Application of LtPCL6 protein and coding gene thereof in regulation and control of pathogenicity, mycelial growth and adversity resistance of Halodiplodia theobromae

Abstract

The invention discloses an application of an LtPCL6 protein and a coding gene thereof in regulation and control of pathogenicity, mycelial growth and adversity resistance of trichodiplodia theobromae. The LtPCL6 protein coding gene disclosed by the invention is derived from lasiodiplodia theobroma, and a knockout mutant is obtained by constructing a knockout gene segment of the lasiodiplodia theobroma LtPCL6 gene and introducing the knockout gene segment into a protoplast of the lasiodiplodia theobroma. Experiments discover that the LtPCL6 gene plays a role in growth of the colletotrichum cacao, completeness of cell walls and cell membranes and adversity resistance, and the pathogenicity of the colletotrichum cacao to hosts is remarkably reduced. Therefore, the LtPCL6 can be used as a bactericide target and a key protein of a disease pathogenic mechanism to research and develop a medicament for diseases caused by the infection of the trichosporon theobromae and cultivate a new disease-resistant variety, and has a wide application prospect in prevention and treatment of plant pathogenic fungal diseases.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to the application of LtPCL6 protein and its encoding gene in regulating the pathogenicity, hyphae growth and resistance to adversity of Lasiosporium cocoi. Background Art

[0002] Lasiodiplodia theobromae belongs to the Eumycetes, Ascomycota, Loculoascomycetes, Botryosphaeriales, Botryosphaeriaceae, and the genus Lasiodiplodia. The fungus is widely distributed and has a variety of hosts. It can cause diseases in tea, eggplant, kiwi, grape, pitaya, mango, and blueberry plants. The pathogen can cause leaf spot, rot, ulcer, branch dieback and / or leaf blight on plants (Li DX, Bao XT, Ren YF, Song BA, Chen Z. 2018. First report of Lasiodiplodia theobromae causing leafspot on tea plant in Guizhou Province of China. Plant Dis. 103(2):374. Vieira J. CB, Camara MPS, Bezerra JDP, Motta CMS, Machado AR 2018. First Report of Lasiodiplodia theobromae causing rot in eggplant fruit in Brazil. Plant Dis. 102(10):2039. Zhou Y., Gong GS, Cui YL, Zhang DX, Chang X. L., Hu RP, Liu N., Sun XF 2015. Identification of Botryosphaeriaceae species causing kiwifruit rot in Sichuan Province, China. Plant Dis. 103(2):374. Dis.99(5):699-708.Xing Q., Zhou X., Cao Y., Peng J., Zhang W., Wang X., Wu J., Li X., Yan J.2023.The woodyplant-degrading pathogen Lasiodiplodia theobromae effector LtCre1 targets thegrapevine sugar-signaling protein VvRHIP1 to suppress host immunity.J ExpBot.74(8):2768-2785.Ganesan GS,Kumari N.,Sahu S.,Pattanaik M.,KishoreK.2023.Identification of Lasiodiplodia species inciting stem rot of dragonfruit in India through polyphasic approach.3Biotech.13(10):333.El Komy MH,Ibrahim YE,Al-Saleh MA2022.First report of Lasiodiplodia theobromaecausing dieback,a destructive disease on Mango trees in Saudi Arabia.PlantDis.107:563.). Among them, Diplodia theobromin (China General Microbial Culture Collection Center Collection Number: CGMCC3.20151) was isolated and identified by the research group of the inventor from tea leaf spot disease in Qilichong Tea Farm, Huishui County, Guizhou Province. Since the pathogen can infect new shoots, young leaves and mature leaves of tea trees, seriously affecting the quality and yield of tea leaves, it is necessary to screen highly active agents and formulate comprehensive prevention and control measures for the disease (Li DX, Bao XT, Ren YF, Song BA, Chen Z. 2018. First report of Lasiodiplodia theobromae causing leaf spot on tea plant in Guizhou Province of China. Plant Dis. 103(2): 374. Ren Yafeng, Bao Xingtao, Li Dongxue, Wang Yong, Wang Delu, Song Baoan, Chen Zhuo. Identification of Lasiodiplodia theobromae, the pathogen of tea leaf spot disease. Acta Phytopathologica Sinica, 2019, 49: 857-861. Bao XT, Yang R., Jiang SL, Zhao JP, Wang DL, Li DX, Wu X., Song BA, Chen Z.Anovel sulfone derivative controls Lasiodiplodia theobromae in tea leaf spot by reducing the ergosterol content. Mol Plant Microbe Interact. 2021. 34 (8): 922-938.). So far, the molecular biology research on the pathogen of Lasiodiplodia theobromae at home and abroad is still relatively weak, especially the lack of reports on the pathogenic mechanism of the pathogen. .

