethroid pesticide-resistant traits of the silkworm F7 variety into the female parent "Su Hao × Zhong Ye" through self-pollination, backcrossing, molecular marker technology screening and pyrethroid pesticide-targeted screening, thereby breeding a silkworm variety resistant to pyrethroid pesticides.

[0007] Preferably, the method is specifically:

[0008] S1, using the silkworm variety "Su Hao × Zhong Ye" as the female parent and the silkworm variety F7 as the male parent, hybridizing to obtain the G1 generation, and then raising them normally;

[0009] The S2 and G1 generations were self-fertilized to obtain the G2 generation, which was raised in a single moth circle. When the third-instar silkworms were raised, 0.1 mg / L deltamethrin was added to the diet. The surviving individuals continued to be raised. At the same time, 30-40 silkworm eggs were taken from each moth circle of the G2 generation, and the genome was extracted. The specific primers for molecular markers of anti-pyrethroid pesticides were used for detection, and the moth circle with dominant homozygous molecular markers was screened out, which was the G3 generation;

[0010] The S3 and G3 generations were reared in the same way as the G2 generation, and the G3 generation female moths were mated with the “Suhao×Zhongye” male moths to produce seeds and obtain the G4 generation;

[0011] The S4 and G4 generations were raised normally, and 0.1 mg / L deltamethrin was added to the diet when the silkworms were third instar. They were backcrossed to the female parent "Su Hao × Zhong Ye" to produce the G5 generation.

[0012] The S5 and G5 generations were raised normally, and 0.1 mg / L deltamethrin was added to the diet when the silkworms were the third instar. They were backcrossed to "Su Hao × Zhong Ye" male moths to produce the G6 generation. The G6 generation was raised in the same way as the G5 generation, and backcrossed to "Su Hao × Zhong Ye" male moths to produce the G7 generation. The G7 generation was self-pollinated to produce seeds, and the G8 generation was produced. 30-40 silkworm eggs were taken from each moth circle of the G8 generation, and the genome was extracted. The specific primers for molecular markers of resistance to pyrethroid pesticides were used for detection, and the moth circles with dominant homozygous molecular markers were screened out. The silkworms were raised in single moth areas, and 0.1 mg / L deltamethrin was added to the diet when the silkworms were the third instar. Their resistance was evaluated according to the method of indirect addition of pesticides, and the breeding areas with excellent resistance were selected. After checking the economic traits, they were self-pollinated to produce seeds, which was the G9 generation. Among them, the indirect addition of pesticides was to randomly take out some silkworm larvae from the breeding area and add pesticides.

[0013] The G8 and G9 generations in S6 and S5 were all raised in multiple samples and single moth areas, and when they were raised to the third instar, they were fed with 0.1 mg / L deltamethrin according to the method of indirect feeding of pesticides to evaluate and identify their ability to resist pyrethroid pesticides, and to select their economic traits;

[0014] S7. After identification and selection in S6, a silkworm variety was obtained that has both the economic traits of the mother parent "Suhao×Zhongye" silkworm variety and the resistance to pyrethroid pesticides of the F7 silkworm variety.

[0015] Furthermore, the anti-pyrethroid pesticide molecular marker is SEQ ID NO: 1, and its specific amplification primers are SEQ ID NO: 2-3. Among them, the anti-pyrethroid pesticide molecular marker is the upstream regulatory sequence of the BmCarE-6 gene of the silkworm F7 variety, and SEQ ID NO: 1 is specifically:

