Acinetobacter HUNAN-1 and its application in the control of white-backed planthoppers

Abstract

This invention relates to an Acinetobacter HUNAN-1 strain and its application in the control of white-backed planthoppers. The culture process of the Acinetobacter strain is simple, with the advantage of obtaining a large number of Acinetobacter strains in a short time. Furthermore, the isolated Acinetobacter strain has significant insecticidal activity against white-backed planthoppers, and its fermentation broth has also been shown to have good insecticidal activity against white-backed planthoppers. This provides a new research idea for the biological control of pests and has broad application prospects.

Description

Technical Field

[0001] This invention belongs to the field of agricultural microbial technology, specifically relating to a strain of Acinetobacter HUNAN-1 and its application in the control of white-backed planthoppers. Background Technology

[0002] Acinetobacter is a Gram-negative cocci belonging to the Moraxellaceae family and the Gamma-Proteobacterium class. It was first isolated from soil and is commonly found in water and soil. Besides its environmental presence, Acinetobacter is also a symbiotic bacterium found in insects, such as houseflies, Aedes albopictus, and planthoppers. Acinetobacter is also a common pathogen in hospitals, causing various human diseases such as sepsis, meningitis, urinary tract infections, skin infections, and gastroenteritis. Acinetobacter baumannii is a particularly common hospital pathogen. In addition to its pathogenicity, Acinetobacter also has the ability to degrade halogenated anilines, various chloroanilines, petroleum hydrocarbons, nitrobenzene, and phosphorus. Furthermore, Acinetobacter has been shown to have insecticidal activity; for example, Acinetobacter johnsonii MB44 has been reported to have nematicidal activity.

[0003] The white-backed planthopper [Sogatella furcifera (Horváth)], belonging to the family Delphacidae in the order Hemiptera, causes severe damage to rice, occurring on a large scale in China and resulting in significant economic losses. Therefore, in 2020, my country's Ministry of Agriculture and Rural Affairs included the white-backed planthopper in the "List of Class A Crop Diseases and Pests." Previous studies have found *Acinetobacter soli*, a species of *Acinetobacter*, in the gut of the white-backed planthopper, and have also demonstrated that *Acinetobacter* within the planthopper can be cultured in vitro, providing support for in vitro research on *Acinetobacter*.

[0004] Currently, there are only reports on the in vitro culture of Acinetobacter soli, a symbiotic bacterium in the white-backed planthopper, and no studies on the interaction between this strain and the white-backed planthopper. Summary of the Invention

[0005] This invention provides a strain of Acinetobacter soli HUNAN-1, which was deposited at the China Center for Type Culture Collection on September 11, 2024, with accession number CCTCC M 20241953.

[0006] The present invention also provides a biocontrol agent for controlling white-backed planthoppers, containing one or more of the above-mentioned Acinetobacter HUNAN-1 or its spore suspension, culture medium, fermentation broth, and fermentation supernatant.

[0007] Furthermore, the biocontrol agent also includes acceptable excipients or carriers.

[0008] The present invention also provides the application of the above-mentioned Acinetobacter or biocontrol agent in the control of white-backed planthoppers or in the preparation of products for the control of white-backed planthoppers.

[0009] The present invention also provides a method for controlling white-backed planthoppers, which involves treatment with the aforementioned Acinetobacter HUNAN-1 or a biocontrol agent.

[0010] Furthermore, the Acinetobacter HUNAN-1 strain was enriched using LB medium and cultured until OD2000. 600 =1.7, which can be used for the control of white-backed planthoppers.

[0011] Furthermore, the bacterial suspension was centrifuged at 10,000 r / min for 10 min, and the supernatant was filtered through a 0.22 μm sterile filter membrane to obtain the bacterial fermentation broth. The obtained bacterial fermentation broth was used for the control of white-backed planthoppers.

[0012] Beneficial effects: The cultivation process of the Acinetobacter bacillus strain of the white-backed planthopper of this invention is simple and has the advantage of obtaining a large number of Acinetobacter bacillus strains in a short time; the isolated Acinetobacter bacillus strain has insecticidal activity against the white-backed planthopper, further proving that the fermentation broth of the Acinetobacter bacillus strain has insecticidal activity against the white-backed planthopper. This provides a new research approach for the biological control of pests and has broad application prospects. Attached Figure Description

[0013] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0014] Figure 1 This is a colony appearance diagram of Acinetobacter hUNAN-1, a bacterium found in white-backed planthoppers.

