Chitosanase mutant, plasmid, recombinant bacteria and application thereof for changing product polymerization degree

Abstract

The present invention relates to a chitosanase mutant, plasmid, recombinant bacteria and application thereof for changing the polymerization degree of a product, belonging to the field of enzyme engineering technology, wherein the mutant is Csn-BJ-A134C or Csn-BJ-Q97K, the amino acid sequence of the mutant Csn-BJ-A134C is SEQ ID NO:1, the amino acid sequence of the mutant Csn-BJ-Q97K is SEQ ID NO:2, and the amino acid sequence of the wild-type chitosanase Csn-BJ is shown in SEQ ID NO:3. The present invention also provides a recombinant vector, recombinant bacteria and enzyme preparation containing the mutant gene and application thereof. The mutant of the present invention is derived from the chitosanase Csn-BJ of the GH46 family, and the catalytic activity of the chitosanase is improved by molecular mutation modification of the chitosanase, and the polymerization degree of the final product chitosan oligosaccharide is changed, so that the polymerization degree of its minimum hydrolysis substrate is increased, laying the foundation for its industrial application.

Description

Technical Field

[0001] The application belongs to the field of enzyme engineering technology, and specifically relates to a chitosanase mutant, plasmid, recombinant bacteria and applications thereof for changing the degree of polymerization of the product. Background Art

[0002] Chitosan is a polysaccharide macromolecule formed by D-glucosamine linked by β-1,4-glycosidic bonds, which can be obtained by partial or complete deacetylation of chitin. Chitosan has many special properties such as biodegradability and cell affinity, but its large molecular weight and poor water solubility limit the biological activity of chitosan and the study of its activity. Chitosan can generate chitooligosaccharides composed of 2 to 20 D-glucosamines after enzymatic reaction or chemical degradation.

[0003] Compared with chitosan, chitosan oligosaccharides with lower molecular weight have good solubility and multiple biological functions, as well as superior biocompatibility, low toxicity and environmental friendliness, and have broad application prospects in the food, health care products and pharmaceutical industries. At present, chitosan oligosaccharides can be prepared by physical methods, traditional chemical methods, electrochemical methods and bioenzymatic methods. Among them, the bioenzymatic method has the advantages of mild and controllable reaction process and green environmental protection, and has received widespread attention in recent years.

[0004] Chitosanase is a glycoside hydrolase that specifically degrades the β-1,4-glycosidic bonds in chitosan. It is widely available from Bacillus sp. Bacillus )、Pseudomonas ( Pseudomonas ) etc. According to the similarity of amino acid sequence, chitosanase can be divided into 7 GH families, including GH3, GH5, GH7, GH8, GH46, GH75 and GH80 families. Among them, the GH46 family chitosanase that can only hydrolyze chitosan has been studied most deeply. Most GH46 family chitosanases follow the endo-type hydrolysis mechanism, and the product of chitosan hydrolysis is usually a mixture of low-polymerization degree chitosan oligosaccharides. A large number of studies have shown that the biological activity of chitosan oligosaccharides is related to its degree of polymerization, and its activity increases with the increase of degree of polymerization. However, the difficulty of preparing chitosan oligosaccharides with a specific degree of polymerization and the market price also increase with the increase of degree of polymerization. Therefore, the existing chitosanase is modified by protein engineering to obtain chitosanase mutants with improved hydrolysis activity, while changing the degree of polymerization of the final product has important theoretical significance and broad application prospects. Summary of the invention

[0005] The purpose of the present invention is to provide a chitosanase mutant with changed product polymerization degree and its application. The mutant is derived from GH46 family chitosanase Csn-BJ. By molecularly modifying chitosanase, the catalytic activity of chitosanase is improved, and the polymerization degree of the final product chitosan oligosaccharide is changed, so that the polymerization degree of its minimum hydrolysis substrate is increased, laying a foundation for its industrial application.

