Indel molecular marker for identifying arisaema heterophyllum blume and arisaema sibiricum

Abstract

The invention relates to the technical field of molecular markers, in particular to an Indel molecular marker for identifying and distinguishing arisaema heterophyllum and arisaema sibiricum. The Indel molecular marker disclosed by the invention can be obtained through amplification of a primer pair as shown in SEQ ID NO.3-12. The Indel molecular marker disclosed by the invention can be applied to the field of detection of By adopting the Indel molecular marker disclosed by the invention, arisaema heterophyllum and alstonia-tuber can be effectively identified and distinguished.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to Indel molecular markers for identifying Arisaema confusa and Echeveria caerulea and applications thereof. Background Art

[0002] Arisaema amurense Maxim. and Arisaema bockii Engler. are both perennial herbs of the genus Araceae in the family Araceae. Arisaema amurense Maxim. is one of the authentic origins of the Araceae medicinal material specified in the Chinese Pharmacopoeia. According to the description of the identification points of the two species in the Flora of China, Arisaema amurense Maxim. has one leaf and Arisaema bockii Engler. has two leaves. However, in field observations of Arisaema amurense and Arisaema bockii Engler., it was found that Arisaema amurense often has two leaves, and Arisaema bockii Engler also often has one leaf. Both have short-stalked rod-shaped appendages, and the leaves are bird-toed compound leaves ( Figure 1 ).

[0003] Therefore, it is difficult to distinguish the two according to the description in Flora of China, so that the single-leaf type of Asterix lanceolata was mistakenly included in Flora of Anhui as Asterix lanceolata. It can be seen that professionals may make mistakes in distinguishing Asterix lanceolata from Asterix lanceolata according to traditional taxonomy, which may lead to Asterix lanceolata being mistakenly used as medicine for Asterix lanceolata. Therefore, it is necessary to find new ways to distinguish the two, among which molecular identification is a relatively fast and reliable identification method nowadays. By developing molecular markers to identify Asterix lanceolata and Asterix lanceolata, it can provide important basis for the management of germplasm resources of the two and the formulation of Chinese medicinal materials for medicine. Summary of the invention

[0004] The present invention mainly aims at the above technical problems, provides a simple molecular marker method to achieve identification and differentiation of Arisaema confusa and Aster fasciata, and specifically provides an Indel molecular marker for identifying Arisaema confusa and Aster fasciata and its application.

[0005] Specifically, the present invention provides the following technical solutions:

[0006] In a first aspect, the present invention provides an Indel molecular marker for identifying and distinguishing Arisaema confusa and Acanthus fasciatus. The Indel molecular marker is the base sequence at positions 495-637 of SEQ ID NO.1, which can be amplified by the primer pair shown in SEQ ID NO.3-12.

[0007] The present invention utilizes a high-throughput sequencing method to assemble genome contigs from the whole genome sequences of Arisaema confusa and Echinops fasciatus, and compares the genome contigs of Arisaema confusa and Echinops fasciatus. Compared with Echinops fasciatus, there is a 143 bp insertion in the genome of Arisaema confusa. The sequence is longer and is presumably used as an Indel molecular marker. Arisaema confusa and Echinops fasciatus are identified and distinguished by conventional PCR and agarose gel electrophoresis.

[0008] Primers are further designed for the above insertion sequence so that the above insertion sequence is contained inside the primer amplification product.

[0009] Samples of Arisaema confusa and Echeveria paniculata with different numbers of leaves were selected and PCR amplification was performed using the designed primers.

[0010] The electrophoresis results showed that the length of the PCR product of Arisaema confusa (1-6 dot sample wells) was significantly longer than that of Asterix fasciata (7-12 dot sample wells), which was consistent with expectations and had nothing to do with the number of leaves of the species.

[0011] In another embodiment, any DNA or RNA fragment containing the above-mentioned Indel molecular marker sequence can be used as an identification molecular marker to identify and distinguish between Arisaema confusa and Aster fasciata.

[0012] In a second aspect, the present invention provides primers for amplifying the above-mentioned Indel molecular marker, wherein the amplification product sequence of the primers comprises the above-mentioned Indel molecular marker sequence.

[0013] In a preferred embodiment, the primers of the present invention include at least one forward primer and one reverse primer sequence as shown in SEQ ID NO.3-SEQ ID NO.12, preferably including primer sequences shown in SEQ ID NO.3 and SEQ ID NO.8.