[0016] TCCATGCACTAATCATAACCACAAGTACCACACGTGGAATCAACTAGTTCTCTATAGCA

[0017] AATAATTTTATTAAATACTAGCTGACCCGGCAGACTTCGTAGTGCCTTAATCTATAAAT

[0018] AAAATACCGAAACTTTTGTACAAAATAAACTTAAAACAAACAAAAGGAATCCGTCCGA

[0019] CGTCCGGGGACACATCAAAGGAAAAACAAAATTGTTATTTTTATTTAATTCCGAGCATT

[0020] TTCATATTTATCTACCTTTTAAACCTTCTCTGGACTTCCACAAATAATTCAAGACCAAA

[0021] ATTAGCCAAATCGGTCCAGCCGTTCTCGAGTTTTAACGAGACTAACGAACAGCAATTC

[0022] ATTTTTATATAGACATTGTTGAATTTTGTTAAAATTTGCACAGTTGTCCAGAGAATA

[0023] TTGAAAAACTGTGTGCTTCGTACGAATTTTTTTTTTTTTACGTTTTCGATAATATATAAG

[0024] TTAGCTGAAATTTGTATGGAGTTGGAACGTTTTCCTACGTTTGCGCTGGGGGTGCTGTT

[0025] CCAACTTTTACATTATCGAGAACTTAAAAAAACTCGCGCTAAGCACACTGGAGACTTG

[0026] AGCATTCGGTTGTTGTTAATGTCTACAATGTCTTTTATAAATCTATCCGAAATATTTTGT

[0027] CTTTCAACGGCCGTCTGGTGTAGTGGTAAGTGACATTGTCACTACCTAAGGGGGTCGCG

[0028] GGTTCGAATCCCGCCAAGGGAAGATATTTGTATGATAAATTAATATAAAATGTCTTTTC

[0029] CAGGGTTATGGATGTATATTAATATATTATGTATGTGTATAATAAAAATCTTACATTT

[0030] ATTTCCGTTATCCGGTACCTTTAACACAAGTTCTTTACGATATTATCACGGATCAGTT

[0031] AACGTGGCGTGATTGTTAGTAAATATTTATTTATTATTTATTTTACTCTTATCTTTCACA

[0032] CTGAGACGCAGTCCGTTCTAGAATAACTTAGTCATCCGTGACCATGAAACTTGTAATGC

[0033] ATTCGAACCGTCGGAAAAAAGAAAAAAATGGACGTGATATTAAACAGTAAAATGAATTT

[0034] TATTCGATTATAAATTATGAACGCGAATCCGTATGAACGTCGAAAAATAGAACAATTA

[0035] CGAAACTAAAATTCTTAATTACAAATTAAATTAAAACTCCTTAGACTTATCAAGAAATT

[0036] AGAAACATCATTTGAATTAGTTAATTAGAAAATAAACGGAACACGGCATTTTAATTCTT

[0037] AAACATTTCAGTGACATTGCTATAAATATATATATCGACACTTGAAAGGCAAAAGTGA

[0038] CTAAGCGGCAATAACTGATTTGTACATAAATGATAGGCAATAACCATATTAGATGCGC

[0039] AAAAAAATATATTTCTAGGTCTATTAAAATCATTTCAATCCTACAGCTACACTAGAATCTA.

[0040] SEQ ID NO: 2 is a forward primer for amplifying the sequence of SEQ ID NO: 1, specifically: 5'-TCCATGCACTAATCATAACCA-3'; SEQ ID NO: 3 is a reverse primer for amplifying the sequence of SEQ ID NO: 1, specifically: 5'-TAGATTCTAGTGTAGCTGTAGGA-3'.

[0041] Furthermore, the anti-pyrethroid pesticide molecular marker is SEQ ID NO: 4, and its specific amplification primers are SEQ ID NO: 5-6. Among them, the anti-pyrethroid pesticide molecular marker is the upstream regulatory sequence of the BmGST-2 gene of the silkworm F7 variety, and SEQ ID NO: 4 is specifically:

[0042] GTGTAGAACAAGGATTCCCCAAGGTGATTGTCCAGAGATCAACTTAATCGAAAATTGA

[0043] TTTTGTGTGTCGACGAGGTCTAAAAATCTGAGGTATCAAATTATTTTGGAAAAGGAGTC

[0044] TTTTACCCAAAATGATTTGGGAATCCCTGATGTCGATTCTACAGACTTTTGGAATTGCT

[0045] TGTGTAGGCTTTAATATTACTGTGCAATGCAGAAACTGACGAACATGTAAATTTGACCA

[0046] TATCATCGTAACGTAGTGTTTATATACATTCTATTTAACTCTCTCGCTTGTTTTACAGAA

[0047] CCGCTGGCTCCAAGTACGTCAATAAAGATTCATTCAGTCAATCAAAATGGAACGTGTA

[0048] GACCGAACGTAGAACATTAAAAATATGTGAAGAAGTGAACCTCACCACTCCAAGATGA

[0049] ATGAACAATAAGAGCAAATTAAAATTACATGTCATAGATAATAAATACATGTATTTTA

[0050] TTTATTGAATGCGTAGATATGTAACGAAATTTTAATAAAAACATGATAACTTCCACTGTAAGTCTGGCCATGCACCTAATATATTCGTCGTTTCAAGGTGTTCGAGTTATCAGTC.

