A molecular marker for identifying porphyra haitanensis zhedong 2 strain

Abstract

This invention provides a molecular marker for identifying the *Porphyra yezoensis* strain "Zhedong 2," and a method for identifying the "Zhedong 2" strain based on this molecular marker. The provided InDel molecular marker has the following nucleotide sequence: SEQ ID NO:1. This invention is faster than traditional molecular markers, such as SSRs or ISSRs, as it can be directly identified from sequencing data, eliminating cumbersome laboratory development steps. The InDel marker provided by this invention can be rapidly identified using only simple PCR amplification and gel electrophoresis, resulting in low detection costs.

Description

Technical Field

[0001] This invention belongs to the field of aquaculture strain screening and breeding technology, specifically involving a molecular marker for identifying the Zhedong 2 strain of Lagerstroemia indica. Background Technology

[0002] Pyropia haitanensis is a large, warm-temperate marine algae endemic to my country with significant economic value. It is mainly cultivated in Zhejiang, Fujian, and Guangdong provinces, accounting for approximately 75% of the national laver production. Initially, the germplasm used for large-scale cultivation largely originated from wild populations. Significant progress has been made in Pyropia haitanensis breeding in the 21st century, with the development of many new varieties and lines possessing superior traits through selective breeding, mutation breeding, and hybridization. However, with climate change and the expansion of cultivation, different varieties and lines are often mixed, increasing the risk of natural hybridization and variation. This leads to unstable traits, decreased disease resistance, and reduced yield and quality, ultimately resulting in severe germplasm degradation. Therefore, there is an urgent need to breed more new varieties (lines) adapted to the current climate and cultivation methods.

[0003] "Zhedong No. 2" is a new strain obtained by using the East China Sea-adapted variety "Zhedong No. 1" as a parent, through 60C-γ ray radiation mutagenesis, and then through continuous selection. Its typical characteristics include a well-developed and strong attachment substrate, wide thallus, appropriately thick leaves, good dry-growing extensibility, rapid growth, and good heat resistance during the filamentous stage. Therefore, the strong attachment of this germplasm makes it very suitable for floating raft cultivation, preventing seedling loss and providing a certain degree of resistance to wind and waves.

[0004] The "Zhedong No. 2" variety has relatively broad and thick leaves, making it suitable for cultivation in the turbid sea areas of Jiangsu, Zhejiang, and Fujian provinces. It grows rapidly during its first and second water seasons, and its protein content, umami amino acid content, and nucleotide content are all higher than its parents. It also has relatively high levels of resistance components, such as GSH, isoerythroglobulin, and ascorbic acid. During its filamentous stage, especially in summer when the filaments swell, it exhibits good heat tolerance, helping it adapt to the high temperatures in seedling ponds caused by recent climate anomalies. Therefore, in order to promote the "Zhedong No. 2" strain as a new variety suitable for large-scale cultivation and production under new climatic conditions...

[0005] Although different strains of *Porphyra yezoensis* exhibit certain differences in body shape and color, these phenotypic characteristics are easily affected by cultivation density and aquatic ecological environment factors. Therefore, it is difficult to achieve accurate strain differentiation based solely on morphological characteristics. While some studies have attempted to use traditional molecular markers such as intermediate simple repeat sequences (ISSRs), simple sequence repeats (SSRs), and sequence characteristic amplification regions (SCARs) to identify different germplasm of *Porphyra yezoensis*, their efficiency in strain identification is not ideal due to the long development cycle of these markers and the limited genetic information they provide. Summary of the Invention

[0006] The purpose of this invention is to provide a molecular marker for identifying the "Zhedong 2" strain of *Porphyra yezoensis*, namely an InDel molecular marker and a method for identifying the "Zhedong 2" strain of *Porphyra yezoensis* based on the molecular marker.

[0007] This invention first provides an InDel molecular marker for identifying the "Zhedong No. 2" strain of *Porphyra yezoensis*, the nucleotide sequence of which is SEQ ID NO:1.

[0008] The InDel molecular marker provided by this invention can be used as a detection site to identify whether an individual *Porphyra yezoensis* belongs to the Zhedong No. 2 strain.

[0009] The present invention also provides a molecular marker detection kit for identifying the Lagerstroemia indica strain “Zhedong 2”, wherein the kit contains primer pairs for detecting the InDel molecular marker;

[0010] The primer pair described herein has a specific sequence of SEQ ID NO:2 and SEQ ID NO:3.