[0003] Studies have shown that Diplodia theobromin successfully infects tea leaves through multiple pathogenic factors. Therefore, fully exploring the pathogenicity-related genes of Diplodia theobromin and conducting functional studies will help to fully understand the pathogenicity of Diplodia theobromin, provide a theoretical basis for the prevention and control of diseases caused by Diplodia theobromin, and provide guidance for effectively controlling the damage of the disease and breeding disease-resistant varieties. Summary of the invention

[0004] In view of this, one of the objects of the present invention is to provide a new use of the LtPCL6 protein derived from Lasiodiplodia theobromae, that is, any one of the following uses of the LtPCL6 protein 1)-6):

[0005] 1) Regulate the pathogenicity of Lactodiella theobroma cacao;

[0006] 2) regulating the hyphal growth of Diplosporus theobrominum;

[0007] 3) Regulate the cell wall integrity of Lactodiella theobroma cacao;

[0008] 4) Regulate the cell membrane integrity of Diplococcidis theobrominata;

[0009] 5) Regulate the stress resistance of theobroma cacao;

[0010] 6) Design and screen antifungal drugs;

[0011] The LtPCL6 protein is the protein shown in A1) or A2) below:

[0012] A1) The amino acid sequence is the protein shown in SEQ ID NO.3;

[0013] A2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO.3.

[0014] In order to solve the above technical problems, the present invention further provides new uses of biomaterials related to LtPCL6 protein.

[0015] The second object of the present invention is to provide any application of the biomaterial related to LtPCL6 protein in the following 1)-6):

[0016] 1) Regulate the pathogenicity of Lactodiella theobroma cacao;

[0017] 2) regulating the growth of hyphae of Diplospora cocoi;

[0018] 3) Regulate the cell wall integrity of Lactodiella theobroma cacao;

[0019] 4) Regulate the cell membrane integrity of Diplococcidis theobrominata;

[0020] 5) Regulate the stress resistance of theobroma cacao;

[0021] 6) Design and screen antifungal drugs;

[0022] The biological material is any one of the following A1) to A8):

[0023] A1) a nucleic acid molecule encoding a LtPCL6 protein;

[0024] A2) an expression cassette containing the nucleic acid molecule described in A1);

[0025] A3) a recombinant vector containing the nucleic acid molecule described in A1);

[0026] A4) a recombinant vector containing the expression cassette described in A2);

[0027] A5) a recombinant microorganism containing the nucleic acid molecule described in A1);

[0028] A6) a recombinant microorganism containing the expression cassette described in A2);

[0029] A7) a recombinant microorganism containing the recombinant vector described in A3);

[0030] A8) A recombinant microorganism containing the recombinant vector described in A4).

[0031] In the above application, the nucleotide sequence of the nucleic acid molecule in A1) is shown in SEQ ID NO. 1 or SEQ ID NO. 2. The nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA, or RNA, such as mRNA or hnRNA.

[0032] In the above applications, the vector may be a plasmid, a cosmid, a phage or a virus vector; the microorganism may be a yeast, a bacterium, an algae or a fungus, such as Agrobacterium.