[0051] SEQ ID NO:5 is a forward primer for amplifying the sequence of SEQ ID NO:4, specifically: 5'-GTGTAGAACAAGGATTCCCC-3'; SEQ ID NO:6 is a reverse primer for amplifying the sequence of SEQ ID NO:4, specifically: 5'-GACTGATAACTCGAACACCTT-3'.

[0052] Furthermore, the anti-pyrethroid pesticide molecular marker is SEQ ID NO: 7, and its specific amplification primers are SEQ ID NO: 8-9. Among them, the anti-pyrethroid pesticide molecular marker is the upstream regulatory sequence of the BmCXE-26 gene of the silkworm F7 variety, and SEQ ID NO: 7 is specifically:

[0053] GAAAGAAAACGGAGCTCTAACCTGGGACGATGCTAACACTAGCCCTAGCAAGAGCAG

[0054] CGCTTCTCAGATGAGAACAAAGATACACTGAAAGGCTTTATATACGAATTGCGCTAAC

[0055] AAAATTATGACTAAACATAATCTTCAGCTGTGAAGGCCGGGACAAGAAATGCAGTAAA

[0056] AAAGTACTTAACGCAAAATTGTAAACAGCTTGTATTACAAATTAAAGTTAACCTAAGG

[0057] ATTTTAAATATGCTTGAAGGTCAGTGTAGTAATTAGAACTAAAACGCGAGAAGTAGAC

[0058] GTGTGTGTAATATTGTGTAAAACTATAAAAAATAAAGAAACTTATCAGACATTGTCCG

[0059] AGACTAGGTAAAAGTAACGTTATCTATATATAAATTATCGTGACCTTCGTTTGTATCAA

[0060] CGTGACTAAATTGATCGCTTGACTTTTAAATGCGAGTTAAGTTCATTGCATTTCAAATG

[0061] CAAAGTACCTTAATTGTTTTGTAATAATTACATATTTTTACTGTTTTTTTATTGCTTAGA

[0062] TGAGTGGATGAGCTCACAGCCCACCTGGTGTTAAGTGGTCACTGGAGGCCCATAGACAT

[0063] CTACAACATAAATGCGCCACCCCACCCACCATCAATGTTCATTTGCATTTTTCCTTGTTTG

[0064] TCCTCTGCTTTGTGAGGACTCTCGGTTGGATTTAAAAGAAAGGGTTTAACATAGTACCA

[0065] TCAACTGATGACGCGCGAGTACTTTGAAGAAATCGATGTTTTTCTTACGATTAGCGTTG

[0066] ATCTTATCGGAGTGAGGATCTCACTATTTTTTTTATATTATACATAAACAATAAACTAG

[0067] ATAAAAAACGTCTATCACCCTACATTTATAATATTTGGTAGCCAATACTTTTAAGAGTC

[0068] AGACTTTGTTCAGGTGCACATTTTTAATGAAGTACCTTAACGTCATATTGTTTTATAATT

[0069] TACTATCTACTTCGGTTCCGGTCCAAAGAGTAATACAAAAGCTATTGAGTATATCTTAT

[0070] ACCTCAAGGTGGAAAATAGTACTCACGGTACATTAACAAAAAAATATTTCATATTTGA

[0071] TTCGTTTATCCGTTGTTCTTAAAATTTAACAAAACTGTCTCAGAACATATTGGCCAACTT

[0072] GATCTGAGACCTTGATCAACATTACGTTACAACGAACTAGTATCTTCTGCTAAATTTGG

[0073] CAGATATTACCAACATGTCATTTACAATTTTACAATGTCAAGATCAAGAAACTACCGTTTGGCAAATAACCAATTGATCAAAATCCAGTACACCGTTTGAAAAGCGAATC.

[0074] SEQ ID NO: 8 is a forward primer for amplifying the sequence of SEQ ID NO: 7, specifically: 5'-GAAAGAAAACGGAGCTCTAAC-3'; SEQ ID NO: 9 is a reverse primer for amplifying the sequence of SEQ ID NO: 7, specifically: 5'-GATTCGCTTTTCAAACGGTG-3'.