[0006] The present invention is achieved through the following technical solutions:

[0007] One of the technical solutions of the present invention is to provide a chitosanase mutant with changed product polymerization degree, wherein the mutant is Csn-BJ-A134C or Csn-BJ-Q97K, the amino acid sequence of the mutant Csn-BJ-A134C is SEQ ID NO: 1, the amino acid sequence of the mutant Csn-BJ-Q97K is SEQ ID NO: 2, and the amino acid sequence of the wild-type chitosanase Csn-BJ is shown in SEQ ID NO: 3.

[0008] The second technical solution of the present invention is to provide a gene encoding the chitosanase mutant, the nucleotide sequence of the gene of the mutant Csn-BJ-A134C is shown in SEQ ID NO:4, the nucleotide sequence of the gene of the mutant Csn-BJ-Q97K is shown in SEQ ID NO:5, and the nucleotide sequence of the wild-type chitosanase Csn-BJ is shown in SEQ ID NO:6.

[0009] The third technical solution of the present invention is to provide a recombinant vector, which carries a gene encoding the chitosanase mutant, and the expression vector is preferably pET-28a(+).

[0010] A recombinant bacterium carrying a gene encoding the chitosanase mutant, wherein the expression host is preferably E. coli BL21(DE3).

[0011] The present invention also provides the use of the chitosanase mutant in catalyzing the hydrolysis of chitosan to produce chitosan oligosaccharides. Specifically, when the mutant of the present invention catalyzes the hydrolysis of chitosan, the polymerization degree of the hydrolysis end product changes. The product of the wild-type chitosanase Csn-BJ is monosaccharide and chitobiose; the product of the mutant Csn-BJ-A134C changes to monosaccharide, chitobiose and chitotriose; the product of the mutant Csn-BJ-Q97K changes to chitobiose and chitotriose.

[0012] The invention also provides an enzyme preparation, which comprises the chitosanase mutant.

[0013] The beneficial effects of the present invention compared with the prior art are as follows: the mutant of the present invention is derived from the GH46 family chitosanase Csn-BJ, and the catalytic activity of the chitosanase is improved by molecular mutation modification of the chitosanase, and the polymerization degree of the final product chitosan oligosaccharide is changed, so that the polymerization degree of the minimum hydrolysis substrate is increased, laying a foundation for its industrial application. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1The electrophoretic diagrams of the purification of wild-type chitosanase Csn-BJ and its mutants Csn-BJ-A134C and Csn-BJ-Q97K in the examples of the present invention are shown; (A) Lane M, protein marker; Lane 1, purified chitosanase Csn-BJ; (B) Lane M, protein marker; Lane 1, purified chitosanase mutant Csn-BJ-A134C; Lane 2, purified chitosanase mutant Csn-BJ-Q97K;

[0015] Figure 2 The thin layer chromatograms of the hydrolysis products of chitosan and chitosan oligosaccharides (with a degree of polymerization of 1 to 6) catalyzed by the wild-type chitosanase Csn-BJ in the examples of the present invention; (A) is a thin layer chromatogram of the hydrolysis products of chitosan catalyzed by the wild-type chitosanase Csn-BJ; (B) is a thin layer chromatogram of the hydrolysis products of monosaccharides and chitobiose catalyzed by the wild-type chitosanase Csn-BJ; (C) is a thin layer chromatogram of the hydrolysis products of chitotriose and chitotetraose catalyzed by the wild-type chitosanase Csn-BJ; (D) is a thin layer chromatogram of the hydrolysis products of chitopentaose and chitohexaose catalyzed by the wild-type chitosanase Csn-BJ;

[0016] Figure 3 The figure is a thin layer chromatogram of the hydrolysis products of chitosan and chitosan oligosaccharide (with a degree of polymerization of 1 to 6) catalyzed by the chitosanase mutant Csn-BJ-A134C in the embodiment of the present invention;

[0017] Figure 4 The figure is a thin layer chromatogram of the hydrolysis products of chitosan and chitosan oligosaccharides (with a degree of polymerization of 1 to 6) catalyzed by the chitosanase mutant Csn-BJ-Q97K in the examples of the present invention. DETAILED DESCRIPTION

[0018] The present invention is described in detail below with reference to the embodiments.

