Oncolytic viruses and methods of use

Abstract

Disclosed herein are nucleic acid viruses for treating cancer.

Description

Background Art

[0001] Cancer is the second leading cause of death worldwide and overall, the prevalence of cancer has increased. Therefore, there is an unmet need for new treatments that can affect the course of the disease.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims priority to U.S. Provisional Application No. 63 / 312,782, filed on February 22, 2022, the entire contents of which are incorporated herein by reference.

[0004] Incorporation by Reference of Sequence Listing

[0005] This application is submitted with a sequence listing in electronic format. The sequence listing is provided as a file titled 61771-701601.xml, which was created on February 21, 2023 and is 357,386 bytes in size. The information in the electronic format of the sequence listing is incorporated by reference in its entirety. Summary of the invention

[0006] In one aspect, provided herein are viruses that meet the needs for new cancer treatment methods. Methods of use include administering a virus to a patient with cancer so that the virus impairs cell division, impairs cell growth, and / or induces cell death of cancer cells. In some cases, the virus having one or more anti-cancer effects is an oncolytic virus.

[0007] In one aspect, provided herein is a method of treating cancer comprising administering a recombinant Zika virus to a subject in need thereof. Other aspects include recombinant Zika virus and nucleic acid compositions.

[0008] In some embodiments, the recombinant Zika virus produces a higher level of subgenomic flaviviral RNA (sfRNA) in the cancer cells of the subject than the wild-type Zika virus. In some embodiments, the higher level of sfRNA is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%.

[0009] In some embodiments, the cancer is brain cancer, retinal cancer, testicular cancer, or prostate cancer. In some embodiments, the cancer is a CNS cancer. In some embodiments, the cancer is a brain cancer. In some specific embodiments, the brain cancer is an astrocytoma, oligodendroglioma, ependymoma, meningioma, schwannoma, craniopharyngioma, germ cell tumor, pineal cell tumor, or a combination thereof. In some embodiments, the cancer is breast cancer. In some embodiments, the cancer is colon cancer. In some embodiments, the cancer is prostate cancer.

[0010] In some embodiments, a recombinant Zika virus is produced from a nucleic acid composition described herein.

[0011] In some embodiments, a recombinant Zika virus is produced by a nucleic acid composition comprising a polynucleotide encoding a Zika virus capsid protein (ancC / C) or a derivative of Zika virus ancC / C, a polynucleotide encoding a Zika virus viral membrane protein (prM / M) or a derivative of Zika virus prM / M, a polynucleotide encoding a Zika virus viral envelope protein (E) or a derivative of Zika virus E, or any combination thereof. In some embodiments, the nucleic acid composition comprises a polynucleotide encoding a Zika virus ancC / C or a derivative of Zika virus ancC / C, a polynucleotide encoding a Zika virus prM / M or a derivative of Zika virus prM / M, and a polynucleotide encoding Zika virus E or a derivative of Zika virus E. In some embodiments, a polynucleotide encoding a Zika virus ancC / C or a derivative of Zika virus ancC / C, a polynucleotide encoding a Zika virus prM / M or a derivative of Zika virus prM / M, and a polynucleotide encoding Zika virus E or a derivative of Zika virus E are expressed on one or two or more separate nucleic acids. In some embodiments, the polynucleotide encoding the derivative of Zika virus ancC / C comprises at least one substitution, at least one deletion, and / or at least one insertion compared to wild-type Zika virus ancC / C. In some embodiments, Zika virus ancC / C or a derivative of Zika virus ancC / C comprises an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of Table 1. In some embodiments, the polynucleotide encoding the derivative of Zika virus prM / M comprises at least one substitution, at least one deletion, and / or at least one insertion compared to wild-type Zika virus prM / M. In some embodiments, the Zika virus prM / M or a derivative of the Zika virus prM / M comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence of Table 2. In some embodiments, the polynucleotide encoding the derivative of Zika virus E comprises at least one substitution, at least one deletion, and / or at least one insertion compared to wild-type Zika virus E. In some embodiments, the polynucleotide encoding E is translated into a wild-type Zika virus E type. In some embodiments, Zika virus E or a derivative of Zika virus E comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of Table 3.

[0012] In some embodiments, the nucleic acid composition comprises the 5' untranslated region (5'UTR) of Zika virus. In some embodiments, the 5' untranslated region (5'UTR) of Zika virus comprises a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of Table 4 or Table 12. In some embodiments, the nucleic acid composition comprises the 3' untranslated region (3'UTR) of Zika virus. In some embodiments, the 3' untranslated region (3'UTR) of the Zika virus comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence of Table 4 or Table 13.

[0013] In some embodiments, the nucleic acid composition does not include polynucleotides encoding one or more nonstructural (NS) proteins selected from (i) NS1, (ii) NS2A, (iii) NS2B, (iv) NS3, (v) NS4A, (vi) NS4B, (vii) NS5, or (viii) (i)-(vii) Two or more of the proteins. In other embodiments, the nucleic acid composition includes polynucleotides encoding one or more nonstructural (NS) proteins selected from (i) NS1, (ii) NS2A, (iii) NS2B, (iv) NS3, (v) NS4A, (vi) NS4B, (vii) NS5, or (viii) (i)-(vii) Two or more of the proteins. In some embodiments, NS1 is Zika virus NS1, NS2A is Zika virus NS2A, NS2B is Zika virus NS2B, NS3 is Zika virus NS3, NS4A is Zika virus NS4A, NS4B is Zika virus NS4B, or NS5 is Zika virus NS5, or any combination of two or more thereof.

[0014] In some embodiments, the components of the nucleic acid composition include African Zika virus components, Asian Zika virus components, or Brazilian Zika virus components, or a combination thereof. In a specific embodiment, the Zika virus is the African MR766 strain.

[0015] In some embodiments, the nucleic acid composition is expressed on one or two or more independent nucleic acids. In some embodiments, the nucleic acid composition comprises one or more operably connected expression control elements, which confer expression of the nucleic acid composition in vitro or in vivo. In some embodiments, the expression control element is a promoter that drives the nucleic acid composition to express in vitro. In a specific embodiment, the promoter is T7, T3, SP6 or any phage promoter.

[0016] In some embodiments, the expression control element is a promoter that drives the expression of the nucleic acid composition in the target cell. In some specific embodiments, the promoter is CMV, SV40 or any eukaryotic promoter.

[0017] In some embodiments, the target cell is a neuron or non-neuronal cell, Vero, COS, CHO, CHLA, C6 / 36, HeLa, HEK, HepG2. In some embodiments, the target cell is an oligodendrocyte, a microglia, or an astrocyte.

[0018] In some embodiments, a recombinant Zika virus is produced by expressing a nucleic acid composition described herein in a producer cell, wherein the producer cell is further infected with a second Zika virus such that Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus.

[0019] In some embodiments, the second Zika virus is a wild-type Zika virus. In some embodiments, wild-type Zika viruses are African, Asian and Brazilian strains. In other embodiments, the second Zika virus is a modified Zika virus. In some specific embodiments, the modified Zika virus comprises one or more microRNA-based gene silencing mechanisms. In some specific embodiments, the one or more microRNA-based gene silencing mechanisms control viral replication.

[0020] In some embodiments, the recombinant Zika virus produced by expressing a nucleic acid composition as described herein in a producer cell is free of infection by a second Zika virus, wherein Zika virus ancC / C or a derivative of Zika virus ancC / C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus. In some embodiments, the producer cell is a Vero E6 or C6 / 36 cell.

[0021] In some embodiments, the recombinant Zika virus is replication-competent. In other embodiments, the recombinant Zika virus is replication-incompetent without reducing vector titer. In some embodiments, the recombinant Zika virus has reduced insertion mutations. In other embodiments, the recombinant Zika virus has a reduced immune response.

[0022] Non-limiting exemplary nucleic acid compositions provided herein comprise a Zika virus 5' untranslated region (5'UTR), a sequence complementary to a regulatory polynucleotide, and a Zika virus 3' untranslated region (3'UTR), wherein the regulatory polynucleotide comprises (i) miR-219a-2-3p, hsa-miR-377-3p, hsa-miR-1225-5p, hsa-miR-4298, hsa-miR-219a-5p, or hsa-miR-129-5p, (ii) a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence of Table 6A or Table 6B, or (iii) (i) and (ii). In some embodiments, the sequence complementary to the regulatory polynucleotide comprises CCGACCTGT, AAAAACGCC, AAACGCCAG, GGCGTTTT, CTAACAGGT, TAACAGGTT, ACTAACAGG, ACCCTGTCC, CACCCATGC, CCCATGCCG, ACCCATGCC, AGTGTGTTT, CTTAACACC, TTAACACCG, CTTAACAGC, or TGCCGGTCA, or a combination of two or more thereof. In some embodiments, the 5'UTR is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homologous or identical to SEQ ID NO:239 (AGTTGTTACTGTTGCTGACTCAGACTGCGACAGTTCGAGTTTGAAGCGAAAGCTAGCAACAGTATCAACAGGTTTTATTTGGATTTG GAAACGAGAGTTTCTGGTC).In some embodiments, the 3'UTR corresponds to SEQ ID NO: 241 (TAAGCACCAATCTTAATGTTGTCAGGCCTGCTAGTCAGCCAC AGCTTGGGGAAAGCTGTGCAGCCTGTGACCCCCCCAGGAGAAGCTGGGAAACCAAGCCTATAGTCAGGCCGAGAACGCCATGGCACGGAAGAAGCCATGCTGCCTGTGAGCCCCTCAGAGGACACTGAGTCAAAAAACCCCACGCGCTTGGAGGCGCAGGATGGGAAAAGAAGGTGGCGACCTTCCCCACCCTTCAATCTGGGGCCTGAACTGGAGATCAGCTGTGGATCTCCAGAAGA In some embodiments, the polynucleotides are expressed in non-cancerous cells, and optionally ... In some embodiments, the length of the sequence complementary to the regulatory polynucleotide is between 9 and 22 nucleotides, optionally about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