[0015] Figure 2 Gram staining image of Acinetobacter hunan-1, a bacterium of the white-backed planthopper;

[0016] Figure 3 Image of the bacterial cell appearance of Acinetobacter hunanensis HUNAN-1 (scanning electron microscope image);

[0017] Figure 4The growth curve of Acinetobacter hunanensis HUNAN-1 is shown.

[0018] Figure 5 The insecticidal activity of Acinetobacter HUNAN-1 against white-backed planthopper;

[0019] Figure 6 The insecticidal activity of Acinetobacter bacillus crude HUNAN-1 extract against white-backed planthopper was determined. Detailed Implementation

[0020] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.

[0021] Example 1: Obtaining and identifying Acinetobacter soli strain HUNAN-1

[0022] Bacterial morphological characteristics:

[0023] Twenty white-backed planthopper nymphs were collected and soaked in 75% ethanol for 3 minutes, then rinsed five times with sterile deionized water. The planthoppers were placed in centrifuge tubes, and 1 mL of sterile deionized water was added, followed by homogenization. The homogenized sample was centrifuged at 5000 rpm for 5 minutes. The supernatant was added to an Erlenmeyer flask containing 100 mL of inorganic salt medium, using acetamiprid as the sole carbon source. The culture was incubated at 200 rpm and 37°C for 2 days. The cultured bacterial solution was spread onto solid inorganic salt medium and incubated at 37°C for 24 hours. Colonies were collected after this incubation. Colonies that were white, round, smooth, and had regular edges were considered good. Figure 1 Gram staining was negative. Figure 2 ); the bacteria are short and rod-shaped, without spores or flagella. Figure 3 ).

[0024] The inorganic salt culture medium formula is as follows:

[0025] Magnesium sulfate heptahydrate (MgSO4·7H2O): 0.2g

[0026] Ammonium sulfate ((NH4)2SO4): 0.5g

[0027] Potassium dihydrogen phosphate (KH2PO4): 0.5g

[0028] Sodium chloride (NaCl): 1.0g

[0029] Dipotassium hydrogen phosphate (K₂HPO₄): 1.5g

[0030] Distilled water: 1000mL

[0031] Add 1.5%-2% agar to the solid culture medium and sterilize at 121℃ for 30 minutes.

[0032] Scanning electron microscopy (HITACHI Regulus 8100) characterization

[0033] Acinetobacter HUNAN-1 strain was enriched using LB liquid medium, centrifuged (10,000 rpm), washed twice with PBS, and stored in electron microscopy fixative. After dehydration, drying, and gold sputtering, it was characterized by scanning electron microscopy (HITACHI Regulus 8100). Figure 3 As shown: The bacterial cells are rod-shaped, with a size of 1.2-2.5 μm in length and 0.5-0.8 μm in width.

[0034] 16S rRNA sequence analysis

[0035] Acinetobacter hUNAN-1 bacterial culture was amplified using universal 16S rRNA primers (27F: AGAGTTTGATCCTGGCTCAG; 1492R: GGTTACCTTGTTACGACTT). The product was sequenced to obtain the 16S rRNA sequence of Acinetobacter hUNAN-1. DNA sequencing analysis showed that the 16S rDNA sequence of this bacterium consisted of 1462 bases. Nucleotide homology comparison of the 16S rDNA sequence of Acinetobacter hUNAN-1 with 16S rDNA sequences already registered in GenBank using the BLAST program showed 100% homology with the reported sequence of Acinetobacter soli, indicating that this isolate is Acinetobacter soli of the genus Acinetobacter.

[0036] Based on the morphological characteristics, Gram staining results, and 16S rRNA sequence analysis, Acinetobacter soli strain HUNAN-1 was identified as belonging to the phylum Proteobacteria, family Moraxellaceae, class Gamma-Proteobacteria, and genus Acinetobacter. It was named Acinetobacter soli HUNAN-1 and was deposited at the China Center for Type Culture Collection on September 11, 2024, with accession number CCTCC M 20241953.

[0037] Example 2: Insecticidal effect of Acinetobacter soli HUNAN-1 against white-backed planthopper

[0038] The insecticidal effect of Acinetobacter HUNAN-1 bacterial suspension on white-backed planthopper was verified by the following steps:

[0039] 1) The above-mentioned Acinetobacter HUNAN-1 strain was enriched and cultured in LB medium until the bacterial culture reached OD. 600 =1.7.

