SNP (Single Nucleotide Polymorphism) typing kit based on double Cas enzymes and single-tube typing method

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) typing kit based on double Cas enzymes and a single-tube typing method, and belongs to the technical field of genetic typing. The invention provides an SNP (Single Nucleotide Polymorphism) typing kit based on double Cas enzymes, which is characterized in that the two Cas enzymes are combined for use, two sgRNAs (Single Guide Ribonucleic Acid) are designed aiming at a target SNP site to respectively target wild type and mutant type sites and sequences nearby the wild type and mutant type sites, and meanwhile, two single-stranded DNA (Deoxyribose Nucleic Acid) fluorescent probes which are only subjected to specific trans-cleavage by the two Cas enzymes are screened out. When the Cas enzyme-sgRNA compound is combined with a target chain, the trans-cleavage activity of the compound is activated, a corresponding single-stranded DNA fluorescent probe is cleaved, and a system can emit red fluorescence, orange fluorescence and yellow fluorescence under the irradiation of blue light and respectively correspond to a wild type, a heterozygous mutant type and a homozygous mutant type of a target SNP (Single Nucleotide Polymorphism). The SNP typing kit disclosed by the invention can be used for rapidly detecting a DNA sample of a pig at normal temperature, and the result is accurate.

Description

Technical Field

[0001] The present invention belongs to the technical field of genotyping, and in particular relates to a SNP typing kit based on dual Cas enzymes and a single-tube typing method. Background Art

[0002] Single nucleotide polymorphism (SNP) mainly refers to DNA sequence polymorphism caused by the variation of a single nucleotide at the genomic level. This variation may affect the transcription process of DNA and then affect the synthesis of proteins, ultimately changing the metabolic process and affecting the individual's traits. Therefore, the detection of SNP is extremely important in animal husbandry production. There are many methods for detecting SNP, such as sequencing, allele-specific amplification, enzyme digestion, high-resolution melting curve method, etc. The CRISPR / Cas system has gradually been applied to SNP detection due to its wide adaptability, strong specificity and high sensitivity. Chen et al. invented a CRISPR / Cas12a biochip (Chen Y, Mei Y, Jiang X. Universal and high-fidelity DNA single nucleotide polymorphism detection based on a CRISPR / Cas12a biochip [J]. Chemical Science, 2021, 12 (12): 4455-4462.) to detect DNA single nucleotide polymorphisms. They successfully detected SNP sites of three genes in 17 human clinical blood samples. However, since one channel of the chip can only detect one base type, the complete typing of a SNP site is achieved through two channels. At present, there are relatively few studies on nucleic acid detection technology developed based on the CRISPR / Cas system for SNP detection, most of which are for the detection of pathogen sequences. However, the two are similar in detection principle and both belong to nucleic acid detection. Therefore, most pathogen detection technologies based on the CRISPR / Cas system can be used for the detection of SNP sites. In many related studies, pathogen detection and SNP detection are also linked together when developing nucleic acid detection technologies based on the CRISPR / Cas system. The SHERLOCKv2 technology developed by Zhang Feng's team (Gootenberg JS, Abudayyeh OO, Kellner MJ, et al. Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6 [J]. Science, 2018, 360 (6387): 439-444.) combines four types of Cas proteins (LwaCas13a, PsmCas13b, CcaCas13b and AsCas12a) to cut reporter molecules labeled with different fluorescent groups and detect them in four channels respectively, thus achieving quantitative and simultaneous detection of four nucleic acid sequences. However, SHERLOCKv2 uses multiplexed detection, so it still needs to be achieved through multiple channels when performing SNP typing.Wang et al. developed a single-tube dual-gene detection technology based on the combination of CRISPR / Cas12a and CRISPR / Cas13a (Wang Y, Fu L, Tao D, et al. Development of a Naked Eye CRISPR-Cas12a and-Cas13a Multiplex Point-of-Care Detection of Genetically Modified Swine [J]. ACS Synthetic Biology, 2023, 12 (7): 2051-2060.), in which RPA amplification is performed by introducing a T7 promoter in one of the genes by designing a primer, and then transcribed into RNA by T7 transcriptase, and then cleverly using the different characteristics of Cas12a and Cas13a target chain types to achieve a single-tube dual-gene detection technology. This method can be used to achieve typing of SNP sites, but considering the cost and the instability of RNA, this technology is difficult to apply to large-scale SNP typing in animal production.

[0003] In summary, the SNP detection technology based on the CRISPR / Cas system has the advantages of being fast and accurate. However, since SNPs have three genotypes: wild type, heterozygous mutation, and homozygous mutation, the current detection method based on the CRISPR / Cas system usually requires double-tube detection to fully type a SNP site. Summary of the invention

[0004] The present invention provides a dual-Cas enzyme-based SNP typing kit and a single-tube typing method, which can achieve single-tube differentiation of three site types: wild type, heterozygous mutation and homozygous mutation.

[0005] The present invention provides a dual-Cas enzyme-based SNP typing kit, comprising a first Cas enzyme, a second Cas enzyme, a first sgRNA targeting a wild-type SNP typing site, a second sgRNA targeting a mutant SNP typing site, a first single-stranded DNA fluorescent probe, and a second single-stranded DNA fluorescent probe;

[0006] The first sgRNA specifically binds to a first Cas enzyme, and the second sgRNA specifically binds to a second Cas enzyme;

[0007] The first single-stranded DNA fluorescent probe is specifically trans-cleaved by a first Cas enzyme, and the second single-stranded DNA fluorescent probe is specifically trans-cleaved by a second Cas enzyme.