[0019] Example 1. Construction of chitosanase Csn-BJ mutant

[0020] Two non-conserved sites A134 and Q97 near the substrate binding pocket of Csn-BJ were selected for mutation. Using the plasmid pET-28a(+) / BJ of chitosanase Csn-BJ as a template, primers were designed for PCR amplification to construct chitosanase mutants Csn-BJ-A134C and Csn-BJ-Q97K. The primer sequences are shown in Table 1, and the PCR reaction system and conditions are shown in Tables 2 and 3.

[0021] Table 1 Primer sequences

[0022] ;

[0023] Table 2 PCR reaction system

[0024] ;

[0025] Table 3 PCR reaction conditions

[0026] .

[0027] Example 2: Digestion and transformation of recombinant plasmid

[0028] Add 1 μL per 25 μL reaction solution Dpn I digested the residual pET-28a(+) / BJ plasmid, incubated at 37°C for 1 h, and then transformed the PCR product into E. coli BL21(DE3) competent cells. Single colonies were picked for sequencing to verify the mutation. The strains with correct sequencing were stored in glycerol tubes.

[0029] Example 3. Induced expression and purification of chitosanase Csn-BJ and chitosanase mutants Csn-BJ-A134C and Csn-BJ-Q97K

[0030] Chitosanase Csn-BJ and the successfully constructed recombinant bacteria Csn-BJ-A134C and Csn-BJ-Q97K were induced to express and cultured in LB medium containing kanamycin (100 μg / mL). 600 When it reaches 0.6-0.8, add IPTG with a final concentration of 0.1 mM to induce protein expression, and continue to culture at 20°C and 200 rpm for 20 h. Collect the bacteria by centrifugation at 4°C, resuspend the bacterial cells with NPI-0 and ultrasonically disrupt them at 30% power for 20 min, and centrifuge to obtain the supernatant after disruption. Under low temperature, pass the supernatant through a 0.45 μm aqueous filter membrane and load it onto a Ni-NTA affinity chromatography column for purification. First, elute the impurities with an elution buffer NPI-20 containing 20 mM imidazole, and then elute the bound target protein with an elution buffer NPI-200 containing 200 mM imidazole. The collected solution containing the target protein was desalted and concentrated by ultrafiltration, and finally chitosanase Csn-BJ, chitosanase mutants Csn-BJ-A134C and Csn-BJ-Q97K pure enzymes were obtained, such as Figure 1 shown.

[0031] Amino acid sequence of chitosanase mutant Csn-BJ-A134C (SEQ ID NO: 1):

[0032] MYKTSNELVSNKTKFFMILLCFTVIASFSSLSGPSPAKAFAEENGTPVQETIDLNEGFDNSNEASIGSLSLTSEEATSQATVAAIDHDANFSPSTLQFLKANTGLDGEQWDNIMKLVNKPEQDSLKWTEFYGYCEDIGDNRGYTIGIFGATTGGSNDTGPDGPDLFKAFDAASGASSPSIAGGLARAGLKGKMSGSILKLSDSDSVIKKKIKALQNNEAWREATWRTFYDTYIKYSVQQAQKRGFNTALTIGSFVDTALNQGATGDSGSLEGILSRSGSSTNEKTFMTNFYAKRTLIVDTNDYNQPPNGKNRVKQWSSLLASGETDLKNADAAVIKVTNWEMK;

[0033] Amino acid sequence of chitosanase mutant Csn - BJ - Q97K (SEQ ID NO:2):