[0023] Non-limiting exemplary nucleic acid compositions provided herein include (a) a Zika virus 5' untranslated region (5'UTR); (b) a polynucleotide encoding at least one Zika virus structural protein selected from the group consisting of capsid protein (ancC / C), membrane protein (prM / M) and envelope protein (E); and / or a polynucleotide encoding at least one Zika virus non-structural protein selected from the group consisting of NS1, NS2A, NS2B, NS3, NS4A, 2k peptide, NS4B, and NS5; (c) a Zika virus 3' untranslated region (3'UTR); and (d) a sequence complementary to a regulatory polynucleotide; wherein: (i) the nucleic acid comprises a polynucleotide encoding at least one Zika virus non-structural protein, and the polynucleotide encoding the at least one Zika virus non-structural protein comprises a polynucleotide encoding a 2k peptide, wherein The sequence complementary to the regulatory polynucleotide is located within the polynucleotide encoding the 2k peptide; (ii) the nucleic acid comprises a polynucleotide encoding at least one Zika virus non-structural protein, and the polynucleotide encoding the at least one Zika virus non-structural protein comprises a polynucleotide encoding NS4A and a polynucleotide encoding NS4B, and the sequence complementary to the regulatory polynucleotide is located between the polynucleotide encoding NS4A and the polynucleotide encoding NS4B; (iii) the sequence complementary to the regulatory polynucleotide is located between the 5'UTR and the polynucleotide encoding at least one Zika virus structural protein and / or the polynucleotide encoding at least one Zika virus non-structural protein; and / or (iv) the sequence complementary to the regulatory polynucleotide is located between the 3'UTR and the polynucleotide encoding at least one Zika virus structural protein and / or the polynucleotide encoding at least one Zika virus non-structural protein.

[0024] In some embodiments, the nucleic acid comprises a polynucleotide encoding at least one Zika virus nonstructural protein, and the polynucleotide encoding the at least one Zika virus nonstructural protein comprises a polynucleotide encoding a 2k peptide, wherein the sequence complementary to the regulatory polynucleotide is located within the polynucleotide encoding the 2k peptide. In some embodiments, the nucleic acid comprises a polynucleotide encoding at least one Zika virus nonstructural protein, and the polynucleotide encoding the at least one Zika virus nonstructural protein comprises a polynucleotide encoding NS4A and a polynucleotide encoding NS4B, and the sequence complementary to the regulatory polynucleotide is located between the polynucleotide encoding NS4A and the polynucleotide encoding NS4B. In some embodiments, the sequence complementary to the regulatory polynucleotide is located between the 5'UTR and the polynucleotide encoding at least one Zika virus structural protein and / or the polynucleotide encoding at least one Zika virus nonstructural protein. In some embodiments, the sequence complementary to the regulatory polynucleotide is located between the 3'UTR and the polynucleotide encoding at least one Zika virus structural protein and / or the polynucleotide encoding at least one Zika virus nonstructural protein.

[0025] In some embodiments, the 5'UTR is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homologous or identical to SEQ ID NO: 239. In some embodiments, the 3'UTR is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homologous or identical to SEQ ID NO: 241. In some embodiments, the 5'UTR is selected from the Zika viruses of Table 12 and the 3'UTR is selected from the Zika viruses of Table 13. In some embodiments, the nucleic acid comprises a polynucleotide encoding at least one Zika virus structural protein, and the nucleic acid comprising a polynucleotide encoding at least one Zika virus structural protein comprises: a polynucleotide encoding a capsid protein (ancC / C), a polynucleotide encoding a membrane protein (prM / M), and a polynucleotide encoding an envelope protein (E). In some embodiments, the nucleic acid comprises a polynucleotide encoding at least one Zika virus non-structural protein, and the polynucleotide encoding at least one Zika virus non-structural protein comprises: a polynucleotide encoding NS1, a polynucleotide encoding NS2A, a polynucleotide encoding NS2B, a polynucleotide encoding NS3, a polynucleotide encoding NS4A, a polynucleotide encoding a 2k peptide, a polynucleotide encoding NS4B, and a polynucleotide encoding NS5. In some embodiments, the regulatory polynucleotide is expressed in non-cancerous cells, optionally wherein the regulatory polynucleotide has higher expression in non-cancerous cells compared to the cancer cells of the subject. In some embodiments, the regulatory polynucleotide is a micro-mRNA. In some embodiments, the length of the sequence complementary to the regulatory polynucleotide is between 9 and 22 nucleotides, optionally about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

[0026] In some embodiments, the recombinant Zika virus is produced by a nucleic acid composition described herein. In some embodiments, the recombinant Zika virus is an oncolytic Zika virus having oncolytic activity.

[0027] Non-limiting exemplary recombinant Zika viruses provided herein comprise a polynucleotide complementary to a regulatory polynucleotide comprising (i) miR-219a-2-3p, hsa-miR-377-3p, hsa-miR-1225-5p, hsa-miR-4298, hsa-miR-219a-5p, or hsa-miR-129-5p, (ii) a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence of Table 6A or Table 6B, or (iii) (i) and (ii). In some embodiments, the sequence complementary to the regulatory polynucleotide comprises CCGACCTGT, AAAAACGCC, AAACGCCAG, GGCGTTTT, CTAACAGGT, TAACAGGTT, ACTAACAGG, ACCCTGTCC, CACCCATGC, CCCATGCCG, ACCCATGCC, AGTGTGTTT, CTTAACACC, TTAACACCG, CTTAACAGC, or TGCCGGTCA, or a combination of two or more thereof. In some embodiments, the recombinant Zika virus is an oncolytic Zika virus with oncolytic activity.

[0028] Non-limiting exemplary methods herein include a method for treating a cancer of a subject in need thereof, the method comprising administering a recombinant Zika virus to the subject. In some embodiments, the recombinant Zika virus is a recombinant Zika virus provided herein. In some embodiments, the cancer is a central nervous system (CNS) cancer. In some embodiments, the CNS cancer is a brain cancer. In some embodiments, the brain cancer is an astrocytoma, an oligodendroglioma, an ependymoma, a meningioma, a schwannoma, a craniopharyngioma, a germ cell tumor, or a pineal cell tumor. In some embodiments, the cancer is breast cancer, prostate cancer, colon cancer, retinal cancer, or testicular cancer. In some embodiments, the recombinant Zika virus does not infect and / or replicate in the non-cancerous cells of the subject; or wherein the recombinant Zika virus infects and / or replicates less in the non-cancerous cells of the subject compared to the cancer cells of the subject. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The novel features of the present invention are particularly set forth in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by referring to the following detailed description and accompanying drawings (also referred to herein as "Figures" and "FIGs") which illustrate illustrative embodiments utilizing the principles of the present invention, in which:

[0030] Figure 1A-Figure 1DExemplary recombinant Zika virus structural features and DNA / RNA elements for transcription and viral genome processing are illustrated. Figure 1A Unmodified Zika virus flanked by ribozymes and promoters is shown. Figure 1B Recombinant Zika virus with a miRNA target inserted into the 2k region is shown. Figure 1C Recombinant Zika virus with a miRNA target inserted between the 5'UTR and the coding sequence is shown. Figure 1D Recombinant Zika virus with a miRNA target inserted between the coding sequence and the 3'UTR is shown.

[0031] Figure 1E-1G Highlight Figure 1B and Figure 1D Examples of 2k and representative images of 3'UTR modifications. Figure 1E The nucleotide and amino acid sequences at NS4A (black) (SEQ ID NO:24 and SEQ ID NO:25) and the 2k region (SEQ ID NO:223, SEQ ID NO:224) are shown. Figure 1F Insertion of the miR-1225-5p target sequence (miRNA target 13) is shown. Figure 1F In the present invention, the miR-1225-5p target sequence (miRNA target 13) flanked by EcoT221 (or AvaIII) sites is inserted into the 2k region, thereby generating a modified 2k region (SEQ ID NO: 26, SEQ ID NO: 27) comprising a first 2k region (SEQ ID NO: 228, SEQ ID NO: 229) and a second 2k region (SEQ ID NO: 230 and SEQ ID NO: 231). Figure 1G In the present invention, the miR-1225-5p target sequence (miRNA target 16) was inserted into the junction of NS5 (SEQ ID NO: 232, 233) and 3'UTR (SEQ ID NO: 234, 235), wherein the target sequence was flanked by MluI sites. The insertion of miR-1225-5p resulted in a modified sequence (SEQ ID NO: 239, 240).

[0032] Figure 1H The location of a polyprotein according to an embodiment of the present disclosure relative to the endoplasmic reticulum membrane and its cleavage site is shown. Figures 1IA-1IB An example schematic diagram of a proposed mechanism of action of an example oncolytic Zika virus comprising an exogenous polynucleotide provided herein is provided.

[0033] Figure 2A-2F Expression profiles of miRNAs in normal and tumor tissues are shown. Figure 2AHigh expression of miR219a-2-3p in neural progenitor cells and low / null expression in CNS tumor cell lines (glioblastoma, medulloblastoma, and ATRT) and other non-tumor cell lines were shown. Figure 2B High expression of miR219a-5p in neural progenitor cells and low / null expression in CNS tumor cell lines (glioblastoma, medulloblastoma, and ATRT) and other non-tumor cell lines were shown. Figure 2C High expression of miR129a-5p in neural progenitor cells and certain medulloblastoma cells (Daoy, CHLA06) and low / null expression in CNS tumor cell lines (glioblastoma, medulloblastoma, and ATRT) and other non-tumor cell lines were shown. Figure 2D Low / null expression of miR4298 (SEQ ID NO: 10) in all cell lines is shown. Figure 2E High expression of miR377-3p in normal cells and glioblastoma cell line (U251), moderate expression in medulloblastoma cells (Daoy, CHLA06), and low / null expression in CNS tumor cell lines (glioblastoma, medulloblastoma, and ATRT) are shown. Figure 2F High expression of miR1225-5p in normal cell lines (Vero) and medulloblastoma cell lines (Daoy), moderate expression in glioblastoma cell lines (HCB151, U138), and low / zero expression in all other cell lines are shown.