[0008] In a preferred embodiment of the present invention, a primer pair for amplifying a target DNA fragment containing a SNP molecular marker is also included.

[0009] In a preferred embodiment of the present invention, when the target DNA fragment is amplified by the RAA method, a PAM sequence is introduced into the upstream primer when designing the primer.

[0010] In a preferred embodiment of the present invention, when the SNP molecular marker is a SNP in the enhancer region of the Yorkshire pig BMP2 gene, the SNP site is rs321846600, the polymorphism is T and C, and the designed RAA primer pair includes an upstream primer having a nucleotide sequence of any one of SEQ ID No.1 to SEQ ID No.6 and a downstream primer having a nucleotide sequence of SEQ ID No.7;

[0011] The first Cas enzyme includes Cas12a; the second Cas enzyme includes Cas12b;

[0012] The nucleotide sequence of the first sgRNA is shown in SEQ ID No.8;

[0013] The nucleotide sequence of the second sgRNA is shown in SEQ ID No.9;

[0014] The sequence of the first single-stranded DNA fluorescent probe includes: 5'-ROX-CCCGGG-BHQ2-3';

[0015] The sequence of the second single-stranded DNA fluorescent probe includes: 5'-FAM-AAATTT-BHQ1-3'.

[0016] In a preferred embodiment of the present invention, when the SNP molecular marker is a SNP of Large White pig and eye muscle thickness trait, the SNP site is the rs81283791 site of the Large White pig DISC1 gene, the polymorphism is C and T, and the designed RAA primer pair includes the nucleotide sequences DISC1-F shown in SEQ ID No.10 and DISC1-R shown in SEQ ID No.11:

[0017] The first Cas enzyme includes Cas12a; the second Cas enzyme includes Cas12b;

[0018] The nucleotide sequence of the first sgRNA is shown in SEQ ID No.12;

[0019] The nucleotide sequence of the second sgRNA is shown in SEQ ID No.13;

[0020] The sequence of the first single-stranded DNA fluorescent probe includes: 5'-ROX-CCCGGG-BHQ2-3';

[0021] The sequence of the second single-stranded DNA fluorescent probe includes: 5'-FAM-AAATTT-BHQ1-3'.

[0022] The present invention also provides a method for single-tube SNP typing using the above-mentioned SNP typing kit, comprising the following steps: (1) amplifying a target DNA fragment containing a SNP molecular marker using a primer pair;

[0023] (2) A fluorescence detection system is configured using the target DNA fragment and the first Cas enzyme, the second Cas enzyme, the first sgRNA, the second sgRNA, the first single-stranded DNA fluorescent probe, and the second single-stranded DNA fluorescent probe. After the reaction, the fluorescence is detected, and the SNP typing result is determined according to the fluorescence color.

[0024] In a preferred embodiment of the present invention, the amplification in step (1) includes using sample genomic DNA as a template.

[0025] In a preferred embodiment of the present invention, the fluorescence detection system in step (2) is calculated in 30 μL and includes: 3 μL of 10×Buffer, 1 μL of a first Cas enzyme with a concentration of 1 μM, 1 μL of a second Cas enzyme with a concentration of 1 μM, 1 μL of a first sgRNA with a concentration of 10 μM, 1 μL of a second sgRNA with a concentration of 10 μM, 1 μL of a target DNA fragment, 3 μL of a first single-stranded DNA fluorescent probe with a concentration of 10 μM, 1 μL of a second single-stranded DNA fluorescent probe with a concentration of 10 μM, and the balance of ddH2O.

[0026] In a preferred embodiment of the present invention, the reaction temperature in step (2) is 48-55° C. and the reaction time is 20 min.

[0027] In a preferred embodiment of the present invention, red fluorescence indicates a wild type, yellow fluorescence indicates a homozygous mutant, and orange fluorescence indicates a heterozygous mutant.

[0028] Beneficial effect: The present invention provides a SNP typing kit based on dual Cas enzymes, and its detection process is as follows: Figure 1 As shown. In the kit of the present invention, two Cas enzymes are used in combination, and two sgRNAs are designed for the target SNP site to target the wild-type and mutant sites and the sequences near them respectively, and two single-stranded DNA fluorescent probes that are specifically trans-cut by the two Cas enzymes are screened out at the same time. When the Cas enzyme-sgRNA complex binds to the target chain, its trans-cutting activity is activated, cutting the corresponding single-stranded DNA fluorescent probe. Under the irradiation of blue light, the system will emit red, orange, and yellow fluorescence, corresponding to the wild type, heterozygous mutant, and homozygous mutant of the target SNP, respectively.