[0014] In a third aspect, the present invention provides a kit containing the above primers.

[0015] In a fifth aspect, the present invention provides any of the following uses of the above-mentioned Indel molecular marker or primer or kit:

[0016] (1) Application in the identification and authentication of Arisaema confusa and Aster fasciata;

[0017] (2) Application in identification, improvement or molecular marker-assisted breeding of Arisaema confusa and Echinochloa chinensis germplasm resources;

[0018] (3) Application in screening or creating different varieties of Arisaema confusa and Aster odoratum;

[0019] (4) Application in constructing DNA fingerprint database of Arisaema confusa and Echinops edulis;

[0020] (5) Application in the quality inspection of seedlings of Arisaema confusa and Echinops edulis.

[0021] The single Indel molecular marker of the present invention can simply and effectively distinguish whether the tested variety is Araceae or Araceae, providing a guarantee for the identification, planting, resource utilization and breeding of Araceae and Araceae. It is also of great significance for the classification, phylogeny, and phylogenetic research of Araceae species, as well as the protection and utilization of Araceae resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Samples of Arisaema confusa and Echinops edulis with different numbers of leaves; A is two-leaf Echinops edulis, B is single-leaf Echinops edulis, C is two-leaf Arisaema confusa, and D is single-leaf Arisaema confusa.

[0023] Figure 2 It is the result of high-throughput sequencing assembly and comparative analysis, showing the Indel molecular markers obtained for Arisaema confusa and Echinops chinensis; among them, sequence 1 is Arisaema confusa and sequence 2 is Echinops chinensis.

[0024] Figure 3 It is an electrophoresis image of the PCR products of 6 (3 of each type of leaves) Arisaema confusa samples and 6 (3 of each type of leaves) Coleus fasciatus samples amplified using SEQ ID NO.3-4, wherein M is mark, 1-3 are two-leaf Arisaema confusa, 4-6 are single-leaf Arisaema confusa, 7-9 are two-leaf Coleus fasciatus, and 10-12 are single-leaf Coleus fasciatus. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical scheme and beneficial technical effect of the present invention clearer, the present invention is further described in detail below in conjunction with embodiment.It should be understood that the following embodiments are provided only for the purpose of illustration and are not intended to limit the scope of the present invention.Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.The experimental methods used in the following examples are conventional methods unless otherwise specified.The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0026] The plant samples of Arisaema confusa and Acanthus chinensis used in the following examples can be obtained through commercial purchase or collected from the wild.

[0027] Example 1 Collection of Arisaema confusa and Echeveria paniculata

[0028] The Arisaema confusa and Echeveria paniculata of the present invention are collected from Jilin City, Jilin Province and Lu'an City, Anhui Province respectively.

[0029] Example 2 Development of specific molecular markers for Arisaema manchurianum and Acanthus chinensis

[0030] The specific molecular markers for distinguishing Arisaema manchurianum and Acanthus chinensis, i.e., Indel molecular markers, were obtained by the following steps:

[0031] 1) Collect leaves of Arisaema confusa and Echeveria paniculata;

[0032] 2) Extracting total DNA from leaves of Arisaema dulcis and Echinops edulis;

[0033] 3) performing second-generation high-throughput sequencing on the total DNA to obtain sequencing reads;

[0034] 4) Assemble the genomes of Arisaema confusa and Echinops edulis to obtain genome contigs sequences.

[0035] 5) Compare the genomic contigs of Arisaema dulcis and Echeveria serrata to obtain insertion and deletion fragments, i.e., Indel molecular markers.

[0036] Results Figure 2 Compared with the Asteraceae, there is a 143bp insertion sequence in the genome of Asteraceae. The sequence is longer and it is speculated that it can be used as an Indel molecular marker to identify and distinguish Asteraceae and Asteraceae through conventional PCR and agarose gel electrophoresis.

