A recombinant microorganism and its use in the production of l-isoleucine

By introducing cimA and ilvIH mutants and overexpressing the leuBCD gene into Escherichia coli or Corynebacterium glutamicum, recombinant microorganisms were constructed, solving the problem of low L-isoleucine synthesis efficiency in microorganisms and realizing efficient and environmentally friendly fermentation production of L-isoleucine.

CN119120333BActive Publication Date: 2026-03-20TSINGHUA UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-05
Publication Date
2026-03-20

AI Technical Summary

Technical Problem

Existing technologies for improving the efficiency of L-isoleucine synthesis in microorganisms have not been fully studied. Traditional chemical synthesis methods are complex and polluting to the environment, while fermentation methods need to be optimized to improve yield and efficiency.

Method used

By introducing the cimA and ilvIH mutants derived from Methanocaldococcus jannaschii into Escherichia coli or Corynebacterium glutamicum and combining them with the overexpression of the leuBCD gene, recombinant microorganisms were constructed to bypass complex metabolic regulation, improve the synthesis efficiency of 2-ketobutyric acid, and enhance the production of L-isoleucine.

Benefits of technology

It significantly improved the yield and efficiency of L-isoleucine, achieving efficient fermentation production, reducing environmental pollution, and meeting the requirements of green and sustainable development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
Patent Text Reader

Abstract

The present application relates to the technical field of microorganism, and particularly discloses a recombinant microorganism and application thereof in production of L-isoleucine. The recombinant microorganism of the present application expresses a cimA mutant and an ilvIH mutant compared with a starting strain; the starting strain is Escherichia coli or Corynebacterium glutamicum; the amino acid sequence of the cimA mutant is shown in SEQ ID No. 1; and the nucleotide sequence of the ilvIH mutant is shown in SEQ ID No. 5. L-isoleucine can be produced by fermentation of the recombinant microorganism of the present application.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, in particular, to a recombinant microorganism and its application in producing L-isoleucine. BACKGROUND

[0002] L-isoleucine is one of the eight essential amino acids, and is called branched-chain amino acid with L-valine and L-leucine because of its branched methyl group. L-isoleucine is an indispensable component in the physiological metabolic activities of animals and plants as a synthetic protein raw material supplement, and is widely used in medical, feed, pharmaceutical, food and other aspects. The market demand for L-isoleucine is increasing. At present, the main methods for industrial production of L-isoleucine are extraction and fermentation. The traditional chemical synthesis method has been eliminated due to the problems of complex reaction and low yield. The extraction method needs to hydrolyze animal and plant protein tissues with strong acid, which is easy to cause environmental pollution. Compared with the extraction method, the fermentation method is widely used because of its simple operation, low cost, environmental friendliness, green and sustainable development and other advantages.

[0003] In the microorganism, L-isoleucine is generated from oxaloacetate, an intermediate metabolite in the TCA cycle, by transamination to produce aspartate. Aspartate is synthesized into precursor L-threonine through 5-step enzyme-catalyzed reaction. L-threonine is converted into 2-ketobutyric acid by L-threonine dehydratase (ilvA encoding). From 2-ketobutyric acid, L-isoleucine is synthesized through 4-step enzyme reaction, and the last 4-step enzyme involved in the reaction is acetyl-hydroxy acid synthase (ilvIH encoding), acetyl-hydroxy acid isomerase (ilvC encoding), dihydroxy dehydratase (ilvD encoding), and branched-chain amino acid transaminase (ilvE encoding). At present, the strategy for strengthening isoleucine synthesis mainly focuses on strengthening the precursor threonine and the biological conversion process from threonine to isoleucine. How to improve the synthesis of isoleucine still needs further research. SUMMARY

[0004] One of the purposes of the present application is to provide a new method for fermentative production of L-isoleucine.

[0005] The present application provides a recombinant microorganism, which expresses a cimA mutant and an ilvIH mutant compared with a starting strain, and overexpresses leuBCD; the starting strain is Escherichia coli or Corynebacterium glutamicum; the amino acid sequence of the cimA mutant is shown in SEQ ID No. 1; the nucleotide sequence of the ilvIH mutant is shown in SEQ ID No. 5.