[0029] The SNP typing kit of the present invention realizes single-tube differentiation of SNPs, and combined with RAA isothermal amplification technology, can realize rapid detection of pig DNA samples at room temperature with accurate results. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is a detection flow chart of the SNP typing kit based on dual Cas enzymes of the present invention;

[0031] Figure 2 This is the RAA amplification result diagram of the SNP site BMP2-rs321846600 (T>C);

[0032] Figure 3 This is a diagram showing the results of the specificity detection of the binding between Cas12 enzyme and sgRNA;

[0033] Figure 4 This is a graph showing the results of the two enzymes' preference for ssDNA fluorescent probe cleavage;

[0034] Figure 5 This is a graph showing the single-base detection efficiency of RAA products, AacCas12b, and Lb5Cas12a;

[0035] Figure 6 A single-tube dual-enzyme detection result diagram of the BMP2-rs321846600 (T>C) site with AacCas12b and Lb5Cas12a enzymes;

[0036] Figure 7 This is the result of a single-tube dual-enzyme detection of the DISC1-rs81283791 (C>T) site using AacCas12b and Lb5Cas12a enzymes. DETAILED DESCRIPTION

[0037] The present invention provides a dual-Cas enzyme-based SNP typing kit, comprising a first Cas enzyme, a second Cas enzyme, a first sgRNA targeting a wild-type SNP typing site, a second sgRNA targeting a mutant SNP typing site, a first single-stranded DNA fluorescent probe, and a second single-stranded DNA fluorescent probe;

[0038] The first sgRNA specifically binds to a first Cas enzyme, and the second sgRNA specifically binds to a second Cas enzyme;

[0039] The first single-stranded DNA fluorescent probe is specifically trans-cleaved by a first Cas enzyme, and the second single-stranded DNA fluorescent probe is specifically trans-cleaved by a second Cas enzyme.

[0040] Two kinds of Cas enzymes are included in the kit of the present invention, and both kinds of Cas enzymes are only specifically bound to a kind of sgRNA, wherein one sgRNA targets a wild-type SNP typing site, and another sgRNA targets a mutant SNP typing site. In a specific embodiment of the present invention, Cas12a and Cas12b are selected as Cas enzymes. When designing sgRNA, the sgRNA structure of Cas12a family is relatively simple, including a recognition sequence of about 20nt in length (for complementary pairing with target DNA) and a scaffold sequence of about 20nt in length (for combining with Cas12a), and different Cas12a enzymes have slightly different scaffold sequences, but the difference is very small. The sgRNA of Cas12b family includes a recognition sequence of about 20nt in length (for complementary pairing with target DNA) and a scaffold sequence of about 91nt in length (for combining with Cas12b), and the scaffold sequences of the selected two Cas12b enzymes in the embodiment of the present invention are identical.

[0041] In one embodiment of the present invention, when Cas12a-sgRNA is obtained, the following process is followed: a biological company is commissioned to synthesize a DNA template of Cas12a-sgRNA, the template comprising a T7 promoter sequence, a scaffold sequence of Cas12a and a recognition sequence, with a length of 59bp. Since the sequence is short, complementary single-stranded DNA is first synthesized, and then double-stranded DNA is formed by annealing, and the guide RNA of Cas12a is obtained by T7 in vitro transcription and RNA purification. The acquisition of Cas12b-sgRNA is carried out according to the following process: (1) a pUC57 plasmid vector of a biological company is commissioned to synthesize Cas12b-sgRNA, the plasmid vector comprising a 20bp T7 promoter sequence, a 91bp scaffold sequence of the Cas12b enzyme, and a 27bp sequence comprising two BbsI restriction sites. (2) a single-stranded DNA sequence F of 19bp identical to the target sequence is synthesized, four bases GCAC are added to its 5' end, and its complementary strand R is synthesized, and four bases CACC are added to its 5' end. The two single-stranded DNAs are complementary paired by annealing to form double-stranded DNA with sticky ends. It is connected to the above-mentioned pUC57 plasmid vector by DNA cloning method and transformed into DH5α competent cells, and then expanded and cultured and the plasmid is extracted. (3) Primers are designed, and PCR amplification is performed using the plasmid vector successfully constructed in (2) as a template, and then Cas12b sgRNA is obtained by T7 in vitro transcription and RNA purification.

[0042] In a specific embodiment of the present invention, when the SNP molecular marker is a SNP in the enhancer region of the BMP2 gene of Yorkshire pigs, the SNP site is rs321846600, the polymorphism is T and C, and the designed RAA primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID No.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID No.2; the first Cas enzyme includes Cas12a; the second Cas enzyme includes Cas12b;

[0043] The first sgRNA is shown in SEQ ID No. 8: GAAUUUCUACUAUUGUAGAUCCAUCUGGGCACCAGUCAU;

[0044] The second sgRNA is shown in SEQ ID No. 9: GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCA GGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACCCACC UGGGCACCAGUCAU;

[0045] The sequence of the first single-stranded DNA fluorescent probe includes: 5'-ROX-CCCGGG-BHQ2-3';

[0046] The sequence of the second single-stranded DNA fluorescent probe includes: 5'-FAM-AAATTT-BHQ1-3'.

[0047] The SNP molecular marker site verified in one embodiment of the present invention has been disclosed in the article (Miao Y, Zhao Y, Wan S, et al. Integrated analysis of genome-wide association studies and 3 Depigenomic characteristics reveal the BMP2 gene regulating loin muscle depth in Yorkshire pigs [J]. M. Groenen. PLOS Genetics, 2023, 19 (6): e1010820.), which may affect the important meat production trait of Yorkshire pig loin muscle depth by affecting the expression of the BMP2 gene. In the embodiment of the present invention, it is verified that Cas12b protein will not bind to the sgRNA of Cas12a and produce cutting activity, and Cas12a protein will not bind to the sgRNA of Cas12b and produce cutting activity;And Lb5Cas12a has a cutting preference of Report 1 (5'-ROX-CCCGGG-BHQ2-3') for sequence significantly higher than Report 2 (5'-FAM-AAATTT-BHQ1-3'), and AacCas12b has a cutting preference of Report 2 significantly higher than Report 1, and the difference between the two can be easily distinguished by the naked eye. Therefore, AacCas12b and Lb5Cas12a are selected as subsequent double enzyme detection, and Report 2 is selected as the signal probe of Cas12b enzyme, and Report 1 is selected as the signal probe of Cas12a enzyme.