[0034] Figure 3A-3E Exemplary exogenous miRNA target sequences (or seed-complementary target sequences) inserted into the recombinant Zika virus genome are shown.

[0035] Figure 3AExample exogenous miR219a-2-3p target sequences (or seed complementary target sequences) complementary to miR-219a-2-ep (SEQ ID NO: 13) and inserted into or near an example 2k, 5'UTR or 3'UTR modification position of the recombinant Zika virus genome are shown (CTTAACACC (miRNA target 12), CCGACCTGT (miRNA target 13), TTAACACCG (miRNA target 14)). In one modification, miRNA target 12 is inserted into the 2k region and flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 31). In one modification, miRNA target 13 is inserted into the 2k region and flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 32). In one modification, miRNA target 12 is inserted into the adjacent 5'UTR region and flanked by BsiWI sites (SEQ ID NO: 33). In one modification, miRNA target 14 was inserted adjacent to the 3'UTR region and flanked by MluI sites (SEQ ID NO: 34).

[0036] Figure 3B Example exogenous miR219a-5p target sequences (or seed complementary target sequences) complementary to miR219a-5p (SEQ ID NO: 9) and inserted into or near an example 2k, 5'UTR or 3'UTR modification position of the recombinant Zika virus genome are shown (CTAACAGGT (miRNA target 4), TAACAGGTT (miRNA target 5), ACTAACAGG (miRNA target 6)). In one modification, miRNA target 4 is inserted into the 2k region and flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 36). In one modification, miRNA target 5 is inserted into the 2k region and flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 37). In one modification, miRNA target 6 is inserted into the adjacent 5'UTR region and flanked by BsiWI sites (SEQ ID NO: 38). In one modification, miRNA target 4 was inserted adjacent to the 3'UTR region and flanked by MluI sites (SEQ ID NO: 39).

[0037] Figure 3CExample exogenous miR-129-5p target sequences (or seed complementary target sequences) complementary to miR-129-5p (SEQ ID NO: 8) and inserted into or near example 2k, 5'UTR or 3'UTR modification positions of the recombinant Zika virus genome (SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43) are shown (AAAAACGCC (miRNA target 1), AAACGCCAG (miRNA target 2)). In one modification, miRNA target 1 is inserted into the 2k region and flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 40). In one modification, miRNA target 2 is inserted into the 2k region and flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 41). In one modification, miRNA target 1 is inserted into the adjacent 5'UTR region and flanked by BsiWI sites (SEQ ID NO: 42). In one modification, miRNA target 1 was inserted adjacent to the 3'UTR region and flanked by MluI sites (SEQ ID NO: 43).

[0038] Figure 3D Example exogenous miR1225-5p target sequences (or seed complementary target sequences) complementary to miR1225-5p (SEQ ID NO: 11) and inserted into or near an example 2k, 5'UTR or 3'UTR modification position of the recombinant Zika virus genome are shown (CACCCATGC (miRNA target 8), ACCCATGCC (miRNA target 10), CCCATGCCG (miRNA target 9)). In one modification, miRNA target 8 is inserted into the 2k region and flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 45). In one modification, miRNA target 10 is inserted into the 2k region and flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 46). In one modification, miRNA target 9 is inserted into the adjacent 5'UTR region and flanked by BsiWI sites (SEQ ID NO: 47). In one modification, miRNA target 10 was inserted adjacent to the 3'UTR region and flanked by MluI sites to give (SEQ ID NO: 48).

[0039] Figure 3EAn exemplary miR377-3p target sequence (or seed complementary target sequence) complementary to miR377-3p (SEQ ID NO: 12) and inserted into or near an exemplary 2k, 5'UTR or 3'UTR modification position of the recombinant Zika virus genome is shown (AGTGTGTTT (miRNA target 11)). In one modification, miRNA target 11 is inserted into the 2k region and flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 49). In one modification, miRNA target 11 is inserted into the adjacent 5'UTR region and flanked by BsiWI sites (SEQ ID NO: 50). In one modification, miRNA target 11 is inserted into the adjacent 3'UTR region and flanked by MluI sites (SEQ ID NO: 51).

[0040] Figure 4A-4B The generation and effects of an exemplary recombinant Zika virus (oZIKV_OP) (pCC1-ZIKV-OP, Table 8, Table 9B) in cancer cell lines are illustrated. Figure 4A Recombinant Zika virus derived from in vitro transcription and Vero cell transfection is shown. Figure 4B Shown is the oncolytic effect of recombinant Zika virus in a medulloblastoma cell line 48 hours after infection.

[0041] Figure 5A-Figure 5B The cytotoxicity of recombinant Zika virus (oZIKV_OP) (pCC1-ZIKV-OP, Table 8, Table 9B) in glioblastoma and medulloblastoma cell lines is demonstrated. Figure 5A Shown is the decreased viability of glioblastoma cells (U138MG, U251MG, and U343MG cell lines) and medulloblastoma cells (ONS-76 and Daoy cell lines) following infection with recombinant Zika virus at an MOI of 2 when compared to control (CT). Figure 5B Shown is a comparison of infection of recombinant Zika virus oZIKV_0P compared to African wild-type Zika virus in medulloblastoma cells (Daoy).

[0042] Figure 6 A representative Zika replicon plasmid (pRep) is illustrated, comprising a T7 promoter, a hammerhead ribozyme, a 5'UTR, an enhanced green fluorescent protein coding region ("EGFP"), portions of the flanking HA (hemagglutinin) of the ZIKV genome (the last 60 bases of NS4A, the first 60 bases of NS4B), a luciferase coding region ("Nluc"), a 3'UTR, an HDV ribozyme, a multiple cloning site (MCS), a bGH poly(A) signal; and a recombinant Zika virus comprising the ZIKV genome (NS4A, NS4B). The miRNA target sequence can be located within pRep or the recombinant Zika virus.

[0043] Figure 7A-7F Proof of concept for miRNA regulation in a target sequence inserted into the Zika replicon plasmid pRep is shown. Fig. 7A Shown are the results of NanoLuc reporter assays of Vero cells containing pRep with different miRNA target inserts. Figures 7B-7F A construct diagram of the pRep construct used in the NanoLuc reporter assay is shown with the respective miRNA target sequence ( Figure 7B : pRep-129-5p-BsiWi-1c containing the miR129-5p(1c) target sequence; Figure 7C : pRep-129-5p-BsiWI-1e containing the miR129-5p(1e) target sequence; Fig.7D : pRep-219a-2-3p-BsiWI-2b containing the miR219a-2-3p (2b) target sequence; Fig. 7E : pRep-377-3p-BsiWI-4c containing the miR377-5p(4c) target sequence; Figure 7F : pRep-377-3p-BsiWI-4e containing the miR377-5p (4e) target sequence; see Tables 7 and 9A-9B for construct details). Overexpression of miR-129-5p reduced NanoLuc expression, confirming the inhibitory mechanism of pRep with the designed corresponding miRNA target sequences (miRNA target 1, miRNA target 2).

[0044] Figure 8 Results of NanoLuc reporter assays of CHLA cells containing pRep with different miRNA target inserts are shown (see Figures 7A-7F Description of pRep construct details). Overexpression of miRNA reduced NanoLuc expression in all pREPs, confirming the repression mechanism in all designed pRep.

[0045] Fig. 9 A representative plasmid, pCC1-ZIKV-OP, is shown, which contains a 5'UTR, a ZIKV genome, ribozymes (eg, hammerhead and HDV), a T7 promoter, and a 3'UTR.

[0046] Fig.10 An example plasmid for inserting a miRNA target adjacent to the 5'UTR region using the BsiWI site is shown.

[0047] Fig.11 An example plasmid for insertion of a miRNA target adjacent to the 5'UTR region using BsiWI and XhoI sites is shown.

[0048] Fig.12 An example plasmid is shown for inserting an exogenous miRNA target sequence into the 2k region using the AarI site (SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54). The exogenous polynucleotide sequence (SEQ ID NO: 226, 227) contains two restriction sites at the 5' and 3' ends.

[0049] Fig.13 Representative images of plasmid pCC1-ZIKV-2P are shown, which has ZIKV genome components, ribozymes (eg, hammerhead and HDV), T7 promoter near the 5'UTR, 3'UTR, and miRNA target 219a-2-3p inserted in the 2k region.

[0050] Fig.14 Shown are representative images of plasmid pCC1-ZIKV-3P, which has ZIKV genome components, ribozymes (eg, hammerhead, HDV), T7 promoter near the 5'UTR, 3'UTR, and miRNA target miR129-5p inserted between NS5 and 3'UTR.

[0051] Fig.15 Shown are representative images of plasmid pCC1-ZIKV-5P-T7, which has ZIKV genome components, ribozymes (eg, hammerhead, HDV), T7 promoter next to the 5'UTR, 3'UTR, and the miRNA target miR-1225 inserted between the 5'UTR and ancC.

[0052] Fig.16 RNA gel electrophoresis images of samples analyzed using the T7-HIGH kit (first three wells from the left) are shown, where samples were treated with DNase and HiScribe TM T7 ARCA mRNA kit (three wells from the right) pre-treated, and RNA ladder in the leftmost column. The bands confirm the efficiency of in vitro transcription, producing RNA at expressed levels.

[0053] Fig.17 Comparison of ZIKV copy concentrations (copies / μL) produced in cell pellets and supernatants at different time points is shown. The graph demonstrates the beginning and end of the same amount of ZIKV genome, confirming the presence of a complete ZIKV genome after in vitro transcription.

[0054] Fig.18Micrographs of Vero cell cultures transfected with modified ZIKV RNA (TI_14, TI_15, TI_16, TI_17, TI_18) are shown over the course of 1, 4, 5, and 6 days post-infection. Cytopathic effects (*) were observed in all RNA samples (TI14-18) 5-6 days after reinfection, confirming the production of active virus.

[0055] Fig.19 Antigen test results of supernatants of Vero cells transfected with modified ZIKV RNA (pCC1-ZIKV-0P "0p", pCC1-ZIKV-2P-T7 "2p", pCC1-ZIKV-3P-T7 "3p") are shown, each result showing the presence of Zika virus in the supernatant.