[0040] 2) Wrap the roots of 20 uniformly growing rice seedlings with absorbent cotton and soak them in water. Place them in a disposable plastic cup and inoculate them with 20 healthy and uniformly sized 4N nymphs.

[0041] 3) Spray 2 mL of Acinetobacter HUNAN-1 bacterial suspension, and use Escherichia coli bacterial suspension with the same OD value as a control. Each treatment is repeated 4 times per cup. Place in an incubator at 26±1℃ and observe and record the number of dead cells at 24h, 48h, and 72h.

[0042] The results showed that, compared with the control, white-backed planthoppers showed significant mortality after treatment with Acinetobacter HUNAN-1 bacterial solution (see...). Figure 5 The mortality rate was as high as 99%, which proves that Acinetobacter HUNAN-1 bacterial solution has significant insecticidal activity against white-backed planthoppers.

[0043] The insecticidal effect of Acinetobacter HUNAN-1 strain fermentation broth on white-backed planthopper was verified by the following steps:

[0044] The above-mentioned Acinetobacter HUNAN-1 strain was enriched and cultured in LB medium until the bacterial culture reached OD. 600 =1.7. Centrifuge the bacterial suspension at 10000 r / min for 10 min, collect the supernatant and filter it through a 0.22 μm sterile filter membrane to obtain the bacterial fermentation broth; add PBS buffer to the bacterial cells precipitated at the bottom of the tube, sonicate to disrupt, and filter through a 0.22 μm sterile filter membrane to obtain the cell lysate.

[0045] Wrap the roots of 20 uniformly growing rice seedlings in absorbent cotton and soak them. Place them in a disposable plastic cup and inoculate them with 20 healthy, uniformly sized 4N nymphs.

[0046] 2 mL of bacterial fermentation broth and cell lysis broth were sprayed in, respectively. LB medium and PBS buffer were used as blank controls, with each treatment repeated 4 times per cup. The cells were placed in an incubator at 26±1℃, and the number of dead cells was observed and recorded at 24h, 48h, and 72h.

[0047] The results showed that, compared with the control, the fermentation broth of Acinetobacter HUNAN-1 had a lethal effect on white-backed planthoppers, while the cell lysate had no significant lethal effect on white-backed planthoppers (see...). Figure 6 This study demonstrated that Acinetobacter HUNAN-1 fermentation broth has insecticidal activity against white-backed planthoppers.

[0048] The above experiments demonstrate that Acinetobacter HUNAN-1 has a significant insecticidal effect on white-backed planthoppers, and the fermentation broth of the strain also has a good insecticidal effect on white-backed planthoppers.

[0049] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. An Acinetobacter HUNAN-1 strain was deposited at the China Center for Type Culture Collection on September 11, 2024, with accession number CCTCC M 20241953.

2. A biocontrol agent for controlling white-backed planthoppers, characterized in that, Contains Acinetobacter HUNAN-1 as described in claim 1 or its fermentation broth; wherein the fermentation broth is prepared by: enriching Acinetobacter HUNAN-1 strain with LB medium and culturing to OD. 600 =1.7, and the bacterial suspension was further centrifuged at 10000 r / min for 10 min. The supernatant was then filtered through a 0.22 μm sterile filter membrane to obtain the bacterial fermentation broth.

3. The biocontrol agent according to claim 2, characterized in that, The biocontrol agent may also include acceptable excipients or carriers.

4. The use of Acinetobacter HUNAN-1 as described in claim 1 or any of the biocontrol agents described in claims 2-3 in the control of white-backed planthoppers or in the preparation of products for the control of white-backed planthoppers.

5. A method for controlling white-backed planthoppers, characterized in that, Treatment was performed using Acinetobacter HUNAN-1 as described in claim 1 or any of the biocontrol agents described in claims 2-3.

6. The method according to claim 5, characterized in that, Acinetobacter HUNAN-1 strain was enriched and cultured in LB medium until OD200. 600 =1.7, which can be used for the control of white-backed planthoppers.

7. The method according to claim 6, characterized in that, The bacterial suspension was further centrifuged at 10,000 r / min for 10 min, and the supernatant was filtered through a 0.22 μm sterile filter membrane to obtain the bacterial fermentation broth. The obtained bacterial fermentation broth was used for the control of white-backed planthoppers.

Images