[0034] MYKTSNELVSNKTKFFMILLCFTVIASFSSLSGPSPAKAFAEENGTPVQETIDLNEGFDNSNEASIGSLSLTSEEATSQATVAAIDHDANFSPSTLKFLKANTGLDGEQWDNIMKLVNKPEQDSLKWTEFYGYAEDIGDNRGYTIGIFGATTGGSNDTGPDGPDLFKAFDAASGASSPSIAGGLARAGLKGKMSGSILKLSDSDSVIKKKIKALQNNEAWREATWRTFYDTYIKYSVQQAQKRGFNTALTIGSFVDTALNQGATGDSGSLEGILSRSGSSTNEKTFMTNFYAKRTLIVDTNDYNQPPNGKNRVKQWSSLLASGETDLKNADAAVIKVTNWEMK;

[0035] Amino acid sequence of chitosanase Csn - BJ (SEQ ID NO:3):

[0036] MYKTSNELVSNKTKFFMILLCFTVIASFSSLSGPSPAKAFAEENGTPVQETIDLNEGFDNSNEASIGSLSLTSEEATSQATVAAIDHDANFSPSTLQFLKANTGLDGEQWDNIMKLVNKPEQDSLKWTEFYGYAEDIGDNRGYTIGIFGATTGGSNDTGPDGPDLFKAFDAASGASSPSIAGGLARAGLKGKMSGSILKLSDSDSVIKKKIKALQNNEAWREATWRTFYDTYIKYSVQQAQKRGFNTALTIGSFVDTALNQGATGDSGSLEGILSRSGSSTNEKTFMTNFYAKRTLIVDTNDYNQPPNGKNRVKQWSSLLASGETDLKNADAAVIKVTNWEMK;

[0037] Nucleotide sequence of chitosanase mutant Csn - BJ - A134C (SEQ ID NO:4):

[0038] ATGTACAAAACCTCTAACGAACTGGTTTCTAACAAAACCAAATTCTTCATGATCCTGCTGTGCTTCACCGTTATCGCTTCTTTCTCTTCTCTGTCTGGTCCGTCTCCGGCTAAAGCTTTCGCTGAAGAAAACGGTACCCCGGTTCAGGAAACCATCGACCTGAACGAAGGTTTCGACAACTCTAACGAAGCTTCTATCGGTTCTCTGTCTCTGACCTCTGAAGAAGCTACCTCTCAGGCTACCGTTGCTGCTATCGACCACGACGCTAACTTCTCTCCGTCTACCCTGCAATTCCTGAAAGCTAACACCGGTCTGGACGGTGAACAGTGGGACAACATCATGAAACTGGTTAACAAACCGGAACAGGACTCTCTGAAATGGACCGAATTCTACGGTTACTGCGAAGACATCGGTGACAACCGTGGTTACACCAT

[0039] CGGTATCTTCGGTGCTACCACCGGTGGTTCTAACGACACCGGTCCGGACGGTCCGGACCTGTTCAAAGCTTTCGACGCTGCTTCTGGTGCTTCTTCTCCGTCTATCGCTGGTGGTCTGGCTCGTGCTGGTCTGAAAGGTAAAATGTCTGGTTCTATCCTGAAACTGTCTGACTCTGACTCTGTTATCAAAAAAAAAATCAAAGCTCTGCAGAACAACGAAGCTTGGCGTGAAGCTACCTGGCGTACCTTCTACGACACCTACATCAAATACTCTGTTCAGCAGGCTCAGAAACGTGGTTTCAACACCGCTCTGACCATCGGTTCTTTCGTTGACACCGCTCTGAACCAGGGTGCTACCGGTGACTCTGGTTCTCTGGAAGGTATCCTGTCTCGTTCTGGTTCTTCTACCAACGAAAAAACCTTCATGACCAACTTCTACGCTAAACGTACCCTGATCGTTGACACCAACGACTACAACCAGCCGCCGAACGGTAAAAACCGTGTTAAACAGTGGTCTTCTCTGCTGGCTTCTGGTGAAACCGACCTGAAAAACGCTGACGCTGCTGTTATCAAAGTTACCAACTGGGAAATGAAA。

[0040] Nucleotide sequence of chitosanase mutant Csn-BJ-Q97K (SEQ ID NO:5):

[0041]

[0042] Nucleotide sequence of chitosanase Csn-BJ (SEQ ID NO: 6):