[0056] Fig. 20A and Fig. 20B The results are shown 3 days after infection with wild-type or recombinant Zika virus (oZIKV_4 (pCC1-ZIKV-0P), oZIKV_16 (pCC1-ZIKV-0P), oZIKV_5 (pCC1-ZIKV-2P-T7), oZIKV_14 (pCC1-ZIKV-2P-T7), oZIKV_17 (pCC1-ZIKV-2P-T7), oZIKV_6 (pCC1-ZIKV-3P-T7), oZIKV_15 (pCC1-ZIKV-2P-T7), oZIKV_18 (pCC1-ZIKV-2P-T7, see Table 10) Fig. 20A ) and 5 days after infection ( Fig. 20B ) The cell viability test results of CHLA-06-ATRT cells. The four recombinant viruses (oZIKV_4, oZIKV_14, oZIKV_17, oZIKV_18) still maintained their oncolytic effect in the CHLA cell line 5 days after infection.

[0057] Fig.21 Micrographs of neural progenitor cells (NPCs) are shown as a model for testing the safety of recombinant Zika viruses (oZIKV_4, oZIKV_14, oZIKV_17, oZIKV_18) in non-tumor cells. NPC cells were transfected with wild-type Zika virus and recombinant Zika virus, and cell cultures were imaged 5 days after infection. The results showed that oZIKV_14 and oZIKV_18 recombinant viruses exhibited oncolytic effects on CHLA tumor cells ( Figures 20A-20B ), but showed little or no cytotoxic effect on normal NPC ( Figure 21-22BNPCs transfected with wild-type Zika and oZIKV_17 had reduced tumor cell viability. In contrast, two recombinant Zika viruses, oZIKV_14 and oZIKV_18, indicated that these recombinant viruses allowed NPC cell survival (i.e., were safe in normal cells).

[0058] Figure 22A-22B Shown is the neurosphere analysis of NPCs transfected with wild-type and recombinant Zika viruses, where the neurosphere area was measured 5 days after infection ( Fig.22A ) and perimeter ( Fig. 22B ).

[0059] Fig.23 Results of cell viability assays of medulloblastoma cells (Daoy) and ATRT cells (CHLA) infected with recombinant Zika virus with miRNA target insert (oZIKV_14) after miRNA modulation by cell transfection 24 h prior to viral infection are shown. These results indicate inhibition of oZIKV_14 replication after miR-219a-2-3p overexpression by target sequence ligation, confirming the inhibitory mechanism function of the recombinant virus.

[0060] Fig.24 Results of cell viability assays of brain microvessels (hCMECs) infected with recombinant Zika virus with miRNA target insert (oZIKV14) and wild-type Zika virus at MOI 5 three days after infection are shown. Relative viability did not decrease after oZIKV_14 infection, confirming the safety of the recombinant virus oZIKV_14 in normal brain microvascular cell lines compared to wild-type ZIKV. Samples were statistically different from mock when: ap<0.0001 by ANOVA multiple comparisons.

[0061] Fig.25 Results of cell viability assays of microglia (hMC3) infected with recombinant Zika virus with miRNA target insert (oZIKV14) and wild-type Zika virus at MOI 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, 0.002 three days after infection are shown. Both oZIKV_14 and wild-type viruses reduced the relative viability of microglial cell lines after infection, confirming the immune response after cell infection. By ANOVA multiple comparisons, samples were statistically different from the mock when: ap<0.0001; bp<0.0009.

[0062] Fig.26Results of cell viability assays of testicular cells (Hs1.Tes) infected with recombinant Zika virus with miRNA target insert (oZIKV14) and wild-type Zika virus at MOI 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, 0.002 three days after infection are shown. Both oZIKV_14 and wild-type viruses reduced the relative viability of the testicular cell line after infection.

[0063] Fig. 27 Results of cell viability assays of medulloblastoma cells (Daoy) infected with recombinant Zika virus with miRNA target insert (oZIKV14) and wild-type Zika virus at MOI 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, 0.002 three days after infection are shown. Both oZIKV_14 and wild-type virus reduced the relative viability of the Daoy cell line after infection, confirming oncolysis in the medulloblastoma cell line. By ANOVA multiple comparisons, samples were statistically different from the mock when: ap<0.0001.

[0064] Fig.28 Shown are the results of cell viability assays of medulloblastoma cells (ONS) infected with recombinant Zika virus with miRNA target insert (oZIKV14) and wild-type Zika virus at MOI 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, 0.002 three days after infection. Both oZIKV_14 and wild-type viruses reduced the relative viability of the ONS cell line after infection, confirming oncolysis in the medulloblastoma cell line. By ANOVA multiple comparisons, samples were statistically different from the simulation when: ap<0.0001.

[0065] Fig.29 Results of cell viability assays of ATRT cells (CHLA-06-ATRT) infected with recombinant Zika virus with miRNA target insert (oZIKV14) and wild-type Zika virus at MOI 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, 0.002 three days after infection are shown. Both oZIKV_14 and wild-type virus reduced the relative viability of the CHLA-06-ATRT cell line after infection, confirming oncolysis in the medulloblastoma cell line. By ANOVA multiple comparisons, samples were statistically different from mock when: ap<0.0001.

[0066] Fig.30Results of cell viability assays of glioblastoma cells (U138 and LN18) infected with recombinant Zika virus with miRNA target insert (oZIKV14) and wild-type Zika virus at MOI 5 and MOI 1.667 three days after infection are shown. When compared to wild-type ZIKV, oZIKV_14 reduced relative viability at the lowest MOI (virus concentration) in both glioblastoma cell lines after infection, confirming the highest oncolytic effect of oZIKV_14. By ANOVA multiple comparisons, samples were statistically different from mock when: ap<0.0001; dp<0.05.

[0067] Fig.31 Results of cell viability assays of prostate tumor cells (DU-145) infected with recombinant Zika virus with miRNA target insert (oZIKV14) and wild-type Zika virus at MOI 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, 0.002 three days after infection are shown. Both oZIKV_14 and wild-type viruses reduced the relative viability of the DU-145 cell line after infection, confirming oncolysis in the prostate tumor cell line. By ANOVA multiple comparisons, samples were statistically different from the mock when: ap<0.0001.

[0068] Fig.32 The results of cell viability assays of triple-negative breast tumor cells (MDA-MB-231) infected with recombinant Zika virus with miRNA target insert (oZIKV14) and wild-type Zika virus are shown three days after infection at MOI 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, 0.002. Both oZIKV_14 and wild-type viruses reduced the relative viability of the MDA-MB-231 cell line after infection, confirming the oncolytic effect in the triple-negative breast tumor cell line. By ANOVA multiple comparisons, samples were statistically different from the simulation when: ap<0.0001; bp<0.0009; cp<0.009.

[0069] Fig.33Results of cell viability assays of colon tumor cells (hCT-8) infected with recombinant Zika virus with miRNA target insert (oZIKV14) and wild-type Zika virus at MOI 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, 0.002 three days after infection are shown. Neither oZIKV_14 nor wild-type virus reduced the relative viability of the hCT-8 cell line after infection, confirming oncolysis in the colon tumor cell line. By ANOVA multiple comparisons, samples were statistically different from mock when: ap<0.0001; cp<0.009; dp<0.05.

[0070] Fig.34 Results of cell viability assays of luminal breast tumor cells (MCF7) infected with recombinant Zika virus with miRNA target insert (oZIKV14) and wild-type Zika virus at MOI 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, 0.002 three days after infection are shown. Neither oZIKV_14 nor wild-type virus reduced the relative viability of the MCF7 cell line after infection, confirming oncolysis in the luminal breast tumor cell line. By ANOVA multiple comparisons, samples were statistically different from mock when: ap<0.0001; bp<0.0009; cp<0.009; dp<0.05.

[0071] Fig.35 The oncolytic effect of oZIKV14 on the development of central nervous system tumors and their metastases in the spinal cord is shown. Control = animals receiving intracerebroventricular (icv) vehicle injection; Zika = animals receiving icv Zika virus (6x10 3 PFU). T0 = image showing tumor presence and location before injection; T1 = image of the same animal one week after injection; T2 = image of the same animal two weeks after injection. Injection of oZIKV_14 resulted in partial and complete remission of brain and metastatic tumors, confirming the in vivo effectiveness of oZIKV_14 against CNS tumors. DETAILED DESCRIPTION

[0072] On the one hand, there is provided a virus that damages cell division, cell growth, and / or induces cell death in cancer cells, referred to in some embodiments as an oncolytic virus. A non-limiting example of an oncolytic virus is a recombinant Zika virus as described herein. Another aspect of the present disclosure relates to a method for treating cancer, the method comprising administering a recombinant Zika virus as described herein. In some embodiments, the oncolytic virus does not replicate in non-cancerous cells. In some embodiments, the oncolytic virus does not damage cell division, cell growth, and / or induce cell death in non-cancerous cells. In some embodiments, the non-cancerous cells express microRNA (miRNA), and the oncolytic virus comprises a target of miRNA, so that the miRNA can bind to the target. The cancer cells may not express the miRNA, or express less miRNA than non-cancerous cells. A non-limiting example of a non-cancerous cell is a neuron. Further provided are nucleic acids and constructs for preparing viruses (such as oncolytic viruses herein).

[0073] Before describing the inventive methods and compositions, it should be understood that the disclosure is not limited to the specific methods or compositions described, and therefore may vary. Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those of ordinary skill in the art are generally understood. All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials associated with the cited publications. It should be understood that in the event of a conflict, the present disclosure replaces any disclosure incorporated into the publication.

[0074] It will be apparent to those skilled in the art upon reading this disclosure that each of the individual embodiments described and illustrated herein has discrete components and features that can be readily separated or combined with the features of any other several embodiments without departing from the scope or spirit of the present disclosure. Any recited method can be performed in the order of events recited or in any other order that is logically possible.