[0033] The third object of the present invention is to provide the application of the above-mentioned LtPCL6 protein as a target in the design and screening of antifungal drugs.

[0034] The fourth object of the present invention is to provide the use of the above-mentioned LtPCL6 protein or the above-mentioned biological material in cultivating transgenic Lactodiella cacao with reduced pathogenicity and / or reduced mycelial growth ability and / or reduced cell wall integrity and / or reduced cell membrane integrity and / or reduced resistance to adversity.

[0035] The fifth object of the present invention is to provide a method for cultivating transgenic cocoa hairy spores with reduced pathogenicity and / or reduced mycelial growth ability and / or reduced cell wall integrity and / or reduced cell membrane integrity and / or reduced resistance to adversity, comprising the step of reducing the expression amount and / or activity of the above-mentioned LtPCL6 protein in the recipient cocoa hairy spores to obtain transgenic cocoa hairy spores. The transgenic cocoa hairy spores have lower pathogenicity and / or mycelial growth ability and / or cell wall integrity and / or cell membrane integrity and / or resistance to adversity than the recipient cocoa hairy spores.

[0036] Preferably, the method for reducing the expression level and / or activity of the LtPCL6 protein in the recipient Diplodia theobromin is achieved by knocking out, inhibiting or silencing the expression of the gene encoding the LtPCL6 protein in the recipient Diplodia theobromin.

[0037] Preferably, the homologous recombination method can be used to knock out the gene encoding the LtPCL6 protein in the recipient Diplosporus theobrominus.

[0038] Preferably, the method of knocking out the gene encoding the LtPCL6 protein in the recipient Diplodia theobromina by homologous recombination is to introduce a homologous recombination fragment for homologous recombination into the protoplasts of the recipient Diplodia theobromina.

[0039] The sixth object of the present invention is to provide the application of the above method in preventing and controlling diseases caused by the fungus Lactodiplodia theobroma.

[0040] The present invention provides an application of LtPCL6 protein derived from Lasiodiplodia theobromae and its encoding gene in regulating the pathogenicity, hyphal growth, cell wall integrity, cell membrane integrity and adversity resistance of the plant pathogenic fungus Lasiodiplodia theobromae. After knocking out the LtPCL6 protein encoding gene in the wild-type Lasiodiplodia theobromae, it was found that the pathogenicity, hyphal growth, cell wall integrity, cell membrane integrity and adversity resistance of the knocked-out Lasiodiplodia theobromae were significantly reduced. Therefore, LtPCL6 can be used as a fungicide target and a key protein in the pathogenic mechanism of the disease to develop medicaments for diseases caused by Lasiodiplodia theobromae infection and cultivate new disease-resistant varieties, which has broad application prospects in the prevention and treatment of plant pathogenic fungal diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 Schematic diagram of the gene knockout and mutant screening strategy of the present invention;

[0042] Figure 2 is a map of the plasmid pct74 of the present invention;

[0043] Figure 3 A schematic diagram of the microscope observation of the protoplasts prepared by the present invention;

[0044] Figure 4 This is the PCR electrophoresis diagram (amplification P1) of the transformant of the present invention;

[0045] Figure 5 This is the PCR electrophoresis diagram (amplification P2) of the transformant of the present invention;

[0046] Figure 6 This is the PCR electrophoresis diagram (amplification P3) of the transformant of the present invention;

[0047] Figure 7 This is the PCR electrophoresis diagram (amplification P4) of the transformant of the present invention;

[0048] Figure 8 Figure 2 is a diagram showing the colony growth of the wild type and mutant ΔLtPCL6 of the present invention on PDA;

[0049] Fig. 9 Figure 2 is a diagram showing the colony growth of the wild type and mutant ΔLtPCL6 of the present invention under different stress conditions;

[0050] Fig.10 Figure 2 is a graph showing the colony growth inhibition rate of the wild type and mutant ΔLtPCL6 of the present invention under different stress conditions;

[0051] Fig.11 The results are the pathogenicity test results of the wild type and mutant ΔLtPCL6 of the present invention on tea leaves. DETAILED DESCRIPTION

[0052] The present invention will be described in detail below in conjunction with examples, which are merely illustrative and are not intended to limit the scope of application of the present invention. The present invention is not limited to the following embodiments or examples, and any modifications and variations made without violating the spirit of the present invention should be included within the scope of the present invention. The experimental materials used in the following examples are commercially available unless otherwise specified.