[0043]

[0044] Example 4. Activity detection of chitosanase mutants

[0045] Colloidal chitosan (1%, w / v) was used as substrate, and appropriate amounts of pure enzymes of Csn-BJ, Csn-BJ-A134C and Csn-BJ-Q97K were added, respectively. The hydrolysis reaction was carried out at 30°C for 10 min, and then 375 μL of DNS reagent was added to terminate the reaction, followed by boiling for 10 min. The reducing sugar in the mixture was measured at 520 nm. The enzymatic activity of chitosanase Csn-BJ was measured to be 61.06 U / mg, and the enzymatic activities of mutants Csn-BJ-A134C and Csn-BJ-Q97K were 141.06 and 156.98 U / mg, respectively, which were 1.3 and 1.57 times higher than those of wild-type chitosanase, respectively.

[0046] Example 5. Analysis of hydrolysis products of chitosanase mutants

[0047] Colloidal chitosan and chitosan oligosaccharides (polymerization degree of 1-6) were used as substrates, respectively, and appropriate amounts of pure enzymes of Csn-BJ, Csn-BJ-A134C and Csn-BJ-Q97K were added. The reaction was carried out at 37°C and samples were taken at different times. The reaction was terminated by adding two volumes of anhydrous ethanol to the reaction solution, and the reaction solution was centrifuged for 10 min (10,000 rpm) to remove the protein precipitate in the reaction solution. The supernatant was spotted on a silica gel plate, and n-propanol: 25% ammonia water: water (8:3:1, v / v / v) was used as the developing agent, and 0.1% ninhydrin ethanol solution was used as the color developer. The plate was baked at 100°C for 10 min, and the hydrolyzate was analyzed by thin layer chromatography. Figure 2-4 As shown, the minimum hydrolysis substrate of chitosanase Csn-BJ is chitotriose, and the final products of chitosan degradation are monosaccharides and chitobiose; while the minimum hydrolysis substrate of chitosanase mutants Csn-BJ-A134C and Csn-BJ-Q97K is chitotetraose, and the corresponding degradation products are monosaccharides, chitobiose and chitotriose, and chitobiose and chitotriose, respectively.

[0048] The above embodiments are only for illustrating the technical concept and features of the present invention, and cannot be used to limit the protection scope of the present invention. Those skilled in the art can make various changes or modifications according to the present invention, and these equivalent forms are also included in the scope defined by the claims attached to this application.

Claims

1. A chitosanase mutant with a changed product polymerization degree, characterized in that: The mutant is Csn-BJ-A134C or Csn-BJ-Q97K, the amino acid sequence of the mutant Csn-BJ-A134C is SEQ ID NO: 1, the amino acid sequence of the mutant Csn-BJ-Q97K is SEQ ID NO: 2, and the amino acid sequence of the wild-type chitosanase Csn-BJ is shown in SEQ ID NO:

3.

2. A gene encoding the chitosanase mutant according to claim 1, characterized in that: The nucleotide sequence of the gene encoding the mutant Csn-BJ-A134C is shown in SEQ ID NO:4, the nucleotide sequence of the gene encoding the mutant Csn-BJ-Q97K is shown in SEQ ID NO:5, and the nucleotide sequence of the gene encoding the wild-type chitosanase Csn-BJ is shown in SEQ ID NO:

6.

3. A recombinant vector, characterized in that: The recombinant vector carries the gene encoding the chitosanase mutant according to claim 1, and the expression vector is pET-28a(+).

4. A recombinant bacterium, characterized in that: The recombinant bacteria carries the gene encoding the chitosanase mutant according to claim 1, and the expression host is E. coli BL21 (DE3).

5. Use of the chitosanase mutant according to claim 1, the gene according to claim 2, the recombinant vector according to claim 3 or the recombinant bacteria according to claim 4 in catalyzing the hydrolysis of chitosan to produce chitooligosaccharides.

6. An enzyme preparation, characterized in that The enzyme preparation comprises the chitosanase mutant according to claim 1.

Images