[0075] In the case of providing a numerical range, unless otherwise stated, each intermediate value between the upper and lower limits of the range is also specifically disclosed to one tenth of the lower limit unit. Each smaller range between the intermediate values ​​in any specified value or specified range is included in this article. The upper and lower limits of these smaller ranges can be independently included in the range or excluded from the range, and each range when any one, no one or two limits are included in the smaller range is also included in this article, but it depends on any specific exclusion limit in the stated range. When the stated range includes one or two limits, the scope of any one or two of the included limits is also included.

[0076] The term "about" or "approximately" can mean that a particular value is within an acceptable error range as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, for example, limitations of the measurement system. For example, depending on the practice of a given value, "about" can mean within 1 or more than 1 standard deviation. Where specific values ​​are described in the application and claims, unless otherwise stated, the term "about" should be assumed to mean an acceptable error range for the specific value, such as ±10% of the value modified by the term "about".

[0077] The terms "individual", "patient" or "subject" can be used interchangeably. The terms do not require or are not limited to situations characterized by supervision (e.g., continuous or intermittent) by a health care worker (e.g., a doctor, a registered nurse, a licensed nurse, a physician's assistant, a caregiver, or a hospice worker). In some embodiments, the patient, object, or individual can be under the supervision of a health care worker. The term "subject" can refer to an animal, including but not limited to primates (e.g., humans), cattle, sheep, goats, horses, dogs, cats, rabbits, rats, or mice. The terms "subject" and "patient" are used interchangeably herein, for example, referring to a mammalian subject, such as a human subject.

[0078] The terms "heterologous nucleic acid sequence" or "foreign nucleic acid sequence" or "transgene" as used herein in relation to a particular virus may refer to a nucleic acid sequence that originates from a source other than the particular virus.

[0079] As referred to herein, the terms "inhibit," "reduce," or "prevent," or any variation of these terms, may include any measurable reduction or complete inhibition to achieve the desired result.

[0080] As used herein, "promoter" can be a control sequence, which is a region in which transcription initiation and rate are controlled in a nucleic acid sequence. In certain embodiments, a promoter can include genetic elements to which regulatory proteins and molecules can bind, such as RNA polymerase and other transcription factors. The terms "operably positioned", "operably connected", "under control" and "under transcriptional control" can mean that a promoter is in the correct functional position and / or direction relative to a nucleic acid sequence to control transcription initiation and / or expression of the sequence. In certain embodiments, a promoter may or may not be used with an "enhancer", which refers to a cis-acting regulatory sequence that participates in transcriptional activation of a nucleic acid sequence.

[0081] The percentage of sequence identity (%) about a reference polypeptide or polynucleotide sequence is the percentage of amino acids or nucleotide residues identical with the amino acids or nucleotide residues in the reference polypeptide or polynucleotide sequence in the candidate sequence after aligning the sequences and introducing gaps (if necessary) in order to achieve the maximum percentage of sequence identity and not considering any conservative substitution as part of the sequence identity. The comparison for the purpose of determining the percentage of amino acid sequence identity can be achieved in a variety of known ways, for example, using publicly available computer software, such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. It is possible to determine the appropriate parameters for aligning sequences, including the algorithm required for achieving maximum alignment on the full length of the compared sequences. However, for the purposes of this article, the sequence comparison computer program ALIGN-2 is used to generate amino acid or polynucleotide sequence identity % values. The ALIGN-2 sequence comparison computer program is written by Genentech, Inc., and the source code has been submitted to the U.S. Copyright Office (USCopyright Office) in Washington DC, 20559 with user documents, where it is registered under U.S. Copyright Registration No. TXU510087. The ALIGN-2 program is publicly available from Genentech, Inc. of South San Francisco, Calif., or can be compiled from source code. The ALIGN-2 program should be compiled for use on a UNIX operating system (including digital UNIX V4.0D). All sequence comparison parameters are set by the ALIGN-2 program and do not change.

[0082] Where ALIGN-2 is used for amino acid or polynucleotide sequence comparisons, the % amino acid or polynucleotide sequence identity of a given sequence A to, with, or relative to a given sequence B (which may alternatively be phrased as a given sequence A having or comprising a certain % sequence identity to, with, or relative to a given sequence B) is calculated as follows: 100 x fraction X / Y, where X is the number of residues scored as identical matches by the sequence alignment program ALIGN-2 in the program's alignment of A and B, and where Y is the total number of residues in B. It will be understood that where the length of sequence A is not equal to the length of sequence B, the % sequence identity of A to B will not be equal to the % sequence identity of B to A. Unless expressly stated otherwise, all % sequence identity values ​​used herein are obtained as described in the immediately preceding paragraph using the ALIGN-2 computer program.

[0083] The terms "treat", "treating" and "treatment" may be meant to include relieving or eliminating a disorder, disease, or condition; or one or more symptoms associated with a disorder, disease, or condition; or relieving or eradicating one or more causes of the disorder, disease, or condition itself. The desired effects of treatment may include, but are not limited to, preventing the occurrence or recurrence of a disease, alleviating symptoms, reducing any direct or indirect pathological consequences of a disease, preventing metastasis, reducing the rate of disease progression, improving or alleviating the disease state, and alleviating or improving prognosis.

[0084] The term "therapeutically effective amount" may refer to an amount of a compound that, when administered, is sufficient to prevent the development of, or to alleviate to some extent, one or more symptoms of a disorder, disease, or condition being treated. The term "therapeutically effective amount" may also refer to an amount of a compound that is sufficient to elicit the biological or medical response of a cell, tissue, system, animal, or human being that is being sought by a researcher, veterinarian, physician, or clinician.

[0085] The terms "pharmaceutically acceptable carrier", "pharmaceutically acceptable excipient", "physiologically acceptable carrier", or "physiologically acceptable excipient" may refer to a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulating material. A component may be "pharmaceutically acceptable" in the sense that it is compatible with the other ingredients of a pharmaceutical formulation. It may also be suitable for use in contact with tissues or organs of humans and animals without producing undue toxicity, irritation, allergic response, immunogenicity, or other problems or complications, commensurate with a reasonable benefit / risk ratio. See, Remington: The Science and Practice of Pharmacy, 21st ed.; Lippincott Williams & Wilkins: Philadelphia, PA, 2005; Handbook of Pharmaceutical Excipients, 5th ed.; Rowe et al., eds., The Pharmaceutical Press and the American Pharmaceutical Association: 2005; and Handbook of Pharmaceutical Additives, 3rd ed.; Ash and Ash, eds., Gower Publishing Company: 2007; Pharmaceutical Preformulation and Formulation, Gibson, ed., CRC Press LLC: Boca Raton, FL, 2004).

[0086] The term "pharmaceutical composition" may refer to a mixture of a compound disclosed herein and other chemical components (such as a diluent or carrier). A pharmaceutical composition may help administer a compound to an organism. There are a variety of techniques for administering compounds in the art, including but not limited to oral, injection, aerosol, parenteral, and topical administration. Pharmaceutical compositions may also be obtained by reacting a compound with an inorganic acid or an organic acid (such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, etc.).

[0087] As used herein, "anticancer agent" may refer to an agent or therapy that can negatively affect a subject's cancer, for example, by killing cancer cells, inducing apoptosis in cancer cells, reducing the growth rate of cancer cells, reducing the incidence or number of metastases, reducing tumor size, inhibiting tumor growth, reducing blood supply to a tumor or cancer cell, promoting an immune response against a cancer cell or tumor, preventing or inhibiting the progression of cancer, or extending the life span of a subject with cancer. Non-limiting examples of anticancer agents may include biological agents (biotherapy), chemotherapeutic agents, and radiotherapeutic agents.

[0088] As used herein, the term "oncolysis" may refer to the killing of cancer or tumor cells by an agent by directly lysing the cells, by stimulating an immune response to the cells, apoptosis, expression of toxic proteins, shutting down autophagy and protein synthesis, induction of anti-tumor immunity, or any combination thereof. Direct lysis of cancer or tumor cells infected by the agent may be the result of viral replication within the cells. In some instances, the term "oncolysis" may refer to killing cancer or tumor cells without lysing the cells.

[0089] As used herein, the term "oncolytic virus" may refer to a virus that preferentially infects and kills tumor cells. In certain non-limiting cases, it is understood that oncolytic viruses can promote anti-tumor responses through a dual mechanism that relies not only on the selective killing of tumor cells, but also on the stimulation of the host's anti-tumor immune response.

[0090] In some embodiments, as used herein, "derivatives" of polypeptides or polynucleotides refer to sequences at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to polypeptides or polynucleotides, respectively. In some embodiments, as used herein, "derivatives" of polypeptides or polynucleotides refer to sequences at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to polypeptides or polynucleotides, respectively. In some embodiments, as used herein, a "derivative" of a polypeptide or polynucleotide refers to a sequence having no or no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid or nucleotide substitutions, insertions, or deletions compared to the polypeptide or polynucleotide, respectively.

[0091] Oncolytic virus and nucleic acid composition

[0092] In one aspect, provided herein are Zika viruses and methods for treating cancer, the methods comprising administering Zika viruses to subjects in need thereof. In some embodiments, the Zika viruses are recombinant Zika viruses. In some embodiments, the Zika viruses are produced by nucleic acid compositions described herein.

[0093] In some embodiments, the Zika virus herein is selective for cells (such as cancer cells) undergoing cell division, and can therefore be used to kill the cancer cells and / or inhibit tumor growth. Therefore, the oncolytic virus provided herein is not limited to the virus having a lytic effect on cancer cells, but includes acting on cancer cells to inhibit cell growth, prevent cell growth, inhibit cell replication, prevent cell replication, cause cell death or any combination thereof. The oncolytic virus can be a clinical isolate of a virus, or a clone or recombinant virus derived or engineered therefrom.

[0094] In some embodiments, the Zika virus herein has a tropism for cells of the central nervous system. As a non-limiting example, the Zika virus has a tropism for cells in the central nervous system (e.g., brain cancer cells).