[0011] This invention also provides a method for identifying the "Zhedong No. 2" strain of *Porphyra yezoensis*, which is performed by detecting the presence of the aforementioned InDel molecular marker.

[0012] The method includes the following steps:

[0013] 1) Extract genomic DNA from the filamentous or thallus forms of *Porphyra yezoensis*;

[0014] 2) Use primers for PCR amplification;

[0015] 3) The amplification products were detected by agarose gel electrophoresis;

[0016] If a specific band of 709 bp in length can be detected, the laver in the jar is identified as the "Zhedong No. 2" strain.

[0017] This invention is faster than traditional molecular markers (such as SSR or ISSR), as it can be directly identified from sequencing data, eliminating cumbersome laboratory development steps. The InDel marker provided by this invention can be rapidly identified with only simple PCR amplification and gel electrophoresis, resulting in lower detection costs. Attached Figure Description

[0018] Figure 1 The image shows the electrophoresis results of the thallus amplification products of various strains of *Porphyra yezoensis* using InDel primers. M is a 2000bp DNA ladder marker; lanes 1-3 are individuals of the "Zhedong No. 2" strain; and lanes 4-21 are individuals of other strains of *Porphyra yezoensis*.

[0019] Figure 2 This image shows the electrophoresis results of InDel primer pair amplification products of filaments and thallus from each generation of the *Porphyra yezoensis* cultivar 'Zhedong 2'. M represents a 2000bp DNA ladder marker; lanes 1-3 represent individuals of the 'Zhedong 2' cultivar; and lanes 4-21 represent thallus from generations F1-F6 of *Porphyra yezoensis*. Detailed Implementation

[0020] The molecular marker used in this invention is the genome-wide insertion / deletion molecular marker InDel. The InDel markers used in this invention not only improve the accuracy of strain identification but also accelerate the selection process for superior strains, thereby promoting the sustainable development of the *Porphyra yezoensis* cultivation industry.

[0021] The present invention will now be described in detail with reference to the embodiments and accompanying drawings.

[0022] Example 1: Screening for specific INDEL molecular markers in *Porphyra yezoensis* 'Zhedong No. 2'

[0023] Whole-genome resequencing was performed on the thallus of seven strains of *Porphyra yezoensis*, including “Zhedong 2”. Bioinformatics software was used to align the samples to the reference genome to obtain the InDel site information for each sample. Then, a script was used to screen for the InDel site unique to “Zhedong 2”, located at position 4,655,835 bp on chromosome 1, with a deletion length of 137 bp.

[0024] The nucleotide sequence of the missing fragment is as follows:

[0025] ACGGCCCCGACCTACCGCCAGCACGGCTCCGACCCATCGCCGCCGCCGGCACGGCTCCGACCCACCGCCGGCACGG CTTTGACCCACCGCTGGCACAGCTCCGACCCACCGCCGGTCCGGCTCCGACCCACCGCCGC (SEQ ID NO: 1).

[0026] The sequences containing the InDel sites mentioned above were extracted from the reference genome of *Porphyra yezoensis* using TBtools software (amplified 500bp on each side). Primers were then designed using Primer5 software. The sequence information of one primer pair is as follows:

[0027] (F)sense primer:5′-GTCTGGCTGGCGATTGA-3′(SEQ ID NO:2),

[0028] (R) Anti-sense primer: 5′-CGACGATGTTGGCACCT-3′ (SEQ ID NO: 3).

[0029] Subsequently, PCR amplification and verification were performed using samples of Zhedong 2 and other strains of Lagerstroemia indica.

[0030] Example 2: Detection of the effect of INDEL molecular markers

[0031] Using the primer sequences of SEQ ID NO:2 and SEQ ID NO:3, samples from different Laveria bassiana strains, including Zhedong No. 2, were amplified by PCR and detected by gel electrophoresis. If a specific band of 709 bp in length was detected, the Laveria bassiana was identified as the "Zhedong No. 2" strain.

[0032] The specific method includes the following steps:

[0033] I. Extracting genomic DNA from individual *Porphyra yezoensis* samples to be tested

[0034] DNA was extracted from the filamentous and thallus tissues of Zhedong No. 2 and thallus tissues of other strains. The specific steps are as follows:

[0035] 1. Grind the liquid nitrogen-treated laver leaf-like sample into powder, and transfer 50 mg of the frozen sample into a centrifuge tube.