[0075] Furthermore, the anti-pyrethroid pesticide molecular marker is SEQ ID NO: 10, and its specific amplification primers are SEQ ID NO: 11-12. Wherein, the anti-pyrethroid pesticide molecular marker is the upstream regulatory sequence of the BmCYP4C1 gene of the silkworm F7 variety, and SEQ ID NO: 10 is specifically:

[0076] TTAACAGTTTCACAGGCGATGTACAGGCCTTTAGTCTTAACAGTAAGCCTCTGATACGC

[0077] CCTTTCGGTTGCCACTTGGAGGTTGCATCGCCGACTCTTAGGGCCCGCGTTCAGTCAG

[0078] CGGGTGCTCAATGGTTTCATCAGTGCTTTCAACTGCAAGTCGAGGGCGCTCGTCACCCA

[0079] GCTGGAGGACCGGGTCGGGCGAGGGCCTTTCGACCACGTCCCCTACCTGTCCTTCAAT

[0080] AACTTGGAAACTATATGTCGTGAGTATTCATGTTTTTTTTTATTGCTTAGATGAGCGTTC

[0081] AAGCTCATAGCTCACCTGGTGTTAAGTGGTTACTGGAGCCCATAGACATTTACAACGTA

[0082] CCACCCACCTTGAGATGTAAGTTGTAAGGTCTCAGTATAGTTACAACGGCTGCCCCACC

[0083] CTTCGAACCGAAACGCATTACTGCTTCACGGCAGAAACAGGCATGGTGGTGGTACCCA

[0084] CCCGCGCGGACTCACATGAGGTCCCACCACCATGCGCGGCGCTCTCTCGCAGCTTTTTC

[0085] AATTCAGTGCAGTATTGCAGCTATGTTCGTTCGCGTTAAGAATGCAGTTAATTATCATT

[0086] GTTCGCCGCCTCCTAACCAATCAAATCTTTTCAAATTACAAGGTCAAGTTCACAGTGAC

[0087] CAGTTGAAAGCACAGCTTCGAACGCGACGGTTGTGTCCTATAATTGTGTTAACTGATTT

[0088] ATATTTAAAAAAATGAATACCTCACCAATTCGTAAAAATAAAAGTGGTTCGTAATTCA

[0089] CAGTGGGGCAGAAAAGTTACAATGTTTTAAAGTATTTTAAACAGTCTGATTTAAATGTG

[0090] ACTGTGGACAGCATAGGACAAATATTTTATAACGCAATTTGGTTAGCGCTGATCGATG

[0091] GAAGAAATGCCGCGAACCACGTCTTGCAAGAAGAAAATACCATGTGGTGTTTAGATGA

[0092] TGTCATGGAACTCGCTAGTCGGCATCGATGCGCATTTCGACAAAGCGGCACGACACG

[0093] AGAGCCCTTCCATCGTGGCCGTCGGTAACTACATTCCCGATCCTACGGACAGAATGGA

[0094] AAGCAGTCGATGTCGCCCAAAACACGTCATTTCGGATCCTCCCGATCCAATAACGGGG

[0095] CTTTTAGGTACCTCAAGCACCGGTTACCGTTCTCGTCGAACCCGTGCCTTGCGACGAAG

[0096] GGCTCGACGAGTAAATTAACCCTCAGACACAGCCCACTGCGTTTCTCGCCGGATCTTTCT

[0097] CAGTGGGTCGCGTTGCCGGTCCAGTGGTAGATTCTGCGAAGCACTGCTCTTGCTAGGGT

[0098] TCGTGTTAGCAACGTCATCAGGTTTGAGCCCCGCGAGCTCACCTACTAGTTAAGGTTCC

[0099] GCTGGTATAGCCTCTCAAGGCTATCAGCTTAGGTAGGAAAAAAAAGAAAAACTCTTGTG

[0100] CAGAAAATTAATTTATTATAAATACTAACGAGGACACTTTAAGCTCATTAAACTTAATC

[0101] TTTAAGAATATAATTGTTTCAATGTTCACACCACTGTGAAAACACCTTTACCCTTCAGTTGC。

[0102] SEQ ID NO: 11 is a forward primer for amplifying the sequence of SEQ ID NO: 10, specifically: 5'-TTAACAGTTTCACAGGCGAT-3'; SEQ ID NO: 12 is a reverse primer for amplifying the sequence of SEQ ID NO: 10, specifically: 5'-GCAACTGAAGGGTAAAGGTG-3'.