[0048] In a preferred embodiment of the present invention, the kit also includes a primer pair for amplifying a target DNA fragment containing a SNP molecular marker. In one embodiment of the present invention, the target DNA fragment is amplified by the RAA method, and a PAM sequence (5'-TTTN-3', wherein N is a degenerate base, representing any one of A, T, C, and G) is introduced into the upstream primer when designing the primer. In an embodiment of the present invention, the genomic DNA of the target is used as a template, and the RAA primer is used to perform RAA isothermal amplification, and then the RAA product is purified to obtain the target DNA fragment. The amplified product needs to meet the following conditions: (1) Contains a detection site; (2) Contains the PAM sequence of the Cas12 enzyme used, i.e., 5'-TTTN-3', and the PAM sequence is within 20 bp upstream of the detection site; (3) To ensure the efficiency of RAA, the length of the amplified fragment is preferably kept between 100-500 bp, and the RAA product band is accurate and single.

[0049] In another embodiment of the present invention, the SNP of Large White pig and eye muscle thickness trait is detected, the SNP site is the rs81283791 site of the Large White pig DISC1 gene, the polymorphism is C and T, and the designed RAA primer pair includes the nucleotide sequence DISC1-F shown in SEQ ID No.10 and DISC1-R shown in SEQ ID No.11:

[0050] The first Cas enzyme includes Cas12a; the second Cas enzyme includes Cas12b;

[0051] The nucleotide sequence of the first sgRNA is shown in SEQ ID No.12;

[0052] The nucleotide sequence of the second sgRNA is shown in SEQ ID No.13;

[0053] The sequence of the first single-stranded DNA fluorescent probe includes: 5'-ROX-CCCGGG-BHQ2-3';

[0054] The sequence of the second single-stranded DNA fluorescent probe includes: 5'-FAM-AAATTT-BHQ1-3'.

[0055] DISC1-F:GCAGTGAGAAGATGATCACTAATTTTTCAAGG;

[0056] DISC1-R:AACCCTAGTCCTAAGTCTAGGAAGGATTG;

[0057] sgRNA-DISC1-C:GAAUUUCUACUAUUGUAGAUAAGGCUUAUAUUCAUAUUA;

[0058] sgRNA-DISC1-T:GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAU GGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGU GGCACAAGGUUUAUAUUCAUAUUA.

[0059] The present invention also provides a method for single-tube SNP typing using the above-mentioned SNP typing kit, comprising the following steps: (1) amplifying a target DNA fragment containing a SNP molecular marker using a primer pair;

[0060] (2) A fluorescence detection system is configured using the target DNA fragment and the first Cas enzyme, the second Cas enzyme, the first sgRNA, the second sgRNA, the first single-stranded DNA fluorescent probe, and the second single-stranded DNA fluorescent probe. After the reaction, the fluorescence is detected, and the SNP typing result is determined according to the fluorescence color.

[0061] In a preferred embodiment of the present invention, the amplification in step (1) includes using sample genomic DNA as a template. In a preferred embodiment of the present invention, the fluorescence detection system in step (2) is measured in 30 μL, including: 10×Buffer 3 μL, 1 μL of the first Cas enzyme with a concentration of 1 μM, 1 μL of the second Cas enzyme with a concentration of 1 μM, 1 μL of the first sgRNA with a concentration of 10 μM, 1 μL of the second sgRNA with a concentration of 10 μM, 1 μL of the target DNA fragment, 3 μL of the first single-stranded DNA fluorescent probe with a concentration of 10 μM, 1 μL of the second single-stranded DNA fluorescent probe with a concentration of 10 μM, and the remainder of ddH2O. In a preferred embodiment of the present invention, the temperature of the reaction in step (2) is 48-55°C and the time is 20min. In a preferred embodiment of the present invention, when red fluorescence is displayed, it indicates wild type, yellow fluorescence indicates homozygous mutant type, and orange fluorescence indicates heterozygous mutant type.

[0062] In order to further illustrate the present invention, a dual Cas enzyme-based SNP typing kit and a single-tube typing method provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0063] Example 1 Amplification and purification of target DNA fragments

[0064] The present invention selects the SNP site BMP2-rs321846600 (T>C) as the detection target; entrusts Sangon Biotech (Shanghai) Co., Ltd. to synthesize a standard containing the wild-type and mutant sites of rs321846600 (T>C) and 300 bp of bases upstream and downstream thereof, and clones them into the PUC57 plasmid vector. The cloned sequence is shown in SEQ ID No. 14:

[0065]

[0066] The bold base Y is a degenerate base, representing C or T, that is, the SNP site BMP2-rs321846600 (T>C).

[0067] RAA amplification primers were designed for the SNP site BMP2-rs321846600 (T>C), and the PAM sequence 5'-TTTN-3' (N is a degenerate base, representing any one of A, T, C, and G) was introduced through the upstream primer. Figure 2 A), and the PAM sequence is located at the 1st to 6th position of the 5' end of the SNP site. The primer sequences are shown in Table 1, and the product length is 181 bp. The amplified target sequence is the underlined portion of the sequence shown in SEQ ID No. 14.