[0036] 2. Immediately add 700 μl of preheated 65°C Buffer PAL to the sample, vortex vigorously to fully disperse the sample, and incubate in a 65°C water bath for 20 minutes, mixing 2-3 times during the process.

[0037] 3. Add 700 μl of Buffer BDP to the sample and vortex for 10 seconds to homogenize.

[0038] 4. Centrifuge at 12,000 x g for 5 minutes at room temperature, and carefully transfer the supernatant to a new centrifuge tube.

[0039] 5. Add 700 μl of Buffer GWP to the supernatant and mix by inverting 10-15 times.

[0040] 6. Load the DNA column into the collection tube and transfer half the volume of the mixture into the column. Centrifuge at 12,000g for 60 seconds.

[0041] 7. Discard the filtrate, reassemble the column into the collection tube, and transfer the remaining mixture into the column. Centrifuge at 12,000g for 60 seconds.

[0042] 8. Discard the filtrate, reassemble the column into the collection tube, add 500 μl of Buffer PW1 to the column, and centrifuge at 12,000 g for 60 seconds.

[0043] 9. Discard the filtrate, reassemble the column into the collection tube, add 500 μl of Buffer PW2 to the column, and centrifuge at 12,000 g for 60 seconds.

[0044] 10. Discard the filtrate and put the column back into the collection tube. Add 300 μL of Buffer PW2 to the column. Centrifuge at 12,000 g for 2 minutes.

[0045] 11. Transfer the column to a new 1.5 ml centrifuge tube, add 40 μl of preheated 65 °C Buffer AE to the center of the membrane in the column. Let stand at room temperature for 2 minutes, then centrifuge at 12,000 g for 1 minute.

[0046] 12. Add 40 μl of preheated 65°C Buffer AE to the center of the membrane on the column. Incubate for 2 minutes. Centrifuge at 12,000 x g for 1 minute. Discard the DNA binding column and store the DNA at -20°C.

[0047] II. PCR amplification and agarose gel electrophoresis detection

[0048] The purified DNA was diluted to 5 ng / uL as a template for PCR amplification. The 25 μL reaction system included: 12.5 μL of Mix, 7.5 μL of ddH2O, 2 μL of DNA template, and 2 μL each of forward and reverse primers (10 μmol / L).

[0049] Reaction procedure: The reaction was carried out in a BIOER PCR instrument. Pre-denaturation was performed at 94℃ for 5 min, followed by 30 cycles of annealing at 54.8℃ for 30 s, extension at 72℃ for 30 s, and a final extension at 72℃ for 10 min after the cycle.

[0050] After the reaction was completed, 5 μL of the amplification product was electrophoresed in a 1.0% agarose gel. The electrophoresis buffer was 50xTAE and the voltage was 120V. Electrophoresis was stopped after 30 min and the results were recorded by taking pictures using a gel imaging system.

[0051] The results showed that the primer pair with sequences SEQ ID NO:2 and SEQ ID NO:3 could amplify a specific band of 709 bp in the filaments and thallus of all generations of Zhedong 2, while an 846 bp band was amplified in the thallus of other strains. Figure 1 and Figure 2 As shown.

[0052] A 709bp specific band was amplified in the filaments and thallus of each generation of Zhedong 2, recovered, and sequenced. The sequence results are as follows:

[0053] GTCTGGCTGGCGATTGACGGCCAGCTCAAGATGTTTGGCATTGACAAAGTCAAACCGCACGTGGTCGCCAGGCCTGATGGGACGACCCCGGATGCC

[0054] GGTGATACGGTGGCCGCTGGTGCGCCGCCTCCAATGCCGGGCCGACGGCGTCGCTGACGCCGCTCCCACGCCCGCGGCGCCCCCCGCCGCCG

[0055] GGACCTGAGCGCCCGGCCACGGGTCTTCCCCCTCTGCCGGGCCGAGCGCCGGGCCGGCCGAGCCGACCAGCAGTGGGAGCACCGCAGGTGGACGCG

[0056] CCGCCGGCGGGCCCAGACGACCCCAGCGACCTGCCCACCGATGCGGCAGGCAATCCGGACTACGGGTCAATGTTAGACACGGTCCTAGCAGGCGAG

[0057] CACTTCATGTCGACACTATACGCTGCCTCGACCGCTTTCGTGTCTGAACGTTCTCAGGTGGTGACCACGGACCCACGGTGCGGCAAGGCGACGCGG

[0058] GGGCGACGATCGTCGCGGTCAGCCACAACTGCAGCCGCTGCGTCCGCCGCACCCTCTGGGTCGACGCCGGCCAAGACCTACATCACCGTAGTGGTA

[0059] CCGCCGGGTGACCCGCGCCTCAGCACCACCCGTTTCCGAGCCGCCGCCGCCAAAGAGGCCGATGGCCTCTAGGAGCGCGGTACGTTCAAAAGGGTCAAGGAGAGCGACGTCCCCAAAGGTGCCAACATCGTCG(SEQ ID NO:4).