[0103] Beneficial effects: (1) The molecular marker breeding method of the present invention, combined with production practice, obtains the "Suhao × Zhongye" silkworm variety with stable genetic traits and resistance to pyrethroid pesticides through molecular markers, hybridization, backcrossing, single-moth directional breeding and other methods; (2) The "Suhao × Zhongye" silkworm variety with pyrethroid pesticide resistance trait bred by the method of the present invention has significantly increased economic benefits in subsequent production practice, and the genetic traits are stable; (3) The method of the present invention can be extended to the introduction of pyrethroid pesticide resistance traits in other practical varieties of silkworms. BRIEF DESCRIPTION OF THE DRAWINGS

[0104] Figure 1 The present invention is a flow chart of the molecular breeding method for silkworm varieties resistant to pyrethroid pesticides.

[0105] Figure 2 It is an electrophoresis diagram of the presence of the anti-pyrethroid pesticide molecular marker SEQ ID NO: 1 in the silkworm F7 variety and the Dazao variety; wherein M is DL2000 Marker, 1 is F7, and 2 is Dazao.

[0106] Figure 3 This is an electrophoresis diagram of the existence form of the pyrethroid pesticide resistance molecular marker SEQ ID NO: 1 after the "Suhao × Zhongye" variety was introduced into the F7 lineage; wherein, M is DL2000 Marker, 1 is F7, 2 is the Chinese mother strain 1 of the "Suhao × Zhongye" introduced into the F7 lineage, 3 is the Chinese mother strain 2 of the "Suhao × Zhongye" introduced into the F7 lineage, 4 is the Japanese mother strain 1 of the "Suhao × Zhongye" introduced into the F7 lineage, and 5 is the Japanese mother strain 2 of the "Suhao × Zhongye" introduced into the F7 lineage.

[0107] Figure 4 This is an electrophoresis diagram of the existence form of the anti-pyrethroid pesticide molecular marker SEQ ID NO: 1 in F7 and "Suhao×Zhong Ye"; wherein, M is DL2000 Marker, 1 is F7, 2 is the Chinese mother strain 1 of "Suhao×Zhong Ye", 3 is the Chinese mother strain 2 of "Suhao×Zhong Ye", 4 is the Japanese mother strain 1 of "Suhao×Zhong Ye", and 5 is the Japanese mother strain 2 of "Suhao×Zhong Ye".

[0108] Figure 5This is the screening result of the G3 generation molecular marker SEQ ID NO:1; the red marked part is the dominant homozygous progeny.

[0109] Figure 6 This is the screening result of the molecular marker SEQ ID NO:1 of the G8 generation; the red marked part is the dominant homozygous progeny.

[0110] Figure 7 It is an electrophoretic diagram of the presence of the pyrethroid-resistant insecticide molecular marker SEQ ID NO: 4 in the silkworm F7 variety and the Dazao variety; wherein M is DL2000 Marker, 1 is F7, and 2 is Dazao.

[0111] Figure 8 This is an electrophoresis diagram of the presence form of the pyrethroid-resistant insecticide molecular marker SEQ ID NO: 4 after the "Su Hao × Zhong Ye" variety was introduced into the F7 pedigree; wherein, M is DL2000 Marker, 1 is F7, 2 is the Chinese mother strain 1 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, 3 is the Chinese mother strain 2 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, 4 is the Japanese mother strain 1 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, and 5 is the Japanese mother strain 2 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree.

[0112] Fig. 9 It is an electrophoretic diagram of the presence of the pyrethroid-resistant insecticide molecular marker SEQ ID NO: 7 in the silkworm F7 variety and the Dazao variety; wherein M is DL2000 Marker, 1 is F7, and 2 is Dazao.

[0113] Fig.10 This is an electrophoresis diagram of the presence form of the pyrethroid-resistant insecticide molecular marker SEQ ID NO: 7 after the "Su Hao × Zhong Ye" variety was introduced into the F7 pedigree; wherein, M is DL2000 Marker, 1 is F7, 2 is the Chinese mother strain 1 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, 3 is the Chinese mother strain 2 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, 4 is the Japanese mother strain 1 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, and 5 is the Japanese mother strain 2 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree.