[0068] Table 1 Primer sequences designed by the present invention

[0069] Primer name Primer sequences SEQ ID No. BMP2-F1 GTCACACATTAGTGCTGACAACCAGATTTA 1 BMP2-F2 GTCACACATTAGTGCTGACAACCAGTTTCA 2 BMP2-F3 GTCACACATTAGTGCTGACAACCATTTCCA 3 BMP2-F4 GTCACACATTAGTGCTGACAACCTTTTTCCA 4 BMP2-F5 GTCACACATTAGTGCTGACAACTTTATCCA 5 BMP2-F6 GTCACACATTAGTGCTGACAATTTGATCCA 6 BMP2-R AAAGCAGCAGAACAGAGCCAGGATTACA 7

[0070] The synthesized standard was used as a template and RAA nucleic acid amplification reagent (Nanning Zhuangbo, ZBA11001) was used for RAA amplification. The RAA amplification reaction system and conditions were referred to the reagent instructions. Agarose gel electrophoresis was then performed with a gel concentration of 1.5%. The results are shown in Figure 2 As shown in Figure B, all primers can amplify a single band, and the length is in line with expectations. The amplified product was then sequenced, and the sequencing results are as follows: Figure 2 As shown in C, the PAM sequence 5'-TTTN-3' was successfully introduced into the amplification product, and the red triangle mark is the SNP site.

[0071] In order to eliminate the influence of complex components in the RAA amplification system on subsequent experiments, the RAA product was purified and recovered using the FastPure Gel DNA Extraction Mini Kit (Vazyme, DC301-01). The operation steps were referred to the instructions of the kit.

[0072] Example 2 Design and Acquisition of sgRNA

[0073] To explore the binding specificity of Cas12 enzyme to sgRNA and the cleavage preference of 6 Cas12 enzyme probe sequences, the template amplified by the BMP2-F4 / R primer pair in Table 1 was selected for sgRNA design.

[0074] 2. Design and acquisition of 14 Cas12a-sgRNAs

[0075] The present invention selects 4 kinds of Cas12a enzymes and their corresponding sgRNA DNA templates (all represented by RD in the table) sequences as shown in Table 2 (underlined part T7 promoter sequence, italic part is the scaffold sequence of the corresponding enzyme, and the rest is the recognition sequence combined with the target dsDNA sequence). Entrusted Sangon Biotechnology (Shanghai) Co., Ltd. to synthesize the 4 kinds of DNA templates shown in Table 2. The synthesized ssDNA concentration was diluted to 10 μM, and then 10 μL of upstream and downstream ssDNA fragments were taken and put into a PCR instrument, and the gradient annealing program was reduced from 95 ° C to 20 ° C at a cooling rate of 5 ° C / 5 min to form a double-stranded DNA template.

[0076] Table 2 sgRNA corresponding to Cas12a enzyme and DNA template of sgRNA

[0077]

[0078] The double-stranded DNA was used as a template and in vitro transcription was performed using T7 High Yield Transcription Kit (Vazyme, TR101). The specific operation steps are referred to the instruction manual of the kit.

[0079] The in vitro transcription products were used RNA Cleanup Kit (NEB, T2030L) was used for purification. The specific operation steps refer to the instructions of the kit. The purified product was temporarily stored at 4°C or stored at -20°C for a long time.

[0080] 2.2 Design and acquisition of Cas12b-sgRNA

[0081] The sgRNAscaffold sequence of AacCas12b and AapCas12b enzymes selected by the present invention is the same, and due to its scaffold sequence is longer (91bp), it takes a long time to directly synthesize DNA templates, which is unfavorable for the progress of subsequent experiments. Therefore, the sgRNAscaffold sequence is first synthesized, and the T7 promoter sequence is added before the scaffold sequence, and the sequence of long 27bp containing two BbsI restriction sites is added after the scaffold sequence, so that the plasmid vector can be cut by the BbsI enzyme and produce 2 non-complementary sticky ends, which are cloned into pUC57 plasmids. This work is entrusted to Sangon Biotech (Shanghai) Co., Ltd. to carry out.

[0082] The synthetic sequence is shown in SEQ ID No. 27, in which the underlined portion is the T7 promoter sequence, the italic portion is the sgRNA scaffold sequence of AapCas12b / AacCas12b (the scaffold sequences of the two are the same), and the bold portion is an additional sequence containing two BbsI restriction sites.

[0083]

[0084] After synthesizing the vector with the sgRNA scaffold sequence, the complete target sgRNA vector is constructed on this basis. The specific steps are as follows:

[0085] 2.2.1 Design, synthesis and annealing of complementary ssDNA linker fragments

[0086] The sequence of the complementary ssDNA connecting fragment (represented by the abbreviation "CF" of Connected Fragment in English) is shown below and was commissioned to be synthesized by Sangon Biotech (Shanghai) Co., Ltd. Four bases 5'-GCAC-3' must be added to the 5' end of the upstream ssDNA fragment, and four bases 5'-CACC-3' must be added to the 5' end of the downstream ssDNA fragment to produce sticky ends at both ends after complementation. The synthesized ssDNA concentration was diluted to 10 μM, and then 10 μL of the upstream and downstream ssDNA fragments were taken and placed in a PCR instrument, and the temperature was reduced from 95°C to 20°C through a gradient annealing program at a cooling rate of 5°C / 5min to form a double-stranded DNA template.