[0006] The present application has carried out a large amount of research on how to improve the supply of metabolic precursor 2-ketobutyric acid (a key precursor for synthesizing isoleucine) in the microorganism, and found that by introducing Methanocaldococcus jannaschiiThe present application provides a new way to produce L-isoleucine by introducing a mutant of citramalate synthase (cimA) and ilvIH mutant. Further, the present application provides a new way to supply the metabolic precursor 2-ketobutyrate of L-isoleucine. By introducing an exogenous mutant of citramalate synthase (cimA, EC 2.3.1.182) into a microorganism (such as Escherichia coli or Corynebacterium glutamicum), acetyl-CoA and pyruvate can be catalyzed to generate citramalate, and further, citramalate can be converted to 2-ketobutyrate by expression of the leuBCD gene of the strain itself. The synthesis of 2-ketobutyrate by this method can bypass the complex metabolic regulation of the strain itself, improve the synthesis efficiency of 2-ketobutyrate, and improve the intracellular ratio of 2-ketobutyrate / pyruvate, thereby further improving the yield of isoleucine on the basis of the original.

[0007] Preferably, the recombinant microorganism of the present application further overexpresses leuBCD compared with the starting strain, so as to better convert citramalate to 2-ketobutyrate.

[0008] More preferably, the recombinant microorganism of the present application expresses the cimA mutant and the ilvIH mutant, overexpresses leuBCD, and further overexpresses thrABC and expresses the ilvA mutant.

[0009] At this time, the recombinant microorganism can synthesize 2-ketobutyrate and L-isoleucine through the threonine pathway and the citramalate synthase pathway, and the two pathways cooperatively improve the yield of L-isoleucine.

[0010] In the recombinant microorganism of the present application, the nucleotide sequence of the cimA mutant is shown in SEQ ID No. 2; the nucleotide sequence of leuBCD is shown in SEQ ID No. 3; and the nucleotide sequence of thrABC is shown in SEQ ID No. 31.

[0011] The present application also provides the use of the above-mentioned recombinant microorganism in fermentation production of L-isoleucine, in genetic breeding of microorganisms for producing L-isoleucine, or in improving the yield of biosynthesis of L-isoleucine.

[0012] The present application also provides a cimA mutant, and the amino acid sequence thereof is shown in SEQ ID No. 1.

[0013] The present application also provides a DNA molecule, and the nucleotide sequence thereof is shown in SEQ ID No. 2, 4 or 5.

[0014] The present application also provides the use of the above-mentioned DNA molecule in constructing a recombinant microorganism, and the recombinant microorganism can ferment to produce L-isoleucine, and the starting strain is Escherichia coli or Corynebacterium glutamicum.

[0015] The cimA mutant of the present application can be used in combination with other genetic modifications to construct a new 2-ketobutyrate synthesis pathway in a recombinant bacterium.

[0016] The present application also provides a method for fermentatively producing L-isoleucine, which comprises the step of culturing the above-mentioned recombinant microorganism.

[0017] The present application also provides a method for constructing a recombinant microorganism for producing L-isoleucine, which comprises the step of causing a starting strain to express a cimA mutant and an ilvIH mutant, or further overexpressing leuBCD, or further overexpressing thrABC and expressing an ilvA mutant; the starting strain is Escherichia coli or Corynebacterium glutamicum; the amino acid sequence of the cimA mutant is shown in SEQ ID No. 1; the nucleotide sequence of the ilvIH mutant is shown in SEQ ID No. 5; the nucleotide sequence of the ilvA mutant is shown in SEQ ID No. 4; the nucleotide sequence of the leuBCD is shown in SEQ ID No. 3; and the nucleotide sequence of the thrABC is shown in SEQ ID No. 31.

[0018] The present application has at least the following beneficial effects:

[0019] The present application provides a new method for producing 2-ketobutyric acid and isoleucine in microorganisms, which bypasses the complex metabolic regulation of the threonine pathway, and can significantly improve the yield and yield of L-isoleucine when coexisting with the known L-isoleucine synthesis pathway (threonine pathway). DETAILED DESCRIPTION

[0020] The preferred embodiments of the present application will be described in detail below with reference to the examples. It should be understood that the following examples are given only to illustrate the present application and are not intended to limit the scope of the present application. Those skilled in the art can make various modifications and substitutions to the present application without departing from the spirit and principles of the present application.