[0114] Fig.11 It is an electrophoretic diagram of the presence of the pyrethroid-resistant insecticide molecular marker SEQ ID NO: 10 in the silkworm F7 variety and the Dazao variety; wherein M is DL2000 Marker, 1 is F7, and 2 is Dazao.

[0115] Fig.12This is an electrophoresis diagram of the presence form of the pyrethroid-resistant insecticide molecular marker SEQ ID NO: 10 after the "Su Hao × Zhong Ye" variety was introduced into the F7 pedigree; wherein, M is DL2000 Marker, 1 is F7, 2 is the Chinese mother strain 1 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, 3 is the Chinese mother strain 2 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, 4 is the Japanese mother strain 1 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree, and 5 is the Japanese mother strain 2 of the "Su Hao × Zhong Ye" introduced into the F7 pedigree. DETAILED DESCRIPTION

[0116] The following examples further illustrate the content of the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and essence of the present invention, modifications and substitutions made to the method, steps or conditions of the present invention all belong to the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0117] Example 1 Identification and application of the pyrethroid pesticide resistance molecular marker SEQ ID NO: 1 of silkworm F7 variety

[0118] The silkworm F7 variety, supplemented with 0.1 mg / L deltamethrin (dry leaf method), induced the BmCarE-6 gene to be significantly upregulated. Therefore, the upstream regulatory sequence (SEQ ID NO: 1) of the BmCarE-6 gene of the silkworm F7 variety was cloned and analyzed, and the specific amplification primers were: SEQ ID NO: 2-3. The silkworm F7 silkworm egg genome was used as the amplification template, and the PCR reaction conditions were: 94℃ pre-denaturation for 4 minutes, then 94℃ denaturation for 40 seconds, 58℃ annealing for 40 seconds, 72℃ extension for 1min40s, a total of 35 cycles, and finally 72℃ extension for 10 minutes; according to the TA cloning method, the PCR product was recovered and connected to the pMD19-T vector, and then the DH5α competent cells were transformed according to the steps, and the positive clones verified by bacterial liquid PCR were sent to Zhejiang Shangya Biotechnology Co., Ltd. for sequencing. The upstream regulatory sequence (1414bp) of the silkworm F7 variety BmCarE-6 was obtained by sequencing. Bioinformatics analysis showed that the upstream regulatory sequence of the silkworm F7 variety BmCarE-6 had a continuous large fragment deletion of 683 bp in size compared with the large variety ( Figure 2 ). Through the analysis of the tolerance mechanism of pyrethroid insecticides in silkworm F7, it was found that silkworm F7 forms pyrethroid insecticide resistance by up-regulating the expression of detoxification enzyme genes, and the resistance of silkworm F7 is dominant. Therefore, the upstream regulatory sequence of silkworm F7 variety BmCarE-6 is suitable as a molecular marker for resistance breeding.

[0119] By hybridization, the resistance to pyrethroid insecticides of the silkworm F7 variety was introduced into the female parent of the economic silkworm variety "Suhao × Zhongye". The molecular biological detection results of silkworm eggs after hybridization showed that the genomic molecular markers were all present in a heterozygous form (that is, there were complete large fragments and missing small fragments) ( Figure 3 ), in the parent copy of "Su Hao × Zhong Ye", it exists as a complete large fragment ( Figure 4 ).

[0120] Example 2 Molecular breeding method for silkworm varieties resistant to pyrethroid pesticides

[0121] like Figure 1 As shown, the method comprises the following steps:

[0122] S1, using the silkworm variety "Su Hao × Zhong Ye" as the female parent and the silkworm variety F7 as the male parent, hybridizing to obtain the G1 generation, and then raising them normally;

[0123] The S2 and G1 generations were self-fertilized to obtain the G2 generation, which was raised in a single moth circle. When the third-instar silkworms were raised, 0.1 mg / L deltamethrin was added to the diet. The surviving individuals continued to be raised. At the same time, 30-40 silkworm eggs were taken from each moth circle of the G2 generation, and the genome was extracted. The specific primers for molecular markers of anti-pyrethroid pesticides were used for detection, and the moth circle with dominant homozygous molecular markers was screened out, which was the G3 generation;

[0124] The S3 and G3 generations were reared in the same way as the G2 generation, and the G3 generation female moths were mated with the “Suhao×Zhongye” male moths to produce seeds and obtain the G4 generation;

[0125] The S4 and G4 generations were raised normally, and 0.1 mg / L deltamethrin was added to the diet when the silkworms were third instar. They were backcrossed to the female parent "Su Hao × Zhong Ye" to produce the G5 generation.