[0053] In the following examples, the wild strain of Diplodia theobromina GZHS-2017-010 was isolated and identified from tea leaf spot disease in a tea garden in Huishui County, Guizhou Province, and sent to the China General Microbiological Culture Collection Administration Center for preservation, with the culture collection number CGMCC3.20151. The genomic DNA sequence of the LtPCL6 gene in the strain is shown in SEQ ID NO.1, the CDS sequence of the LtPCL6 gene is shown in SEQ ID NO.2, and the amino acid sequence of the LtPCL6 protein encoded by the LtPCL6 gene is shown in SEQ ID NO.3.

[0054] Example 1 Knockout of the LtPCL6 gene of Diplosporus cocoi

[0055] Schematic diagram of the knockout and mutant screening strategy of LtPCL6 gene in theobroma cacao Figure 1 As shown, the specific construction and screening methods are:

[0056] 1. Construction of knockout gene fragments

[0057] 1) Amplification of upstream and downstream homologous sequences of the target gene: Design primers based on the sequence of SEQ ID NO.1, use the genomic DNA of the wild strain CGMCC3.20151 of the cocoa hairy spore as a template, use primers 1F and 2R to amplify the upstream A fragment, use primers 3F and 4R to amplify the downstream B fragment, and add a reverse complementary sequence of primer HYGF to the 5' end of primer 2R, and add a reverse complementary sequence of primer HYGR to the 5' end of primer 3F. The sequences of primers 1F, 2R, 3F, 4R, HYGF and HYGR (5' to 3') are:

[0058] 1F:CTGCTACGACAACAAGGACAT

[0059] 2R:ACCTCCACTAGCTCCAGCCAAGGAGGCGGGAGGAAAAGAT

[0060] 3F:GAATAGAGTAGATGCCGACCGGGAGTGGGCGGGTTTCGATACA

[0061] 4R:TAATTCGAATGCGTGAAGGT

[0062] HYG-F:CTTGGCTGGAGCTAGTGGAGGT

[0063] HYG-R:CCCGGTCGGCATCTACTCTATTC

[0064] 2) Amplification of the hygromycin resistance gene hph: Using plasmid pct74 (map as shown Figure 2As shown in Figure 2, the first half of the hygromycin resistance gene H1 (1094 bp) was amplified using primers HYGF and HYG-1R; the second half of the hygromycin resistance gene H2 (748 bp) was amplified using primers HYG-1F and HYG-1R. The sequences of primers HYG-1F and HYG-1R (5' to 3') are:

[0065] HYG-1F: CGTTGCAAGACCTGCCTGAA

[0066] HYG-1R: GGATGCCTCCGCTCGAAGTA

[0067] 3) Fusion of upstream and downstream fragments of the target gene with the hygromycin resistance gene: Overlapping PCR was used to overlap the recovered A and B fragments with the H1 and H2 fragments to obtain A-H1 connection fragments and H2-B connection fragments. Primers 1F / HYG-1R and HYG-1F / 4R were used to amplify A-H1 and H2-B fragments, respectively, and the knockout fragments were purified to a concentration of 500 ng / μL.