[0087] CF-4-F-BMP2 (SEQ ID No. 28): GCACCCATCTGGGCACCAGTCAT;

[0088] CF-4-R-BMP2 (SEQ ID No. 29): CACCATGACTGGTGCCCAGATGG.

[0089] 2.2.2 sgRNA scaffold vector digestion

[0090] Take 1 μg of the above plasmid vector and 5 μL NEB Buffer TMr2.1 (NEB, B6002SVIAL), 1 μL BbsI (NEB, R0539SVIAL), supplemented with ddH2O to 50 μL, reacted at 37°C for 10 min. Add 10 μL Gel Loading Dye, Purple (6X) (NEB, B7024AVIAL), all products were subjected to agarose gel electrophoresis, and then gel recovery was performed using FastPure GelDNAExtractionMini Kit (Vazyme, DC301-01).

[0091] 2.2.3 Vector-annealed fragment ligation

[0092] Take 60 ng of the above gel recovery product, 2 ng of the annealing product, 5 μL 5 min Universal Ligation Mix (Vazyme, C311-01), add ddH2O to 10 μL, and react at 37°C for 5 min.

[0093] 2.2.4 Transformation of ligation products

[0094] (1) Take 5 μL of the ligation product from 2.2.3 and add it to 50 μL of DH5α competent cells and place on ice for 30 min.

[0095] (2) Heat shock at 42°C for 60–90 s and place on ice for 2 min.

[0096] (3) Add 500 μL LB medium and shake at 37°C and 200 rpm for 30 min.

[0097] (4) Centrifuge at 3000 rpm for 3 min and remove 450 μL of supernatant.

[0098] (5) Mix the remaining 100 μL of liquid and apply it evenly on the LA solid culture medium.

[0099] (6) Culture at 37°C for 14 to 16 hours.

[0100] 2.2.5 Picking single clone colonies

[0101] Single colonies were picked and placed in 1 mL of LA liquid culture medium, 5 colonies were picked per plate, and shaken at 37°C and 200 rpm for 4-5 h, and the bacterial solution was sequenced and analyzed.

[0102] 2.2.6 Plasmid extraction

[0103] According to the sequencing results, the successfully constructed bacterial solution was selected, and 1 mL of the bacterial solution was added to 9 mL of LA liquid culture medium, and shaken at 200 rpm for 14 to 16 h. The plasmid was extracted using an endotoxin-free plasmid mini-extraction kit (TIANGEN, DP118). For specific operation steps, refer to the kit manual.

[0104] 2.2.7 Plasmid PCR

[0105] Take 10 ng of plasmid in 2.2.6 as PCR template, add 2×Rapid Taq Master Mix (Vazyme, P222) 25 μL, add 1 μL of upstream and downstream primers, and add ddH2O to 50 μL.

[0106] RDP-F (SEQ ID No. 30): TAATACGACTCACTATAGGG;

[0107] RDP-4-R-BMP2 (SEQ ID No. 31): ATGACTGGTGCCCAGATGG.

[0108] The PCR program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 50°C for 15 s, extension at 72°C for 5 s, 35 cycles; and final extension at 72°C for 5 min.

[0109] 2.2.8 T7 in vitro transcription and purification of PCR products

[0110] Using the PCR product in 2.2.7 as a template, in vitro transcription was performed using T7 High Yield Transcription Kit (Vazyme, TR101). For specific operation steps, refer to the instructions of the kit.

[0111] The in vitro transcription products were used RNA Cleanup Kit (NEB, T2030L) was used for purification. The specific operation steps refer to the instructions of the kit. The purified product was temporarily stored at 4°C or stored at -20°C for a long time.

[0112] Example 3 Detection of binding specificity between Cas12 enzyme and sgRNA

[0113] In this example, four Cas12a enzymes and two Cas12b enzymes were selected for enzyme-sgRNA binding specificity detection. All six enzymes were purchased from Tolo Biotechnology (TOLOBIO), specifically LbCas12a (TOLOBIO, 32108), AsCas12a (TOLOBIO, 32104), FnCas12a (TOLOBIO, 32106), Lb5Cas12a (TOLOBIO, 32110), AacCas12b (TOLOBIO, 32116), and AapCas12b (TOLOBIO, 32118).

[0114] The reaction system is: 3 μL of 10×HOLMES Buffer1 (TOLOBIO, 32005), 1 μL of Cas12 enzyme at a concentration of 1 μM, 1 μL of sgRNA at a concentration of 1 μM, 1 μL of purified RAA product (RAA amplification product of BMP2-F4 / R primer pair), 1 μL of ssDNA probe at a concentration of 10 μM (the red fluorescent probe is ROX-CCCCCC-BHQ2, and the yellow fluorescent probe is FAM-CCCCCC-BHQ1), and ddH2O is added to 30 μL. The reaction temperature is 52°C. After 20 minutes of reaction, the fluorescence is observed in a fluorescence detector (Shangrui Bio, SRB-ES-004), and a smartphone is used to take photos and record.

[0115] The results are as follows Figure 3 As shown. Although the sgRNA scaffold sequences of the four Cas12a are slightly different, cross-use will cause interference ( Figure 3 A), while Cas12b protein does not bind to Cas12a sgRNA and produce cutting activity ( Figure 3 In B), Cas12a protein will not bind to Cas12b's sgRNA and produce cutting activity ( Figure 3 Middle C).