[0021] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available or prepared according to conventional methods in the art unless otherwise specified.

[0022] The specific implementation methods of this invention include: (1) constructing recombinant plasmids pBbA1K-cimA, pBbA1K-cimA-leuBCD, pTrc99a-ilvAIH, and pTrc99a-ilvIH; the amino acid sequence of cimA is shown in SEQ ID No. 1, the nucleotide sequence of cimA is shown in SEQ ID No. 2; the leuBCD sequence is shown in SEQ ID No. 3, the ilvA sequence is shown in SEQ ID No. 4, and the ilvIH sequence is shown in SEQ ID No. 5; (2) introducing the recombinant plasmids into Escherichia coli to construct an L-isoleucine-producing strain; (3) fermenting the above strains to detect the growth of the cells and the yield of L-isoleucine. Feasible embodiments are as follows, but are not limited to the examples below.

[0023] Example 1: Construction of recombinant plasmids pBbA1K-cimA, pBbA1K-cimA-leuBCD, pTrc99a-ilvAIH, and pTrc99a-ilvIH

[0024] This embodiment will Methanocaldococcus jannaschii Methanocaldococcus jannaschii The cimA mutant (containing the point mutation I47V-E114A-H126Q-T204G-L238S, sequence as shown in SEQ ID No. 1, nucleotide sequence as shown in SEQ ID No. 2), leuBCD (sequence as shown in SEQ ID No. 3), ilvA mutant (containing the double point mutation F352A-R362F, sequence as shown in SEQ ID No. 4), and ilvIH mutant (containing the double point mutation G41A-C50T, ilvIH mutant sequence as shown in SEQ ID No. 5) were constructed into a vector to relieve L-isoleucine feedback inhibition.

[0025] PCR was performed with the synthesized cimA gene as a template and cimA-F (tcttttaagaaggagatatacatatgatggtgcgcatttttgataccac, SEQ ID No. 6) and cimA-R2 (ccttactcgagtttggatccTTAGTTCAGCAGCATGTTAATGCCTTCCAT, SEQ ID No. 32) as primers to obtain a gene fragment cimA of about 1500 bp and perform PCR product purification. PCR was performed with the plasmid pBbA1K (purchased from Addgene) as a template and primer pBbA1K-F (ggatccaaactcgagtaaggatctccaggca, SEQ ID No. 10) and pBbA1K-R (atgtatatctccttcttaaaagatcttttgaattctga, SEQ ID No. 11) to obtain a gene fragment pBbA1K of about 3500 bp and perform PCR product purification. The fragments cimA and pBbA1K were recombined by a recombination cloning kit (Vazyme, C115), and then introduced into the host Escherichia coli DH5a, screened and extracted to obtain the recombinant plasmid pBbA1K-cimA.

[0026] PCR was performed using the synthesized cimA gene as a template, cimA-F (tcttttaagaaggagatatacatatgatggtgcgcatttttgataccac, SEQ ID No. 6) and cimA-R (TTAGTTCAGCAGCATGTTAATGCCTTCCATCAC, SEQ ID No. 7) as primers to obtain a gene fragment cimA of about 1500 bp and perform PCR product purification. PCR was performed using the genome of E. coli MG1655 ATCC 700926 as a template, primer leuB-F (aacatgctgctgaactaatttaagaaggagatatacatatgtcgaagaattaccatattgccgtat, SEQ ID No. 8) and leuD-R (agatccttactcgagtttggatccttaattcataaacgcaggttgttttgcttcataag, SEQ ID No. 9) to obtain a gene fragment leuBCD of about 3000 bp and perform PCR product purification. PCR was performed using plasmid pBbA1K (purchased from Addgene) as a template, primer pBbA1K-F (ggatccaaactcgagtaaggatctccaggca, SEQ ID No. 10) and pBbA1K-R (atgtatatctccttcttaaaagatcttttgaattctga, SEQ ID No. 11) to obtain a gene fragment pBbA1K of about 3500 bp and perform PCR product purification. Fragments cimA, leuBCD and pBbA1K were recombined by recombination cloning kit (Vazyme, C115), and then introduced into host E. coli DH5a, screened and extracted to obtain recombinant plasmid pBbA1K-cimA-leuBCD.