[0037] The 143 bp insertion sequence in the genome of the northeastern star is as follows, where the underlined part of SEQ ID NO.1 is the insertion fragment unique to the northeastern star, the homologous region sequence in the corresponding scutellaria genome is shown in SEQ ID NO.2, and the dash '-' represents the fragment missing from the homologous region group of the eastern star genome relative to the northeastern star gene:

[0038] 5'-GCCGAAAAGAACGAGCATCCTTATGTATTTGCATATATCTTTTTTTATAATATATACAGAATGCGCAGGGGCAGGGACCTTACCCACAATCCATATAT ACAAGATCTAAATACAAGATAAGATCTAAGGCTAAACAACTAAATATTTCTTTTTATTATTTGTTGGATCTATAAAAAATCCTATGGATCCTTTTGATTGGTAGATTATTTTATATACCAGAGTTTCAGACCATAGCTCAACCCAAGGGAGGGTATCTTCCACTGGTCCTGTATATTGTCTTTTTCGTTCCGTGTCGTGTTCCTATGGAAACTAATATTATACGAGAATGAATTCTTTCCAGAGGTAACAAGTATTTCTACTTTCGATGAAAATTTATACACGATATACGATATGAGAAGAAACCCCTACTTATATTTTTTTCTATTTTTTATAATTGAGGAAAAGATTCCATTATTTAAATCATAATCATATTAAATCATAAGAAATC ATATATATAAATCATAAATCATAATA AATCATATTCATATACATATTCATATAATCATATATATAATATATATAATAAATCATAATCATATATAAATCATAT CATATATAAATCATATTAAATCATATATAAATCATATTCAT ATATCATATATATAATCATATAACTAATACATAATAATAATATATATTGAAATGAGACCCTGGATCCCCACACACAAAAAAAAAATTATTTCTTTCAATACTCATTCGTATTAGTTAACGATCCAAACGGCTGGATCCATATGCTTAATTCTGATACGAAATCAAATAGTAAAATAATTATTCATCGAATGACTATTCATCCATTATATTTTCAAATAAGGCGCGGGAAGATTCTATG-3'(SEQ ID NO.1)

[0039] 5'-GCCGAAAAGAACGAGCATCCTCATGTATTTGCATATATCTTTTTTTTATAATATATACAGAATGCGCAGGGGCAGGGACCTTACCCACAATCCATATATACAAG ATCTAAATACAAGATAAGATCTAAGGCTAAACAACTAAATATTTCTTTTATTATTTGTTGGATCTATAAAAAATCCTATGGATCCTTTGGATTGGTAGATTATTTTATATACCAGAGTTTCAGACCATAGCT CAACCCAAGGGAGGGTATCTTCCACCGGTCCTGTATATTGTCTTTTTCGTTCCGTGTCGTGTTCCTATGGAAACTAATATTATATATTATACGAGAATGAATTCTTTCCAGAGGTAACAAGTATTTCTACTTT CGATGAAAATTTATACACGATATACGATATGAGAAGAAACCCCTACTTATATTTTTTTTCTATTTTTTATAATTGAGGAAAAGATTCCATTATTTAAATCATAAATCATAATCATATTAAATCATAAGAAATC--------------------------------ATATCATATATATAATCATATAACTAATACATAATAATAATATATATTGAAATGAGACCCTGGATCCCCACACAAAAAAAAATTATTTCTTTCAATA CTCATTCGTATTAGTTAACGACCCAAACGGCTGGATCCATATGTTTAATTCTGATACGAAATCAAATAGTAAAATAATTCATCGAATGACTATTCATCCATTAT ATTTTCAAATAAGGCGCGGGAAGATTCTATG-3'(SEQ ID NO.2)

[0040] Example 3 Primer design of specific molecular markers of Arisaema confusa and Acanthus chinensis

[0041] According to the comparison results in Example 2, combined with the corresponding contigs sequences, multiple pairs of PCR primers for identifying Arisaema confusa and Acanthus fasciatus were designed using Geneious software. The primer sequences are as follows:

[0042] Forward primer TM-4F1: 5'-GCCGAAAAGAACGAGCATCC-3' (SEQ ID NO. 3)

[0043] Forward primer TM-4F2: 5'-CCGCTGCTTGTGAGATTTGG-3' (SEQ ID NO. 4)

[0044] Forward primer TM-4F3: 5'-TGAGCCGAAAAGAACGAGCA-3' (SEQ ID NO. 5)

[0045] Forward primer TM-4F4: 5'-TATACAGAATGCGCAGGGGC-3' (SEQ ID NO. 6)

[0046] Forward primer TM-4F5: 5'-CGTTCCGTGTCGTGTTCCTA-3' (SEQ ID NO. 7)

[0047] Reverse primer TM-4R1: 5'-CATAGAATCTTCCCGCGCCT-3' (SEQ ID NO. 8)

[0048] Reverse primer TM-4R2: 5'-TGGGGATCCAGGGTCTCATT-3' (SEQ ID NO.9)