[0095] On the other hand, a composition is provided, which comprises one or more parts of Zika virus. For example, such parts of the virus include nucleic acid (e.g., nucleic acid encoding Zika virus or part thereof) and protein of the virus. Non-limiting examples of viral proteins include capsid proteins, membrane proteins, non-structural proteins, and envelope proteins. Non-limiting examples of viral nucleic acids include protein coding sequences and non-protein coding sequences.

[0096] In some embodiments, nucleic acid compositions are provided that encode sequences that are at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more sequences of Table 1. In some embodiments, nucleic acid compositions are provided that encode sequences that are at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more sequences of Table 2. In some embodiments, nucleic acid compositions are provided that comprise sequences that are at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more sequences of Table 3. In some embodiments, nucleic acid compositions are provided that encode sequences that are at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more sequences of Table 4. In some embodiments, nucleic acid compositions are provided that comprise a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more sequences of Table 5. In some embodiments, nucleic acid compositions are provided that comprise a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more sequences of Table 6A. In some embodiments, a nucleic acid composition comprising a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the complement of one or more sequences of Table 6B is provided. In some embodiments, a nucleic acid composition comprising a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more recombinant Zika virus constructs of Table 8 is provided.In some embodiments, nucleic acid compositions are provided that comprise sequences that are at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more recombinant Zika virus constructs of Table 9A. In some embodiments, nucleic acid compositions are provided that comprise sequences that are at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more sequences of Table 9B. In some embodiments, nucleic acid compositions are provided that comprise a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more recombinant Zika virus constructs of Table 10. In some embodiments, nucleic acid compositions are provided that comprise a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more sequences of the Zika virus from Table 12. In some embodiments, a nucleic acid composition is provided comprising a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences of the Zika virus from Table 13.

[0097] In some embodiments, a recombinant Zika virus is provided that comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more sequences of Table 1. In some embodiments, a recombinant Zika virus is provided that comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more sequences of Table 2. In some embodiments, a recombinant Zika virus is provided that comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more sequences of Table 3. In some embodiments, a recombinant Zika virus is provided that comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more sequences of Table 4. In some embodiments, a recombinant Zika virus is provided that comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more sequences of Table 5. In some embodiments, a recombinant Zika virus is provided that comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more sequences of Table 6A. In some embodiments, a recombinant Zika virus is provided that comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the complement of one or more sequences of Table 6B. In some embodiments, a recombinant Zika virus is provided that comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more recombinant Zika virus constructs of Table 8.In some embodiments, a recombinant Zika virus is provided that comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more recombinant Zika virus constructs of Table 9A. In some embodiments, a recombinant Zika virus is provided that comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more sequences of Table 9B. In some embodiments, a recombinant Zika virus is provided that comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more recombinant Zika virus constructs of Table 10. In some embodiments, a recombinant Zika virus is provided that comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more sequences of the Zika virus from Table 12. In some embodiments, a recombinant Zika virus is provided that comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences of the Zika virus from Table 13.

[0098] In some embodiments, the recombinant Zika virus described herein is a recombinant Zika virus comprising a nucleic acid sequence derived from the Zika virus genome, for example, by mutation, insertion, and / or deletion of one or more nucleobases. Insertion includes a nucleic acid sequence encoding one or more proteins. Insertion also includes a promoter, such as a promoter inducible in mammalian cells. Deletion includes removal of a coding sequence that allows viral replication. Therefore, in some cases, the recombinant Zika virus described herein indicates that the virus has been modified by introducing heterologous nucleic acids or proteins and / or changing the native nucleic acid sequence.

[0099] In some embodiments, the recombinant Zika virus described herein comprises one or more molecules, such as exogenous nucleic acids, which confer enhanced levels of tumor cell specificity to the virus. In this way, the virus is targeted to a specific tumor type using tumor cell-specific molecules or biomarkers. In some embodiments, the recombinant Zika virus comprises an exogenous nucleic acid complementary to a miRNA. The miRNA may be expressed in non-tumor cells, but not in tumor cells. The expression of the miRNA in non-tumor cells may be more than in tumor cells, for example, the expression of the miRNA in non-tumor cells is at least 2 times more than in tumor cells. A non-limiting example of a non-tumor cell is a neuron. In some embodiments, the recombinant Zika virus is an oncolytic Zika virus with oncolytic activity, and the recombinant Zika virus retains oncolytic activity with exogenous nucleic acids. For example, if an exogenous nucleic acid is inserted into a polynucleotide encoding a 2k protein, the 2k protein is still expressed, and the Zika virus retains oncolytic activity. As another example, if an exogenous nucleic acid is inserted between a 5'UTR and a polynucleotide encoding ancC / C protein, the ancC / C protein is still expressed, and the Zika virus retains oncolytic activity. As another example, if an exogenous nucleic acid is inserted between the 3'UTR and the polynucleotide encoding the nonstructural protein NS5, the NS5 protein is still expressed and the Zika virus retains oncolytic activity.

[0100] In some embodiments, the recombinant Zika virus described herein comprises a nucleic acid sequence encoding a polypeptide heterologous to the virus, wherein the polypeptide can be expressed under an inducible promoter. Therefore, the virus can also be an expression vector that can express a polypeptide. For example, the recombinant Zika virus described herein comprises a suicide gene that can be expressed under an inducible promoter (such as CMV). Cancer treatment methods involving the recombinant Zika virus described herein optionally include inducing the expression of a suicide gene to kill or otherwise prevent viral reproduction. Therefore, viral infection can be controlled by a doctor according to the needs of the patient.

[0101] In some embodiments, the recombinant Zika virus described herein comprises a genetic modification that affects viral gene expression. For example, a virulence gene mutation that causes the virus to be pathogenic to a host organism causes a significant reduction in the expression of the gene, or wherein the gene product becomes non-functional, or its ability to function is significantly reduced. In some cases, the genetic modification impairs the ability of the virus to replicate or replicate in non-cancerous or non-dividing cells.

[0102] In some embodiments, the recombinant Zika virus described herein comprises at least one viral protein necessary for viral replication under the control of a tumor-specific promoter. In some embodiments, a gene encoding a cytotoxic agent is placed under the control of a tumor-specific promoter. For example, cytotoxic agents include toxins, prodrugs, cytokines, and chemokines.

[0103] In some cases, the recombinant Zika virus described herein includes at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 500, 1000, 5000, 10000, or 11000 nucleobases of the wild-type Zika genome. These nucleobases do not necessarily have 100% sequence identity with the wild-type Zika virus, and can vary, for example, the identity is at least about 80%, 85%, 90%, 95%, or 98%. In some cases, a portion refers to a viral region encoding one or more proteins. In addition, or alternatively, a portion refers to a viral region that does not encode a protein.

[0104] The present invention further provides a nucleic acid composition comprising the genome of the recombinant Zika virus described herein. Another aspect relates to a host cell comprising the recombinant Zika virus described herein.

[0105] In some embodiments, the recombinant Zika virus can exhibit enhanced intratumoral and intertumoral spread, enhanced immune evasion, enhanced tumor-specific replication, and / or enhanced tumor-targeted delivery. In some embodiments, the recombinant Zika virus as described herein exhibits enhanced intratumoral and intertumoral spread, enhanced immune evasion, enhanced tumor-specific replication, and enhanced tumor-targeted delivery.

[0106] Zika virus produces highly abundant non-coding RNA in infected cells, called subgenomic flaviviral RNA (sfRNA). In some embodiments, the recombinant Zika virus produces higher levels of sfRNA in the cancer cells of the subject than wild-type Zika virus. In some embodiments, the higher level of sfRNA is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%.

[0107] In some embodiments, the recombinant Zika virus described herein comprises a 3'UTR to increase sfRNA production, for example, as a result of a longer stagnation of the exoribonuclease XRN1 in cancer cells. In some embodiments, the recombinant Zika virus described herein comprises a 5'UTR to increase sfRNA production, for example, as a result of a longer stagnation of the exoribonuclease XRN1 in cancer cells. In some embodiments, the recombinant Zika virus described herein comprises a 5'UTR and a 3'UTR to increase sfRNA production, for example, as a result of a longer stagnation of the exoribonuclease XRN1 in cancer cells.

[0108] In some embodiments, the method of administering a recombinant Zika virus further comprises administering additional exoribonuclease-resistant sfRNA to a subject in need thereof.

[0109] In some embodiments, the recombinant Zika virus is produced by a nucleic acid composition comprising a polynucleotide encoding Zika virus capsid protein C or a derivative of Zika virus C, a polynucleotide encoding Zika virus viral membrane protein (prM / M) or a derivative of Zika virus prM / M, a polynucleotide encoding Zika virus viral envelope protein (E) or a derivative of Zika virus E, or any combination thereof. Non-limiting example sequences include those of Table 5 and Table 9B.

[0110] In certain embodiments, the recombinant Zika virus is produced by a nucleic acid composition comprising only a polynucleotide encoding Zika virus C or a derivative of Zika virus C. Thus, in some embodiments, the recombinant Zika virus described herein is produced by expressing such a nucleic acid composition in a producer cell, wherein the producer cell is further infected with a second Zika virus, such that Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus.

[0111] In certain embodiments, the recombinant Zika virus is produced by a nucleic acid composition comprising only polynucleotides encoding Zika virus prM / M or a derivative of Zika virus prM / M. Thus, in some embodiments, the recombinant Zika virus described herein is produced by expressing such a nucleic acid composition in a production cell, wherein the production cell is further infected with a second Zika virus, such that Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus.

[0112] In certain embodiments, the recombinant Zika virus is produced from a nucleic acid composition comprising only a polynucleotide encoding Zika virus E or a derivative of Zika virus E. Thus, in some embodiments, the recombinant Zika virus described herein is produced by expressing such a nucleic acid composition in a producer cell, wherein the producer cell is further infected with a second Zika virus, such that Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus.

[0113] In certain embodiments, the recombinant Zika virus is produced by a nucleic acid composition comprising only a polynucleotide encoding Zika virus C or a derivative of Zika virus C and a polynucleotide encoding Zika virus prM / M or a derivative of Zika virus prM / M. Thus, in some embodiments, the recombinant Zika virus described herein is produced by expressing such a nucleic acid composition in a production cell, wherein the production cell is further infected with a second Zika virus, such that Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus.