[0126] The S5 and G5 generations were raised normally, and 0.1 mg / L deltamethrin was added to the diet when the silkworms were raised at the third instar. The male moths of "Su Hao × Zhong Ye" were backcrossed to produce the G6 generation. The G6 generation was raised in the same way as the G5 generation, and the male moths of "Su Hao × Zhong Ye" were backcrossed to produce the G7 generation. The G7 generation was self-pollinated to produce seeds, and the G8 generation was produced. 30-40 silkworm eggs were taken from each moth circle of the G8 generation, and the genome was extracted. The specific primers for molecular markers of resistance to pyrethroid pesticides were used for detection, and the moth circles with dominant homozygous molecular markers were screened out, and the silkworms were raised in a single moth area. When the silkworms were raised at the third instar, 0.1 mg / L deltamethrin was added to the diet. The resistance was evaluated according to the method of indirect feeding of pesticides (taking some silkworms from the feeding area to feed pesticides), and the breeding area with excellent resistance was selected. After checking the economic traits, the silkworms were self-pollinated to produce seeds, which was the G9 generation.

[0127] The G8 and G9 generations in S6 and S5 were all raised in multiple samples and single moth areas, and when they were raised to the third instar, they were fed with 0.1 mg / L deltamethrin according to the method of indirect feeding of pesticides to evaluate and identify their ability to resist pyrethroid pesticides, and to select their economic traits;

[0128] S7. After identification and selection in S6, a silkworm variety was obtained that has both the economic traits of the mother parent "Suhao×Zhongye" silkworm variety and the resistance to pyrethroid pesticides of the F7 silkworm variety.

[0129] The anti-pyrethroid pesticide molecular marker is SEQ ID NO: 1, and its specific amplification primers are SEQ ID NO: 2-3.

[0130] Example 3 Identification and application of the pyrethroid pesticide resistance molecular marker SEQ ID NO: 4 of silkworm F7 variety

[0131] The difference from Example 1 is that the anti-pyrethroid pesticide molecule marker is the upstream regulatory sequence of the BmGST-2 gene (SEQ ID NO: 4), and the specific primers for amplifying the upstream regulatory sequence are SEQ ID NO: 5-6. The test results of this example are as follows: Figure 7-8 shown.

[0132] Example 4

[0133] The difference from Example 2 is that the anti-pyrethroid insecticide molecular marker is SEQ ID NO: 4, and its specific amplification primers are SEQ ID NO: 5-6.

[0134] Example 5 Identification and application of the pyrethroid pesticide resistance molecular marker SEQ ID NO: 7 of the silkworm F7 variety

[0135] The difference from Example 1 is that the anti-pyrethroid pesticide molecule marker is the upstream regulatory sequence of the BmCXE-26 gene (SEQ ID NO: 7), and the specific primers for amplifying the upstream regulatory sequence are SEQ ID NO: 8-9. The test results of this example are as follows: Figure 9-10 shown.

[0136] Example 6

[0137] The difference from Example 2 is that the anti-pyrethroid pesticide molecule marker is SEQ ID NO: 7, and its specific amplification primers are SEQ ID NOs: 8-9.

[0138] Example 7 Identification and application of the pyrethroid pesticide resistance molecular marker SEQ ID NO: 10 of the silkworm F7 variety

[0139] The difference from Example 1 is that the anti-pyrethroid insecticide molecule marker is the upstream regulatory sequence of the BmCYP4C1 gene (SEQ ID NO: 10), and the specific primers for amplifying the upstream regulatory sequence are SEQ ID NO: 11-12. The test results of this example are as follows: Figure 11-12 shown.

[0140] Example 8

[0141] The difference from Example 2 is that the anti-pyrethroid insecticide molecular marker is SEQ ID NO: 10, and its specific amplification primers are SEQ ID NOs: 11-12.

[0142] Example 9

[0143] After the G10 generation was raised, its resistance to pyrethroid pesticides and practical economic traits were investigated. F7 and "Suhao×Zhongye" were used as the control group. The results are shown in Table 1-2.