[0068] 2. Preparation of protoplasts of Diplococcidis cocoa

[0069] 1) Inoculate theobroma cacao on potato dextrose agar medium, culture at 28°C for 36 hours, drip 2-3 mL of sterile water on the surface of the colony, break the mycelium with an inoculation loop, transfer the bacterial suspension to CM liquid medium and shake for 24 hours, and collect the fresh mycelium of theobroma cacao by filtration;

[0070] 2) Using 10 mL of 0.7 mol / L sodium chloride solution as an osmotic pressure stabilizer, prepare a mixed enzymatic solution of Drislase and Snailase, and lyse 5 g of suspended mycelium at 28°C and 120 rpm for 4 h;

[0071] 3) Filter through 2-3 layers of sterilized lens paper (pore size of the fiber mesh is 45±12μm), rinse with 1.2mol / L sodium chloride, collect the filtrate, centrifuge the filtrate at 4°C and 4000rpm for 6min, and resuspend with 15mL 1.2mol / L sorbitol buffer (STC) solution;

[0072] 4) Discard the supernatant and resuspend the protoplast pellet in 1 mL STC buffer to a concentration of 1×10 7 / mL protoplast suspension (protoplast microscope observation diagram as shown in Figure 3 Place on ice until use.

[0073] 3. Protoplast transformation of Diplospora cocoi

[0074] 1) Take 200 μL of protoplast suspension and add it to a 50 mL centrifuge tube. Add 10-20 μg of A-H1 and H2-B knockout transformation fragments, mix gently, and let stand on ice for 20 min.

[0075] 2) Add 200 μL, 200 μL, and 800 μL of 60% polyethylene glycol 3350 buffer (PTC) in sequence, gently invert to mix, let stand at room temperature for 20 min, add 5 mL of TB3 liquid culture medium, invert to mix, and let stand for 8 to 12 h.

[0076] 3) Centrifuge at room temperature, 4000 rpm / min for 6 min, discard the supernatant, and resuspend the remaining 1 mL with the regenerated protoplasts.

[0077] 4) Add to 50 mL of warm TB3 regeneration solid medium, mix well and prepare plates. After inverted culture at 28°C for 10 h, cover with PDA medium containing 50 μg / mL hygromycin B and culture at 28°C for about 3 to 4 days until transformants grow, then subculture and screen for 3 generations.

[0078] 4. Transformant PCR Verification

[0079] After three generations of subculture on PDA medium containing hygromycin, a total of seven transformants of ΔLtPCL6 were obtained. The transformants were numbered 1 to 7 and corresponded to lanes 2 to 8 of the electrophoresis diagram of PCR amplification below. DNA was extracted from the transformant colonies using the CTAB method and PCR amplified using four pairs of primers. The primer pair HYGF / HYGR was used to amplify fragment P1 to detect the presence of the hph gene (e.g. Figure 4 As shown, lane 1: 2kb PlusⅡDNA Marker, lanes 2-8: P1 amplified in transformants; lane 9: P1 amplified in the wild type strain CGMCC3.20151 of theobroma cacao); primer pair 5F / 6R was used to amplify fragment P2 to detect whether the target gene was knocked out (such as Figure 5 As shown, lane 1: 2kb PlusⅡDNA Marker, lanes 2-8: P2 amplified from transformants; lane 9: P2 amplified from the wild-type strain of Diplodia theobromina CGMCC3.20151); primer pair 7F / HYG-1R was used to amplify fragment P3 to detect the occurrence of upstream homologous recombination (such as Figure 6 As shown, lane 1: 2kb PlusⅡDNA Marker, lanes 2-8: P3 amplified from transformants; lane 9: P3 amplified from the wild-type strain of Diplodia theobromina CGMCC3.20151); primer pair HYG-1F / 8R was used to amplify fragment P4 to detect the occurrence of downstream homologous recombination (such as Figure 7As shown, lane 1: 2kb PlusⅡDNA Marker, lanes 2-8: P4 amplified from transformants; lane 9: P4 amplified from the wild-type strain of Diplospora theobroma CGMCC3.20151). Figures 4 to 7 As shown, a total of 2 positive transformants were screened. The sequences of primers 5F, 6R, 7F, and 8R (5' to 3') are:

[0080] 5F: ATGGGCTCCATCGTGATTACGAGCAGCGA

[0081] 6R:TCAGGAAGGCGCAGCAGCTGCTGTG

[0082] 7F:ATCGGAGTGCTGGGTGAAGG

[0083] 8R:TGACCCATACTCCAGTGACCGAG

[0084] Using homologous recombination, the gene knockout fragment was transferred into the protoplasts of theobroma cacao, and 7 hygromycin-positive transformants (numbered 1 to 7) were obtained. PCR verification analysis was performed on the positive transformants using hph gene-specific primers. The results are as follows Figures 4 to 7 As shown, the hph gene, upstream homologous recombination and downstream homologous recombination were detected in the 7 transformants, while the LtPCL6 gene was not amplified in numbers 1 and 2. A total of 2 positive transformants were screened, namely the ΔLtPCL6 knockout mutant.

[0085] Example 2 Phenotypic observation and stress resistance analysis of the wild type and ΔLtPCL6 knockout mutant of Diplosporus cocoi

[0086] 1. Colony morphology observation and growth rate determination

[0087] The wild type and knockout mutant ΔLtPCL6 of Diplospora cocoi were inoculated on PDA medium, cultured at 28℃ in the dark, and the colony diameter was measured by the cross method at 3d, and the colony morphology was observed; 4 replicates were set for each treatment.

[0088] The results of colony morphology observation and growth rate determination of wild type and knockout mutant ΔLtPCL6 of theobroma cacao on PDA medium are shown in Figure 8 As shown, Figure 8 A shows the growth of the wild-type strain of Diplospora cocoi and the mutant strain ΔLtPCL6 after inoculation on PDA medium for 24 h, the scale bar is 1 cm; Figure 8B is the colony growth rate of the wild-type strain of theobroma cacao and the mutant strain ΔLtPCL6 after inoculation on PDA medium for 24 hours. The ordinate is the diameter of the lesion. The value is the mean value based on 4 independent experiments, and the data were analyzed by Duncan's new multiple range method (p < 0.05). Figure 8 It can be seen that the colony morphology and growth rate of the theobroma cacao pubescens knockout mutant ΔLtPCL6 on PDA medium were significantly lower than those of the theobroma cacao pubescens wild type, indicating that the LtPCL6 gene has a significant effect on the growth of theobroma cacao pubescens.

[0089] 2. Analysis of stress resistance

[0090] 1) Oxidative stress analysis: The wild type and knockout mutant ΔLtPCL6 of the cocoa plant were inoculated in 0.06% H 2 O 2 The cells were incubated on PDA medium at 28°C for 2 to 3 days, and then the colony growth of the knockout mutant ΔLtPCL6 and the wild type was observed.

[0091] 2) Cell wall integrity analysis

[0092] The wild type and knockout mutant ΔLtPCL6 of Diplodia theobromina were inoculated on PDA medium containing 120 μg / mL Congo red, respectively, and cultured inverted in a 28°C incubator for 2 to 3 days, and then the colony growth of the knockout mutant ΔLtPCL6 and the wild type strain was observed.

[0093] 3) Cell membrane integrity analysis

[0094] The wild type and knockout mutant ΔLtPCL6 of the cocoa buttercup were inoculated in a 0.05%

[0095] After inverted culture on PDA medium containing sodium dodecyl sulfate (SDS) in a 28°C incubator for 2 to 3 days, the colony growth of the knockout mutant ΔLtPCL6 and the wild-type strain was observed.

[0096] 4) High osmotic pressure stress analysis

[0097] The wild type and knockout mutant ΔLtPCL6 of Diplodia theobrominata were inoculated on PDA medium containing 0.6 mol / L NaCl and 0.5 mol / L sorbitol, respectively. After inverted culture in a 28°C incubator for 2 to 3 days, the colony growth of the knockout mutant ΔLtPCL6 and the wild type strain was observed.

[0098] The colony diameters of all strains were measured (cross method) and photographed and recorded. The growth inhibition rate of strains was calculated as (colony diameter of control strain - colony diameter of treated strain) / colony diameter of control strain * 100%.