[0114] In certain embodiments, a recombinant Zika virus is produced by a nucleic acid composition comprising only a polynucleotide encoding Zika virus C or a derivative of Zika virus C and a polynucleotide encoding Zika virus E or a derivative of Zika virus E. Thus, in some embodiments, a recombinant Zika virus described herein is produced by expressing such a nucleic acid composition in a producer cell, wherein the producer cell is further infected with a second Zika virus such that Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus.

[0115] In certain embodiments, a recombinant Zika virus is produced by a nucleic acid composition comprising only a polynucleotide encoding a Zika virus prM / M or a derivative of a Zika virus prM / M and a polynucleotide encoding a Zika virus E or a derivative of a Zika virus E. Thus, in some embodiments, a recombinant Zika virus described herein is produced by expressing such a nucleic acid composition in a producer cell, wherein the producer cell is further infected with a second Zika virus such that Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of a Zika virus prM / M, and Zika virus E or a derivative of a Zika virus E are present in the recombinant Zika virus.

[0116] In some embodiments, the nucleic acid composition herein comprises a polynucleotide encoding Zika virus C, a polynucleotide encoding Zika virus prM / M, and a polynucleotide encoding Zika virus E. When the three structural proteins are expressed as a nucleic acid composition described herein, in some embodiments, they can be expressed in one nucleic acid. When the three structural proteins are expressed as a nucleic acid composition described herein, in other embodiments, they can be expressed in more than one nucleic acid.

[0117] In some embodiments, the polynucleotide encoding the derivative of Zika virus C comprises at least one substitution, at least one deletion, and / or at least one insertion compared to wild-type Zika virus C. In some embodiments, Zika virus C or a derivative of Zika virus C comprises an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of Table 1.

[0118] Table 1. Example sequences

[0119]

[0120] In some embodiments, the polynucleotide encoding the derivative of Zika virus prM / M comprises at least one substitution, at least one deletion, and / or at least one insertion compared to wild-type Zika virus prM / M. In some embodiments, Zika virus prM / M or a derivative of Zika virus prM / M comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of Table 2.

[0121] Table 2. Example sequences

[0122]

[0123] In some embodiments, the polynucleotide encoding the derivative of Zika virus E comprises at least one substitution, at least one deletion, and / or at least one insertion compared to wild-type Zika virus E. In some embodiments, the polynucleotide encoding E is translated into wild-type Zika virus E. In some embodiments, Zika virus E or a derivative of Zika virus E comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence of Table 3.

[0124] Table 3. Example sequences

[0125]

[0126] In some embodiments, the nucleic acid composition comprises the 5' untranslated region (5'UTR) of Zika virus. In some embodiments, the nucleic acid composition comprises the 3' untranslated region (3'UTR) of Zika virus. Non-limiting example untranslated regions include untranslated regions from viruses disclosed in Table 4 and Tables 12-13. In some embodiments, the 5' untranslated region (5'UTR) of Zika virus comprises a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of Table 4 or Table 12.

[0127] Table 4. Example Zika UTR sequences

[0128]

[0129] Table 12. Non-limiting example Zika 5'UTR sequences

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139]

[0140] Table 13. Non-limiting example Zika 3'UTR sequences

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151] In some embodiments, the nucleic acid composition does not include polynucleotides encoding one or more nonstructural (NS) proteins selected from (i) NS1, (ii) NS2A, (iii) NS2B, (iv) NS3, (v) NS4A, (vi) NS4B, (vii) NS5, or (viii) (i)-(vii) two or more. In other embodiments, the nucleic acid composition includes polynucleotides encoding one or more nonstructural (NS) proteins selected from (i) NS1, (ii) NS2A, (iii) NS2B, (iv) NS3, (v) NS4A, (vi) NS4B, (vii) NS5, or (viii) (i)-(vii) two or more. Non-limiting example nonstructural proteins include sequences of Table 5 and Table 9B. In some embodiments, the nucleic acid does not include polynucleotides encoding 2k peptides. In some embodiments, the nucleic acid includes polynucleotides encoding 2k peptides. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of Table 5.

[0152] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding an NS1 protein. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding an NS2A protein. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding an NS2B protein. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding an NS3 protein. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding an NS4A protein. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding an NS4B protein. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding an NS5 protein. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding a 2k peptide.

[0153] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1 and NS2A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1 and NS2B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1 and NS3. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1 and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1 and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1 and NS5.

[0154] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2A and NS2B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2A and NS3. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2A and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2A and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2A and NS5.

[0155] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2B and NS3. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2B and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2B and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2B and NS5.

[0156] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS3 and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS3 and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS3 and NS5.

[0157] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS4A and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS4A and NS5.

[0158] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS4B and NS5.

[0159] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1, NS2A, and NS2B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1, NS2A, and NS3. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1, NS2A, and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1, NS2A, and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1, NS2A, and NS5.

[0160] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1, NS2B, and NS3. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1, NS2B, and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1, NS2B, and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1, NS2B, and NS5.

[0161] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1, NS3, and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1, NS3, and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1, NS3, and NS5.

[0162] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1, NS4A, and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1, NS4A, and NS5.

[0163] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1, NS4B, and NS5.

[0164] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2A, NS2B, and NS3. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2A, NS2B, and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2A, NS2B, and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2A, NS2B, and NS5.

[0165] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2A, NS3, and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2A, NS3, and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2A, NS3, and NS5.

[0166] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2A, NS4A, and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2A, NS4A, and NS5.

[0167] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2A, NS4B, and NS5.

[0168] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2B, NS3, and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2B, NS3, and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2B, NS3, and NS5.

[0169] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2B, NS4A, and NS5.

[0170] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2B, NS4B, and NS5.

[0171] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS3 and NS4A, and NS5.

[0172] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS3, NS4B, and NS5.

[0173] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS4A, NS4B, and NS5.

[0174] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1, NS2A, and NS2B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1, NS2A, and NS3. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1, NS2A, and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1, NS2A, and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1, NS2A, and NS5.

[0175] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1, NS2B, and NS3. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1, NS2B, and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1, NS2B, and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1, NS2B, and NS5.

[0176] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1, NS3, and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1, NS3, and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1, NS3, and NS5.

[0177] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1, NS4A, and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1, NS4A, and NS5.

[0178] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1, NS4B, and NS5.

[0179] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2A, NS2B, and NS3. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2A, NS2B, and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2A, NS2B, and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2A, NS2B, and NS5.

[0180] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2A, NS3, and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2A, NS3, and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2A, NS3, and NS5.

[0181] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2A, NS4A, and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2A, NS4A, and NS5.

[0182] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2A, NS4B, and NS5.

[0183] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2B, NS3, and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2B, NS3, and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2B, NS3, and NS5.

[0184] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2B, NS4A, and NS5.

[0185] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2B, NS4B, and NS5.

[0186] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS3 and NS4A, and NS5.

[0187] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS3, NS4B, and NS5.

[0188] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS4A, NS4B, and NS5.

[0189] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1 and NS2A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1 and NS2B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1 and NS3. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1 and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1 and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1 and NS5.

[0190] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2A and NS2B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2A and NS3. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2A and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2A and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2A and NS5.

[0191] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2B and NS3. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2B and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2B and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2B and NS5.

[0192] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS3 and NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS3 and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS3 and NS5.

[0193] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS4A and NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS4A and NS5.

[0194] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS4B and NS5.

[0195] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS1. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS2B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS3. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS4A. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS4B. In certain embodiments, the nucleic acid composition comprises polynucleotides encoding all NS proteins except NS5.

[0196] In some embodiments, the NS1 is Zika virus NS1. In some embodiments, the NS2A is Zika virus NS2A. In some embodiments, the NS2B is Zika virus NS2B. In some embodiments, the NS3 is Zika virus NS3. In some embodiments, the NS4A is Zika virus NS4A. In some embodiments, the NS4B is Zika virus NS4B. In some embodiments, the NS5 is Zika virus NS5.

[0197] In some embodiments, the components of the nucleic acid composition include African Zika virus components, Asian Zika virus components, or Brazilian Zika virus components, or a combination of two or more thereof. In one embodiment, the Zika virus is the African MR766 strain.

[0198] In some embodiments, the components of the nucleic acid composition are expressed on one or more independent nucleic acids. In some embodiments, the nucleic acid composition comprises one or more operably connected expression control elements, which confer expression of the nucleic acid composition in vitro or in vivo. In some embodiments, the expression control element is a promoter that drives the nucleic acid composition to express in vitro. In certain embodiments, the promoter is T7, T3, SP6 or any phage promoter.

[0199] In some embodiments, the expression control element is a promoter that drives expression of the nucleic acid composition in the target cell. In some embodiments, the promoter is CMV, SV40, or any eukaryotic promoter.

[0200] In some embodiments, the target cell is a neuron or non-neuronal cell, Vero, COS, CHO, C6 / 36, HeLa, HEK, HepG2. In some embodiments, the target cell is an oligodendrocyte, a microglia, or an astrocyte.

[0201] In some embodiments, a recombinant Zika virus is produced by expressing a nucleic acid composition described herein in a producer cell, wherein the producer cell is further infected with a second Zika virus such that Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus.

[0202] In some embodiments, the second Zika virus for further infection is a wild-type Zika virus. In some embodiments, the wild-type Zika virus is an African, Asian or Brazilian strain. In other embodiments, the second Zika virus for further infection is a modified Zika virus. In some specific embodiments, the modified Zika virus comprises one or more microRNA-based gene silencing mechanisms. In some specific embodiments, the one or more microRNA-based gene silencing mechanisms control viral replication.

[0203] In some embodiments, the recombinant Zika virus is produced by expressing the nucleic acid composition in a production cell. In some embodiments, it is produced without a second Zika virus infection. In some embodiments, Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus or Zika virus-like particles. In some embodiments, the production cell is a Vero E6 or C6 / 36 cell.