[0049] Reverse primer TM-4R3: 5'-TTGTGTTGTGGGGATCCAGG-3' (SEQ ID NO.10)

[0050] Reverse primer TM-4R4: 5'-TCCATAGAATCTTCCCGCGC-3' (SEQ ID NO. 11)

[0051] Reverse primer TM-4F5: 5'-TCTTCCCGCGCCTTATTTGA-3' (SEQ ID NO. 12)

[0052] Example 4 Identification of Arisaema manchurianum and Echeveria serrata

[0053] 1) Collect leaves of Arisaema confusa and Echeveria paniculata plants as samples to be tested, with 3 double-leaf and 3 single-leaf samples of each plant;

[0054] 2) extracting total DNA from the sample to be tested;

[0055] 3) using the primers designed in Example 3 (TM-4F1 and TM-4R1), PCR was performed on the total DNA of the above samples respectively;

[0056] The PCR amplification reaction system is 25 μL, 2×PhantaMaxMasterMix12.5 μL, upstream primer (10 μM) / downstream primer (10 μM) 1 μL each, DNA template 200-300 ng, ddH2O supplemented to 25 μL. 2×PhantaMaxMasterMix contains PhantaMaxSuper-FidelityDNAPolymerase, dNTP, protective agent and buffer system;

[0057] The PCR amplification program is as follows: ① 95℃ pre-denaturation for 3 min; ② 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 75 s, 35 cycles; ③ 72℃ extension for 5 min; 4) PCR amplification product detection:

[0058] The PCR product was detected by 1% agarose gel electrophoresis, stained with 10× Loading Buffer and loaded, and the PCR amplification was observed under a gel imaging system, and the main band was clear.

[0059] From the electropherogram ( Figure 3 ) It can be seen that the length of the PCR product of Arisaema confusa (1-6 dot sample wells) is significantly longer than that of Aster fasciata (7-12 dot sample wells), which is in line with expectations. It can be seen that the aforementioned Indel molecular markers and corresponding primers can be used for conventional PCR gel electrophoresis to achieve simple and effective identification and differentiation of Arisaema confusa and Aster fasciata.

[0060] In summary, firstly, the present invention is a powerful supplement to traditional species identification, and the sample identification process is effective, can be automated and standardized, breaks through the excessive reliance on experience, and can use fresh or dried leaves of plants, such as specimen samples, for rapid and effective identification, and can establish an easy-to-use application system in a short time. Finally, the method of the present invention is of great significance for the classification, phylogeny, and phylogeography of Araceae species, as well as the protection and utilization of Araceae resources.

[0061] According to the disclosure and teaching of the above description, those skilled in the art to which the present invention belongs may also make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and changes to the present invention should also fall within the scope of protection of the claims of the present invention. In addition, although some specific terms are used in this specification, these terms are only for the convenience of description and do not constitute any limitation to the present invention.

Claims

1. An Indel molecular marker for identifying and distinguishing Arisaema confusa and Acanthus sempervivum, characterized in that: The Indel molecular marker comprises the base sequence at positions 495-637 of the sequence described in SEQ ID NO.

1.

2. The Indel molecular marker according to claim 1, characterized in that: The Indel molecular marker only exists in the genome of Arisaema confusa, but not in the genome of Echeveria glabra.

3. The Indel molecular marker according to claim 1, characterized in that: The Indel molecule marker is the sequence described in SEQ ID NO.

1.

4. Primers used to identify and distinguish between Arisaema confusa and Aster fasciata, the primers being primers capable of amplifying SEQ ID NO.1 in the genome of Arisaema confusa.

5. The primer according to claim 4, characterized in that The primers include at least one forward primer as shown in SEQ ID NO.3-7, and at least one reverse primer sequence as shown in SEQ ID NO.8-12.

6. A kit comprising the primer according to claim 4 or 5.

7. Any of the following uses of the Indel molecular marker according to claim 1, the primer according to claim 4, or the kit according to claim 6: (1) Application in the identification and authentication of Arisaema confusa and Aster fasciata; (2) Application in identification, improvement or molecular marker-assisted breeding of Arisaema confusa and Echinochloa chinensis germplasm resources; (3) Application in screening or creating different varieties of Arisaema confusa and Aster odoratum; (4) Application in constructing DNA fingerprint database of Arisaema confusa and Echinops edulis; (5) Application in the quality inspection of seedlings of Arisaema confusa and Echinops edulis.

Images