[0116] Example 4 Verification of Cas12 enzyme probe sequence cleavage preference

[0117] Two specific single-stranded DNA fluorescent probes are selected as the signal probes of the present invention, which are named as follows:

[0118] Report 1: 5'-ROX-CCCGGG-BHQ2-3';

[0119] Report 2: 5'-FAM-AAATTT-BHQ1-3'.

[0120] Using the same reaction system and reaction conditions as in Example 3, probes Report 1 and Report 2 were reacted for 20 minutes and then placed in a fluorescence detector (Shangrui Bio, SRB-ES-004) to observe the fluorescence and take photos using a smartphone. The results of the two enzymes' cleavage preference test for ssDNA fluorescent probes are shown in Figure 2. Figure 4As shown, Lb5Cas12a has a significantly higher cleavage preference for Report 1 than Report 2, while AacCas12b has a significantly higher cleavage preference for Report 2 than Report 1, and the difference between the two can be easily distinguished by the naked eye. Therefore, AacCas12b and Lb5Cas12a were selected for subsequent dual enzyme detection, and Report 2 was selected as the signal probe for the AacCas12b enzyme, and Report 1 was selected as the signal probe for the Lb5Cas12a enzyme.

[0121] Example 5 Detection and optimization of single-base resolution efficiency of AacCas12b and Lb5Cas12a enzymes

[0122] For the SNP site BMP2-rs321846600 (T>C), the sgRNAs of Lb5Cas12a and AacCas12b were designed respectively, and the DNA template sequence of Lb5Cas12a-sgRNA, the ssDNA connection fragment of AacCas12b-sgRNA and the sgRNA vector amplification primers are shown in Table 3. The corresponding sgRNA was obtained in the same manner as in Example 2.

[0123] Table 3 BMP2-rs321846600 (T>C) site detection system

[0124]

[0125]

[0126]

[0127] The purified RAA product was used as a substrate, and AacCas12b and Lb5Cas12a were used for detection. The system and conditions were the same as those in Example 3. The detection results were as follows: Figure 5 The detection results of Lb5Cas12a are shown in Figure 5 As shown in A, when the PAM-SNP is 4 bases apart, it has a higher single-base resolution efficiency. The sgRNAs used in Figures 1 to 6 are sgRNA-1-BMP2-T, sgRNA-2-BMP2-T, sgRNA-3-BMP2-T, sgRNA-4-BMP2-T, sgRNA-5-BMP2-T, and sgRNA-6-BMP2-T in Table 3, respectively; the detection results of AacCas12b are shown in Figure 5As shown in B, when the PAM-SNP is 2, 3, 4, and 6 bases apart, it has a higher single-base resolution efficiency. The sgRNAs used in 1 to 6 in the figure are sgRNA-1-BMP2-C, sgRNA-2-BMP2-C, sgRNA-3-BMP2-C, sgRNA-4-BMP2-C, sgRNA-5-BMP2-C, and sgRNA-6-BMP2-C in Table 3. Based on this result, when the PAM-SNP is 4 bases apart, Lb5Cas12a and AacCas12b both have a higher single-base resolution efficiency, so primer F4 is selected as the RAA upstream amplification primer for detecting the BMP2-rs321846600 (T>C) site.

[0128] Example 6 AacCas12b and Lb5Cas12a enzymes are used together to perform single-tube dual-enzyme detection of the BMP2-rs321846600 (T>C) site

[0129] The above experiments have screened out two qualified Cas12 enzymes and the optimal RAA amplification primer pair and sgRNA for detecting the SNP site: BMP2-rs321846600 (T>C). Therefore, a single-tube dual-enzyme test based on AacCas12b and Lb5Cas12a can be performed to identify the genotype of Large White pigs.

[0130] The collected Large White pig ear samples were used to extract the Large White pig genome using the Fast Pure Cell / Tissue DNA Isolation Mini Kit (Vazyme, DC102). For specific operations, refer to the kit instructions. The extracted Large White pig genomic DNA was used as a template, and RAA amplification was performed using the F4 / R primer pair. The product was purified and recovered using the Fast Pure Gel DNA Extraction Mini Kit (Vazyme, DC301-01).

[0131] Next, fluorescence detection was performed. The reaction system was: 3 μL of 10×Buffer, 1 μL of 1 μM AacCas12b enzyme, 1 μL of 1 μM Lb5Cas12a enzyme, 1 μL of 10 μM sgRNA-4-BMP2-T, 1 μL of 10 μM sgRNA-4-BMP2-C, 1 μL of purified RAA product, 3 μL of 10 μM ssDNA probe Report 1, 1 μL of 10 μM ssDNA probe Report 2, and ddH2O was added to 30 μL. The reaction temperature was 52°C. After 20 minutes of reaction, the fluorescence was observed in a fluorescence detector (Shangrui Bio, SRB-ES-004), and photos were taken with a smartphone. The fluorescence detection results of DNA samples from 8 different individuals of Large White pigs are shown in the figure below. Figure 6 As shown, red fluorescence corresponds to the wild type (T / T), yellow fluorescence corresponds to the homozygous mutant (C / C), and orange fluorescence corresponds to the heterozygous mutant (T / C). The fluorescence detection results are completely consistent with the Sanger sequencing results.