[0027] The genomic DNA of E. coli MG1655 was used as a template for PCR with primers ilvA-F (ggataacaatttcacacaggaaacagaccatggctgactcgcaacccctgtccggtg, SEQ ID No. 12), ilvA(F352A)-R (ccgccaagcagttggcagaatttgagcgcgctgcctttttcttccggaatgg, SEQ ID No. 13) to obtain a gene fragment ilvA-1 of about 1000 bp and purify the PCR product. The primers ilvA(R362F)-F (tcaaattctgccaactgcttggcgggttctcggtcaccgagttcaactaccgttt, SEQ ID No. 14) and ilvA-R (acccgccaaaaagaacctgaacgccgggttattggtttcgtcgtggcaatcg, SEQ ID No. 15) were used for PCR to obtain a gene fragment ilvA-2 of about 500 bp and purify the PCR product. The genomic DNA of E. coli MG1655 was used as a template for PCR with primers ilvI-F (cccggcgttcaggttctttttggcgggttagtttaagaaggagatatacatatggagatgttgtctggagccgaga, SEQ ID No. 16), ilvH(G41A,C50T)-R (ccaatcacgcggAataacgcgTctgattcattttcgagtaagactgat, SEQ ID No. 17) to obtain a gene fragment ilvIH-1 of about 1800 bp and purify the PCR product. The primers ilvH(G41A,C50T)-F (cagAcgcgttatTccgcgtgattggccttttttcccag, SEQ ID No. 18) and ilvH-R (caggtcgactctagaggatcctcaacgcattattttatcgccgcgcga, SEQ ID No. 19) were used for PCR to obtain a gene fragment ilvIH-2 of about 400 bp and purify the PCR product. The plasmid pTrc99a was used as a template for PCR with primers pTrc99a-F (ggatcctctagagtcgacctgcaggcatgc, SEQ ID No. 20) and pTrc99a-R (ggtctgtttcctgtgtgaaattgttatccg, SEQ ID No. 21) to obtain a gene fragment pTrc99a of about 4000 bp and purify the PCR product.The fragments ilvA-1, ilvA-2, ilvIH-1, ilvIH-2 and pTrc99a were recombined by recombination cloning kit (Vazyme, C115), and then introduced into host E. coli DH5a, screened and extracted to obtain recombinant plasmid pTrc99a-ilvAIH.

[0028] The gene fragment ilvIH of about 2200 bp was obtained by PCR using recombinant plasmid pTrc99a-ilvAIH as a template and primers ilvI-F2 (taacaatttcacacaggaaacagaccatggagatgttgtctggagccgagatg, SEQ ID No. 22) and ilvH-R (SEQ ID No. 19), and PCR product purification was performed. The gene fragment pTrc99a of about 4000 bp was obtained by PCR using plasmid pTrc99a as a template and primers pTrc99a-F (SEQ ID No. 20) and pTrc99a-R (SEQ ID No. 21), and PCR product purification was performed. The fragments ilvIH and pTrc99a were recombined by recombination cloning kit (Vazyme, C115), and then introduced into host E. coli DH5a, screened and extracted to obtain recombinant plasmid pTrc99a-ilvIH.

[0029] Example 2 Construction of L-isoleucine engineering bacteria

[0030] The genomic DNA of E. coli MG1655 was used as a template for PCR with primers tdh-UP-F (ttcctgctttgatgctaacggtggcct, SEQ ID No. 23) and tdh-UP-R (gcattatacgagccggatgattaattgtcaaagtcccgcagatggctgttttac, SEQ ID No. 24) to obtain a gene fragment tdh-UP of about 1000 bp and purification of the PCR product. The genomic DNA of E. coli MG1655 was used as a template for PCR with primers tdh-DOWN-F (gatgatgaatcatcagtaacacgaacaagggctggtattcca, SEQ ID No. 25) and tdh-DOWN-R (ggcataatttcgatttaatttctc, SEQ ID No. 26) to obtain a gene fragment tdh-DOWN of about 1000 bp and purification of the PCR product. The genomic DNA of E. coli MG1655 was used as a template for PCR with primers thrABC-F (atccggctcgtataatgcacacaggaaacagaccatgcgagtgttgaagttcggcggta, SEQ ID No. 27) and thrABC-R (tggaataccagcccttgttcgtgttactgatgattcatcatcaatttac, SEQ ID No. 28) to obtain a gene fragment thrABC of about 1000 bp and purification of the PCR product.