[0144] Table 1 Survey results of economic traits of G10 generation

[0145]

[0146] Table 2 Results of the survey on resistance to G10 deltamethrin pesticide

[0147]

Claims

1. A molecular breeding method for silkworm varieties resistant to pyrethroid pesticides, characterized in that: The method uses the silkworm variety "Su Hao × Zhong Ye" as the female parent and the silkworm variety F7 as the male parent to obtain the G1 generation through hybridization, and then introduces the pyrethroid pesticide resistance characteristics of the silkworm F7 variety into the female parent "Su Hao × Zhong Ye" through self-pollination, backcrossing, molecular marker technology screening and pyrethroid pesticide directional screening, so as to cultivate a silkworm variety with pyrethroid pesticide resistance.

2. The molecular breeding method for silkworm varieties resistant to pyrethroid pesticides according to claim 1, characterized in that: The method is specifically as follows: S1, using the silkworm variety "Su Hao × Zhong Ye" as the female parent and the silkworm variety F7 as the male parent, hybridizing to obtain the G1 generation, and then raising them normally; The S2 and G1 generations were self-fertilized to obtain the G2 generation, which was raised in a single moth circle. When the third-instar silkworms were raised, 0.1 mg / L deltamethrin was added to the diet. The surviving individuals continued to be raised. At the same time, 30-40 silkworm eggs were taken from each moth circle of the G2 generation, and the genome was extracted. The specific primers for molecular markers of anti-pyrethroid pesticides were used for detection, and the moth circle with dominant homozygous molecular markers was screened out, which was the G3 generation; The S3 and G3 generations were reared in the same way as the G2 generation, and the G3 generation female moths were mated with the "Su Hao × Zhong Ye" male moths to produce seeds and obtain the G4 generation; The S4 and G4 generations were raised normally, and 0.1 mg / L deltamethrin was added to the diet when the silkworms were third instar. They were backcrossed to the "Su Hao × Zhong Ye" female parent to produce the G5 generation. The S5 and G5 generations were raised normally, and 0.1 mg / L deltamethrin was added to the diet when the silkworms were raised at the third instar. The male moths of "Su Hao × Zhong Ye" were backcrossed to produce the G6 generation. The G6 generation was raised in the same way as the G5 generation, and the male moths of "Su Hao × Zhong Ye" were backcrossed to produce the G7 generation. The G7 generation was self-pollinated to produce seeds, and the G8 generation was produced. 30-40 silkworm eggs were taken from each moth circle of the G8 generation, and the genome was extracted. The specific primers for molecular markers of resistance to pyrethroid pesticides were used for detection, and the moth circles with dominant homozygous molecular markers were screened out, and the moths were raised in single moth areas. When the silkworms were raised at the third instar, 0.1 mg / L deltamethrin was added to the diet. The insecticide resistance was evaluated according to the method of indirect feeding of pesticides, and the breeding area with excellent insecticide resistance was selected. After checking the economic traits, the seeds were self-pollinated to produce the G9 generation. The G8 and G9 generations in S6 and S5 were all raised in multiple samples and single moth areas, and when they were raised to the third instar, they were fed with 0.1 mg / L deltamethrin according to the method of indirect feeding of pesticides to evaluate and identify their ability to resist pyrethroid pesticides, and to select their economic traits; S7. After identification and selection in S6, a silkworm variety was obtained that has both the economic traits of the mother parent "Su Hao × Zhong Ye" silkworm variety and the resistance to pyrethroid pesticides of the F7 silkworm variety.

3. The molecular breeding method for silkworm varieties resistant to pyrethroid pesticides according to claim 2, characterized in that: The anti-pyrethroid pesticide molecular marker is SEQ ID NO: 1, and its specific amplification primers are SEQ ID NO: 2-3.

4. The molecular breeding method for silkworm varieties resistant to pyrethroid pesticides according to claim 2, characterized in that: The anti-pyrethroid pesticide molecular marker is SEQ ID NO: 4, and its specific amplification primers are SEQ ID NO: 5-6.

5. The molecular breeding method for silkworm varieties resistant to pyrethroid pesticides according to claim 2, characterized in that: The anti-pyrethroid pesticide molecular marker is SEQ ID NO: 7, and its specific amplification primers are SEQ ID NO: 8-9.

6. The molecular breeding method for silkworm varieties resistant to pyrethroid pesticides according to claim 2, characterized in that: The anti-pyrethroid pesticide molecular marker is SEQ ID NO: 10, and its specific amplification primers are SEQ ID NO: 11-12.

Images