[0099] The growth of the LtPCL6 gene knockout mutant ΔLtPCL6 and the wild type of the cocoa buttercup under different stress conditions Fig. 9 As shown (wherein, A to E are the growth conditions of the wild-type strain of Diplococcosis cocoae CGMCC3.20151 on the culture medium under different stress conditions; Fig. 9 F-J, the growth of the mutant strain ΔLtPCL6 of the cocoa hairy spore on the culture medium under different stress conditions; 120 μg / mL Congo red: containing a final concentration of 120 μg / mL Congo red; 0.5 mol / L sorbitol: containing a final concentration of 0.5 mol / L sorbitol; 0.05% SDS: containing a final concentration of 0.05% SDS; 0.06% H 2 O 2 : Contains a final concentration of 0.06% HO 2 O 2 ; 0.6mol / L NaCl: containing a final concentration of 0.6mol / L NaCl; scale bar is 1cm); the relative growth inhibition rate of the colonies under different stress conditions is shown in Fig.10 As shown, the ordinate is the relative growth inhibition rate, the values ​​are the means based on 4 independent experiments, and the data were analyzed by Duncan's new multiple range method (p < 0.05). Fig.10 From left to right, the wild type and knockout mutants are shown in Congo red, sorbitol, SDS, H 2 O 2 The relative growth inhibition rate of the colony under the stress of NaCl and 40°C was analyzed by Duncan's new multiple range method (p < 0.05). Fig. 9 It can be seen that the growth rate of the knockout mutant ΔLtPCL6 on different culture media was significantly lower than that of the wild type; Fig.10 It can be seen that in the PDA medium containing 120μg / mL Congo red, 0.5mol / L sorbitol, 0.05% SDS and 0.6mol / L NaCl, the relative growth inhibition rate of the knockout mutant ΔLtPCL6 was significantly lower than that of the wild type, indicating that the knockout of the LtPCL6 gene reduced the sensitivity to Congo red, sorbitol, SDS and NaCl. 2 O 2 In the PDA medium, the relative growth inhibition rate of the knockout mutant ΔLtPCL6 was significantly higher than that of the wild type, indicating that the knockout of the LtPCL6 gene increased the resistance to H 2 O 2 sensitivity.

[0100] In summary, the knockout of the LtPCL6 gene reduced the growth rate, cell wall integrity, cell membrane integrity and tolerance to high salt, hyperosmotic and oxidative stress of B.

[0101] Example 3 Pathogenicity analysis of the knockout mutant of theobroma cacao

[0102] The wild type of Diplococcidioides theobrominum and the knockout mutant ΔLtPCL6 were inoculated on PDA culture medium, inverted and cultured in an incubator at 28°C for 24 hours. A sterile cork borer with a diameter of 4 mm was used to punch several bacterial cakes at the edge of the colony, which were then inoculated on the surface of tea leaves with puncture wounds. The disease status of the tea leaves was investigated after 3 days.

[0103] The results of the pathogenicity test of the LtPCL6 gene knockout mutant ΔLtPCL6 of Lactochromis cocoi to tea leaves are shown in Fig.11 As shown, Fig.11 A is the lesion picture of the wild-type strain of Diplodia theobromina and the mutant strain ΔLtPCL6 after being inoculated on tea leaves for 3 days; Fig.11 B is the result of measuring the diameter of the lesions of the wild-type strain of theobroma cacao and the mutant strain ΔLtPCL6 after inoculation on tea leaves for 3 days. The ordinate is the diameter of the lesions, and the values ​​are the means based on 30 independent experiments. The data were analyzed by Duncan's new multiple range method (p < 0.05). Fig.11 It can be seen that on tea leaves, the lesion diameter of the knockout mutant ΔLtPCL6 is smaller than that of the wild type, indicating that after knocking out the LtPCL6 gene, the pathogenicity of Diplodia theobrominata is significantly reduced.