[0031] The fragments tdh-UP, tdh-DOWN and thrABC were subjected to overlap PCR to obtain the targeting fragment. The plasmid pTarget (Jiang, Y., Chen, B., Duan, C.L., Sun, B.B., Yang, J.J., and Yang, S. (2015) Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol 81: 2506-2514. Jiang, et al. 2015) was used as the template, and the primers tdh-N20-F (tcgtctgatatgtctatcgacgttttagagctagaaatagcaagttaaaat, SEQ ID No. 29) and tdh-N20-R (gtcgatagacatatcagacgactagtattatacctaggactgagctag, SEQ ID No. 30) were used for amplification to obtain pTarget-tdh. The targeting fragment was transformed into E. coli MG1655 by electroporation using an electroporator (Biorad), with the voltage at 2.5 KV, the resistance at 200 Ω, and the capacitance at 25 μF (the width of the shock cup was 2 mm). The recombinant strain capable of producing threonine was screened and named E. coil-△tdh::Ptrc-thrABC.

[0032] The recombinant plasmids pTrc99a-ilvAIH and pBbA1K prepared in Example 1 were transformed into E. coil-△tdh::Ptrc-thrABC by electroporation (conditions as above) to obtain a recombinant strain named E. coil-△tdh::Ptrc-thrABC / ilvAIH, which was capable of synthesizing L-isoleucine through the threonine pathway and did not contain the shikimic acid synthase pathway.

[0033] The recombinant plasmids pTrc99a-ilvIH and pBbAlK-cimA-leuBCD prepared in Example 1 were transformed into E. coli-MG1655 by electroporation (conditions as above) to obtain a recombinant strain named E. coli-MG1655 / ilvIH-cimA-BCD. The recombinant plasmids pTrc99a-ilvIH and pBbAlK-cimA were transformed into E. coli-MG1655 by electroporation (conditions as above) to obtain a recombinant strain named E. coli-MG1655 / ilvIH-cimA. These two recombinant strains can only synthesize 2-ketobutyrate and L-isoleucine through the citramalate synthase pathway because they do not overexpress the key genes of the threonine synthesis pathway, thrABC, and ilvA, which is relieved of the feedback inhibition of L-isoleucine. The recombinant plasmids pTrc99a-ilvIH and pBbAlK were transformed into E. coli-MG1655 by electroporation (conditions as above) to obtain a recombinant strain named E. coli-MG1655 / ilvIH. This strain only overexpresses the ilvIH gene and cannot effectively synthesize 2-ketobutyrate.

[0034] The recombinant plasmids pTrc99a-ilvAIH and pBbAlK-cimA-leuBCD prepared in Example 1 were transformed into E. coli-△tdh::Ptrc-thrABC by electroporation (conditions as above) to obtain a recombinant strain named E. coli-△tdh::Ptrc-thrABC / ilvAIH-cimA. This recombinant strain can synthesize 2-ketobutyrate and L-isoleucine through both the threonine pathway and the citramalate synthase pathway.

[0035] Example 3 Fermentation of recombinant E. coli to produce L-isoleucine

[0036] The recombinant strains E. coli-MG1655 / ilvIH, E. coli-MG1655 / ilvIH-cimA, E. coli-MG1655 / ilvIH-cimA-BCD, E. coli-△tdh::Ptrc-thrABC / ilvAIH and E. coli-△tdh::Ptrc-thrABC / ilvAIH-cimA prepared in Example 2 were cultured overnight on LB plates. Single colonies were inoculated into 5 ml of LB medium in test tubes from the fresh plates and cultured at 37°C, 200 rpm for 12 hours.

[0037] Inoculate 5% into 50 ml of fermentation medium in a 500 ml baffled flask and incubate at 37°C, 200 rpm until the OD 600For 0.6, add 0.1 mM IPTG, co-culture for 48 h.