[0132] Example 7 AacCas12b and Lb5Cas12a enzymes are used together to perform single-tube dual-enzyme detection of the DISC1-rs81283791 (C>T) site

[0133] The rs81283791 (C>T) locus of the DISC1 gene of Large White pigs is significantly associated with the eye muscle thickness trait. The rs81283791 (C>T) locus of 8 selected Large White pig ear samples was detected using the method described in the present invention. The RAA amplification primer sequences used were DISC1-F (SEQ ID No.10) and DISC1-R (SEQ ID No.11), and the amplification product length was 238bp; the sgRNA sequences used were sgRNA-DISC1-C (SEQ ID No.12) and sgRNA-DISC1-T (SEQ ID No.13).

[0134] Except for the RAA amplification primers and sgRNA, the rest of the scheme is the same as Example 6. The test results are as follows: Figure 7 As shown in the figure, red fluorescence corresponds to the wild type (C / C), yellow fluorescence corresponds to the homozygous mutant (T / T), and orange fluorescence corresponds to the heterozygous mutant (C / T). The fluorescence detection results are completely consistent with the Sanger sequencing results.

[0135] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A SNP typing kit based on dual Cas enzymes, characterized in that: It includes a first Cas enzyme, a second Cas enzyme, a first sgRNA targeting a wild-type SNP typing site, a second sgRNA targeting a mutant SNP typing site, a first single-stranded DNA fluorescent probe, and a second single-stranded DNA fluorescent probe; The first sgRNA specifically binds to a first Cas enzyme, and the second sgRNA specifically binds to a second Cas enzyme; The first single-stranded DNA fluorescent probe is specifically trans-cleaved by a first Cas enzyme, and the second single-stranded DNA fluorescent probe is specifically trans-cleaved by a second Cas enzyme.

2. The SNP typing kit according to claim 1, characterized in that: Also included are primer pairs for amplifying a target DNA fragment containing a SNP molecular marker.

3. The SNP typing kit according to claim 2, characterized in that: When the RAA method is used to amplify the target DNA fragment, a PAM sequence is introduced into the upstream primer when designing the primer.

4. The SNP typing kit according to claim 3, characterized in that: When the SNP molecular marker is a SNP in the enhancer region of the Yorkshire pig BMP2 gene, the SNP site is rs321846600, the polymorphism is T and C, and the designed RAA primer pair includes an upstream primer having a nucleotide sequence of any one of SEQ ID No.1 to SEQ ID No.6 and a downstream primer having a nucleotide sequence of SEQ ID No.7; The first Cas enzyme includes Cas12a; the second Cas enzyme includes Cas12b; The nucleotide sequence of the first sgRNA is shown in SEQ ID No.8; The nucleotide sequence of the second sgRNA is shown in SEQ ID No.9; The sequence of the first single-stranded DNA fluorescent probe includes: 5'-ROX-CCCGGG-BHQ2-3'; The sequence of the second single-stranded DNA fluorescent probe includes: 5'-FAM-AAATTT-BHQ1-3'.

5. The SNP typing kit according to claim 3, characterized in that: When the SNP molecular marker is a SNP of Large White pig and eye muscle thickness trait, the SNP site is the rs81283791 site of the Large White pig DISC1 gene, the polymorphism is C and T, and the designed RAA primer pair includes the nucleotide sequences DISC1-F shown in SEQ ID No.10 and DISC1-R shown in SEQ ID No.11: The first Cas enzyme includes Cas12a; the second Cas enzyme includes Cas12b; The nucleotide sequence of the first sgRNA is shown in SEQ ID No.12; The nucleotide sequence of the second sgRNA is shown in SEQ ID No.13; The sequence of the first single-stranded DNA fluorescent probe includes: 5'-ROX-CCCGGG-BHQ2-3'; The sequence of the second single-stranded DNA fluorescent probe includes: 5'-FAM-AAATTT-BHQ1-3'.

6. A method for performing single-tube SNP typing using the SNP typing kit according to any one of claims 1 to 5, characterized in that: The following steps are involved: (1) Amplifying a target DNA fragment containing a SNP molecular marker using a primer pair; (2) A fluorescence detection system is configured using the target DNA fragment and the first Cas enzyme, the second Cas enzyme, the first sgRNA, the second sgRNA, the first single-stranded DNA fluorescent probe, and the second single-stranded DNA fluorescent probe. After the reaction, the fluorescence is detected, and the SNP typing result is determined according to the fluorescence color.

7. The method according to claim 6, characterized in that: The amplification in step (1) includes using sample genomic DNA as a template.

8. The method according to claim 6, characterized in that: The fluorescence detection system in step (2) is calculated in 30 μL and includes: 3 μL of 10×Buffer, 1 μL of the first Cas enzyme with a concentration of 1 μM, 1 μL of the second Cas enzyme with a concentration of 1 μM, 1 μL of the first sgRNA with a concentration of 10 μM, 1 μL of the second sgRNA with a concentration of 10 μM, 1 μL of the target DNA fragment, 3 μL of the first single-stranded DNA fluorescent probe with a concentration of 10 μM, 1 μL of the second single-stranded DNA fluorescent probe with a concentration of 10 μM, and the balance of ddH2O.

9. The method according to claim 6 or 8, characterized in that: The reaction temperature in step (2) is 48-55°C and the reaction time is 20 minutes.

10. The method according to claim 9, characterized in that: Red fluorescence indicates wild type, yellow fluorescence indicates homozygous mutant, and orange fluorescence indicates heterozygous mutant.

Images