[0104] In summary, the LtPCL6 gene or LtPCL6 protein provided by the present invention can be used to prevent and treat diseases caused by Diplodia theobromina, and can be used as a target for drugs used to prevent and treat plant diseases. Those skilled in the art can follow the teachings and inspirations of this specification to develop agents for preventing and treating plant diseases, especially diseases caused by Diplodia theobromina.

[0105] The conventional techniques and schemes not described in detail in the above embodiments are well known in the art, so they will not be described in detail here. The above embodiments and / or experimental examples describe the preferred embodiments of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, the technical scheme of the present invention can be subjected to a variety of simple modifications, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. The LtPCL6 protein is used in any of the following 1)-6): 1) Regulate the pathogenicity of Lactodiella theobroma cacao; 2) regulating the hyphal growth of Diplosporus theobrominum; 3) Regulate the cell wall integrity of Lactodiella theobroma cacao; 4) Regulate the cell membrane integrity of Diplococcidis theobrominata; 5) Regulate the stress resistance of theobroma cacao; 6) Design and screen antifungal drugs; The LtPCL6 protein is the protein shown in A1) or A2) below: A1) a protein with an amino acid sequence as shown in SEQ ID NO.3; A2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO.

3.

2. The use of the biomaterial related to the LtPCL6 protein described in claim 1 in any one of the following 1)-6): 1) Regulate the pathogenicity of Lactodiella theobroma cacao; 2) regulating the hyphal growth of Diplosporus theobrominum; 3) Regulate the cell wall integrity of Lactodiella theobroma cacao; 4) Regulate the cell membrane integrity of Diplococcidis theobrominata; 5) Regulate the stress resistance of theobroma cacao; 6) Design and screen antifungal drugs; The biological material is any one of the following A1) to A8): A1) a nucleic acid molecule encoding a LtPCL6 protein; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a recombinant vector containing the nucleic acid molecule described in A1); A4) a recombinant vector containing the expression cassette described in A2); A5) a recombinant microorganism containing the nucleic acid molecule described in A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) A recombinant microorganism containing the recombinant vector described in A4).

3. The use according to claim 2, characterized in that A1) The nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO.1 or as shown in SEQ ID NO.

2.

4. Use of the LtPCL6 protein described in claim 1 as a target in the design and screening of antifungal drugs.

5. Use of the LtPCL6 protein described in claim 1 or the biomaterial described in claim 2 or 3 in cultivating transgenic Lactodiella cacao with reduced pathogenicity and / or reduced mycelial growth ability and / or reduced cell wall integrity and / or reduced cell membrane integrity and / or reduced resistance to adversity.

6. A method for cultivating transgenic Lasiospora cocoi with reduced pathogenicity and / or reduced mycelial growth ability and / or reduced cell wall integrity and / or reduced cell membrane integrity and / or reduced resistance to adversity, characterized in that: The method comprises the steps of reducing the expression amount and / or activity of the LtPCL6 protein described in claim 1 in the recipient Lacto-Coloured Diplospora cocoa to obtain transgenic Lacto-Coloured Diplospora cocoa.

7. The method according to claim 6, characterized in that The method for reducing the expression level and / or activity of the LtPCL6 protein described in claim 1 in the recipient Diplococcidioides cocoae is achieved by knocking out, inhibiting or silencing the expression of the gene encoding the protein described in claim 1 in the recipient Diplococcidioides cocoae.

8. The method according to claim 7, characterized in that The homologous recombination method is used to knock out the coding gene of the protein described in claim 1 in the receptor Diplosporus theobroma.

9. The method according to claim 8, characterized in that The method of knocking out the gene encoding the protein described in claim 1 in the recipient Diplodia theobromina by using homologous recombination is to introduce a homologous recombination fragment used for homologous recombination into the protoplasts of the recipient Diplodia theobromina.

10. Use of the method according to any one of claims 6 to 9 in preventing and controlling diseases caused by Lasiodiplodia theobroma.

Images