[0038] Each liter of fermentation medium includes: glucose 20 g, magnesium sulfate heptahydrate 0.8 g, diammonium phosphate 4 g, potassium phosphate monobasic 6.67 g, potassium citrate 1.35 g, 3-morpholinopropanesulfonic acid 20.9 g, yeast powder 2.5 g, ferrous sulfate heptahydrate 50 mg, calcium chloride dihydrate 10 mg, zinc sulfate heptahydrate 11 mg, manganese sulfate tetrahydrate 2.5 mg, copper sulfate pentahydrate 5 mg, ammonium molybdate 0.5 mg, sodium borate decahydrate 0.1 mg.

[0039] The product concentration and the growth of the strains were detected by liquid chromatography during the fermentation process, and the results are shown in Tables 1 and 2. As can be seen from Tables 1 and 2, the control strain E. coil-MG1655 / ilvIH cannot synthesize isoleucine, and after introducing cimA (strain E. coil-MG1655 / ilvIH-cimA) or cimA-leuBCD (strain E. coil-MG1655 / ilvIH-cimA-BCD) in the strain, L-isoleucine can be synthesized only through the citramalate synthase pathway. Meanwhile, after further introducing cimA-leuBCD in the strain E. coil-△tdh::Ptrc-thrABC / ilvAIH which retains the natural threonine and isoleucine synthesis pathways of E. coli (strain E. coil-△tdh::Ptrc-thrABC / ilvAIH-cimA), the yield and production efficiency of L-isoleucine can also be significantly improved.

[0040] Table 1 Growth of different strains (OD 600 )

[0041]

[0042] Table 2 L-isoleucine yield of different strains (g / L)

[0043]

[0044] Although the present application has been described in detail with general description and specific embodiments above, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of the present application claimed.

Claims

1. A recombinant microorganism, characterized in that, Compared with the starting strain, the recombinant microorganism expresses cimA mutant and ilvIH mutant; the starting strain is Escherichia coli; The amino acid sequence of the cimA mutant is shown in SEQ ID No. 1; the nucleotide sequence of the ilvIH mutant is shown in SEQ ID No.

5.

2. The recombinant microorganism according to claim 1, characterized in that, The recombinant microorganism further overexpresses leuBCD compared to the starting strain.

3. The recombinant microorganism according to claim 2, characterized in that, The recombinant microorganism further overexpresses thrABC and expresses the ilvA mutant compared to the starting strain; the nucleotide sequence of the ilvA mutant is shown in SEQ ID No.

4.

4. The recombinant microorganism according to claim 3, characterized in that, The nucleotide sequence of the cimA mutant is shown in SEQ ID No. 2; The nucleotide sequence of the leuBCD is shown in SEQ ID No. 3; The nucleotide sequence of the thrABC is shown in SEQ ID No.

31.

5. The use of the recombinant microorganisms according to any one of claims 1-4 in the fermentation production of L-isoleucine, the genetic breeding of microorganisms for the production of L-isoleucine, or in increasing the yield of L-isoleucine synthesized by biological methods.

6. A cimA mutant, characterized in that, The amino acid sequence is shown in SEQ ID No.

1.

7. A DNA molecule, characterized in that, The nucleotide sequence is shown in SEQ ID No. 2 or 4.

8. The application of the DNA molecule of claim 7 in the construction of recombinant microorganisms, wherein the recombinant microorganisms can ferment to produce L-isoleucine, and the starting strain is Escherichia coli.

9. A method for producing L-isoleucine by fermentation, characterized in that, Includes the step of culturing the recombinant microorganisms as described in any one of claims 1-4.

10. A method for constructing recombinant microorganisms for producing L-isoleucine, characterized in that, This includes expressing the cimA mutant and the ilvIH mutant in the starting strain; the starting strain is Escherichia coli; the amino acid sequence of the cimA mutant is shown in SEQ ID No. 1; The nucleotide sequence of the ilvIH mutant is shown in SEQ ID No.

5.

11. The method according to claim 10, characterized in that, It also includes the step of further overexpressing leuBCD in the starting strain; the nucleotide sequence of said leuBCD is shown in SEQ ID No.

3.

12. The method according to claim 11, characterized in that, It also includes the step of further overexpressing thrABC and expressing the ilvA mutant in the starting strain; the nucleotide sequence of the ilvA mutant is shown in SEQ ID No. 4; the nucleotide sequence of the thrABC is shown in SEQ ID No. 31.

Citation Information

Patent Citations

  • L-isoleucine production strain as well as construction method and application thereof

    CN117925666A