[0060] For the 846 bp band amplified from the filaments and thalli of each generation of non-Zhedong 2, the nucleotide sequence is as follows:

[0061] GTCTGGCTGGCGATTGACGGCCAGCTCAAGATGTTTGGCATTGACAAAGTCAAACCGCACGTGGTCGCCAGGCCTGATGGGACGACCCCGGATGCC

[0062] GGTGATACGGTGGCCGCTGGTGCGCCGCCTCCAATGCCGGGCGCCGACGGCGTCGCTGACGCCGCTCCCACGCCCGCGGCGCCCCCCCCGCCGCCG

[0063] GGACCTGAGCGCCCGGCCACGGGTGCTTCCCCCTCTGCCGGGCCGAGCGCCGGGCCGGCCGAGCCGACCAGCAGTGGGAGCACGCAGGTGGACGCG

[0064] CCGCCGGCGGGCCCAGACGACCCCAGCGACCTGCCCACCGATGCGGCAGGCAATCCGGACTACGGGTCAATGTTAGACACGGTCCTAGCAGGCGAG

[0065] CACTTCATGTCGACACTATACGCTGCCTCGACCGCTTTCGTGTCTGAACGTTCTCAGGTGGTGACCACGGACCCACGGTGCGGCAAGGCGACGCGG

[0066] GGGCGACGATCGTCGCGGTCAGCCACAACTGCAGCCGACGGCCCCGACCTACCGCCAGCACGGGCTCCGACCCATCGCCGCCGCCGGCACGGCTCCG

[0067] ACCCACCGCCGGCACGGCTTTGACCCACCGCTGGCACAGCTCCGACCCACCGCCGGTCCGGCTCCGACCCACCGCCGCCTGCGTCCGCCGCACCCT

[0068] CTGGGTCGACGCCGGCCAAGACCTACATCACCGTAGTGGTACCGCCGGGTGACCCGCGCCTCAGCACCACCCGTTTCCGAGCCGCCGCCGCCAAAG

[0069] AGGCCGATGGCCTCTAGGAGCGCGGTACGTTCAAAAGGGTCAAGGAGAGCGACGTCCCCAAAGGTGCCAACATCGTCG (SEQ ID NO: 5).

[0070] That is, the amplified 846bp band contains 137bp of InDel markers.

[0071] In summary, the InDel marker provided by this invention has good genetic stability, good consistency in performance across different generations, and is not affected by environmental factors, which is beneficial for long-term tracking and monitoring of strain changes.

Claims

1. An InDel molecular marker for identifying the *Porphyra yezoensis* strain "Zhedong 2", characterized in that, The nucleotide sequence of the InDel molecular marker is SEQ ID NO:

1.

2. The application of the InDel molecular marker as a detection site as described in claim 1 in identifying whether an individual *Porphyra yezoensis* belongs to the Zhedong No. 2 strain.

3. A molecular marker detection kit for identifying the "Zhedong 2" strain of *Porphyra yezoensis*, characterized in that, The kit contains a primer pair for detecting the InDel molecular marker of claim 1; the primer pair has the sequences SEQ ID NO:2 and SEQ ID NO:

3.

4. A method for identifying the "Zhedong No. 2" strain of *Porphyra yezoensis*, characterized in that... The method described herein is to identify the presence of the InDel molecular marker as described in claim 1.

5. The method as described in claim 4, characterized in that, The method described herein is to use the kit described in claim 3 for identification.

6. The method as described in claim 5, characterized in that, The method includes the following steps: 1) Extract genomic DNA from the filamentous or thallus forms of *Porphyra yezoensis*; 2) Use primers for PCR amplification; 3) The amplification products were detected by agarose gel electrophoresis; If a specific band of 709 bp in length can be detected, the laver in the jar is identified as the "Zhedong No. 2" strain.

Images