[0204] In some embodiments, the recombinant Zika virus is replication-competent. In other embodiments, the recombinant Zika virus is replication-incompetent without reducing vector titer. In some embodiments, the recombinant Zika virus has reduced insertion mutations. In other embodiments, the recombinant Zika virus has a reduced immune response.

[0205] Some embodiments of the present disclosure may include recombinant Zika virus, which may include modifications in the viral genome. In some embodiments, the recombinant Zika virus may include at least one modification in the viral genome. In some embodiments, the recombinant Zika virus may include at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20 or even more modifications in the viral genome. The modification of the viral genome may include mutations, deletions, or both of viral genes. The deletion of viral genes may include partial or complete deletions of viral genes. It should be noted that, as used herein, "partial deletions" or "mutations" may refer to partial deletions or mutations in situ of endogenous viral genes, respectively. Alternatively, they may refer to replacing endogenous viral genes with a portion of a lacking gene ("partial deletions") or with another identical exogenous nucleic acid having one or more nucleotide changes ("mutations") in a gene.

[0206] A method for generating the recombinant Zika virus described herein includes introducing the viral genome or part thereof in whole or in part into a cell, for example, in the form of two or more fragments of the desired viral genome or part thereof assembled in the cell. Non-limiting methods include cloning and amplifying nucleic acid fragments covering the viral genome or part thereof. Nucleic acid fragments or complete viral genomes can also be generated from scratch. A promoter sequence, such as a cytomegalovirus (CMV) promoter, can be inserted at the end of the first fragment. For recombinant Zika virus with a heterologous nucleic acid sequence, the sequence is fused into or adjacent to one of the fragments. In a method for producing an oncolytic virus, for example, the amplified fragment is introduced into the cell by electroporation, and the cell is then transferred to a growth medium. The cell supernatant is then recovered and stored or used to infect cells, and clarified viruses can be obtained from the culture supernatant.

[0207] Any suitable method can be used to generate genetic modification in the recombinant Zika virus described herein, including mutagenesis, polymerase chain reaction, homologous recombination, or any other genetic engineering technology available in the art. Mutagenesis includes modification of nucleotide sequence, single gene, or gene block, and involves removal, addition, and / or substitution of single or multiple nucleotide bases. In some cases, genetic modification includes using genetic recombination technology to delete or replace at least part of the natural virus sequence. For example, a polynucleotide replaces part or all of the regions of the natural virus sequence of interest. Alternatively or additionally, a polynucleotide is inserted into the natural virus sequence. The inserted polynucleotide can be functional and encodes, for example, suicide protein, therapeutic agent, and / or reporter protein. Exemplary non-limiting polynucleotides encoding reporter proteins include green fluorescent protein, enhanced green fluorescent protein, beta-galactosidase, luciferase, and HSV-tk.

[0208] Exogenous polynucleotides

[0209] In some embodiments, disclosed herein is a recombinant Zika virus comprising an exogenous polynucleotide. An exogenous polynucleotide can be a target for regulating a polynucleotide, for example, an exogenous polynucleotide target is at least 80% complementary to a regulating polynucleotide. The target can be at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to a regulating polynucleotide. An example regulating polynucleotide is a ribonucleic acid (RNA) molecule. For example, RNA is a microRNA or miRNA, and an oncolytic virus comprises a target ("target miRNA" or "target sequence") of miRNA. Non-limiting example exogenous polynucleotides as targets of miRNA are provided in the third column of Table 6A. Non-limiting example miRNAs are provided in the second column of Table 6B and Table 6A. In some embodiments, the exogenous polynucleotide is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence in column 3 of Table 6A or a complementary sequence in Table 6B. In some embodiments, the exogenous polynucleotide anneals to a polynucleotide that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence in column 2 of Table 6A. In some embodiments, the exogenous polynucleotide anneals to a polynucleotide that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a complementary sequence in Table 6B. In some embodiments, the exogenous polynucleotide comprises about 6 bases, about 9 bases, about 12 bases, about 15 bases, or about 18 bases.

[0210] The exogenous polynucleotide may be located within the oncolytic virus so that the oncolytic virus comprising the exogenous polynucleotide retains oncolytic activity. The retained oncolytic activity can be measured by in vitro or in vivo assays. The retained oncolytic activity can be at least 50%, 60%, 70%, 80%, 90%, or 100% of the oncolytic activity of an oncolytic virus without exogenous polynucleotides.

[0211] In some embodiments, the exogenous polynucleotide comprises a target of miRNA (e.g., annealed to a target of miRNA), wherein the miRNA is expressed in non-tumor cells, but is expressed at a lower level or not expressed in tumor cells. In exemplary embodiments, compared with the viral activity in tumor cells, the oncolytic virus comprising the target of miRNA has lower viral activity or no viral activity in non-tumor cells. In exemplary embodiments, compared with the oncolytic virus without the target of miRNA, the oncolytic virus comprising the target of miRNA has lower viral activity or no viral activity in non-tumor cells. In exemplary embodiments, compared with the replication in tumor cells, the oncolytic virus comprising the target of miRNA has lower replication or no replication in non-tumor cells. In exemplary embodiments, compared with the oncolytic virus without the target of miRNA, the oncolytic virus comprising the target of miRNA has lower replication or no replication in non-tumor cells. Non-limiting example miRNA is provided in the second column of Table 6A. Non-limiting example miRNA targets are provided in the third column of Table 6A. Non-limiting examples of miRNA are provided in Table 6B, from which miRNA targets can be derived.

[0212] In some embodiments, the exogenous polynucleotide is inserted into the untranslated region of the oncolytic virus. As an example, the exogenous polynucleotide is inserted into the region between the coding sequence and the 3'UTR (e.g., Figure 1D As another example, an exogenous polynucleotide is inserted into the region between the 5'UTR and the coding sequence (e.g., Figure 1C In some embodiments, the exogenous polynucleotide is inserted into the coding sequence of the nonstructural protein (e.g., Figure 1B In some embodiments, the exogenous polynucleotide is inserted between the coding sequence of the nonstructural protein and the 3'UTR (e.g., Figure 1G As shown). Non-limiting examples provide inserting a polynucleotide sequence (e.g., Figure 1F shown).

[0213] Figure 1IAA non-limiting example oncolytic virus is shown in FIG. In this figure, the exogenous polynucleotide is a miRNA target located near the 3'UTR region of the viral genetic material. However, the exogenous polynucleotide can be a target of a non-miRNA polynucleotide, such as an alternative regulatory polynucleotide. The exogenous polynucleotide can also be located elsewhere, for example, Figure 1B or Figure 1C As shown. In this example figure, the miRNA target shows selective tropism and specific replication in certain tissues. In some embodiments, the exogenous polynucleotide is a target (e.g., at least 80% complementary) of a miRNA that is highly expressed in normal tissues (such as neurons) and lowly expressed in tumor cells. Therefore, the presence of exogenous polynucleotides allows the modified oncolytic virus to replicate in tumor cells. When the endogenously expressed miRNA targets the exogenous polynucleotide sequence in the virus, the miRNA silencing of the modified oncolytic virus in non-tumor cells is achieved. Tumor cell lines that do not endogenously express miRNA allow viral replication by not targeting exogenous polynucleotide sequences. Figure 1IA-Figure 1IB This mechanism of action is shown in .

[0214] Adjustment area

[0215] In some embodiments, the recombinant Zika virus, such as an oncolytic virus described herein, comprises one or more ribozymes. Ribozymes are self-cleaving RNAs. Small ribozyme motifs are mainly divided into four types: hammerhead, hairpin, Varkud satellite (VS), and hepatitis D virus (HDV). In some embodiments, the recombinant Zika virus comprises a hammerhead ribozyme. In some embodiments, the recombinant Zika virus comprises an HDV ribozyme.

[0216] In some embodiments, the recombinant Zika virus is produced by a nucleic acid composition comprising a polynucleotide encoding one or more ribozymes. In some embodiments, the polynucleotide encodes a ribozyme upstream of the 5'UTR. In some embodiments, the ribozyme upstream of the 5'UTR is a hammerhead ribozyme. In some embodiments, the polynucleotide encodes a ribozyme downstream of the 3'UTR. In some embodiments, the ribozyme downstream of the 3'UTR is an HDV ribozyme.

[0217] How to use

[0218] On the one hand, disclosed herein is an oncolytic virus for treating or preventing one or more cancer diseases, conditions, and / or symptoms. Methods of use include contacting cancer cells with an effective amount of recombinant Zika virus as described herein. Contact can be performed in vitro (e.g., in biochemistry and / or cell assays), in non-human animals, and in mammals including humans. In some cases, contact includes making cancer cells and a composition comprising recombinant Zika virus described herein close enough so that the composition plays a role on cancer cells. Contact includes physical interactions between the composition and the cancer cells, and interactions that do not require physical interactions. Contact includes applying an effective amount of a composition comprising cancer cells to an object, so that the composition damages cancer cell growth, division, and / or induces cancer cell death. In some embodiments, contact by administration includes intravenous administration, intraperitoneal administration, intramuscular administration, intracoronary administration, intraarterial administration, subcutaneous administration, transdermal administration, intratracheal administration, subcutaneous administration, intraarticular administration, intraventricular administration, inhalation, intracerebral, intranasal, oral, pulmonary administration, catheter immersion, and direct injection into the tissue or tumor of the object.

[0219] Subjects include animals such as humans, other higher primates, lower primates, and important veterinary animals such as dogs, cats, horses, sheep, goats, and cattle, etc. Subjects also include animals used in research, such as mice, rats, and other rodents.

[0220] Provided is a method for treating cancer of a subject, the method comprising administering to the subject an effective amount of a pharmaceutical composition comprising a recombinant Zika virus as described herein. The effective amount or therapeutically effective amount of the composition is an amount sufficient to achieve the desired treatment and / or preventive effect, such as an amount that causes prevention or reduction of cancer-related symptoms. The amount of the composition applied to the subject may depend on the type and severity of the cancer and the characteristics of the individual, such as general health, age, sex, weight, and tolerance to the drug. In some embodiments, an effective amount of an oncolytic virus is applied to a subject with cancer in an amount sufficient to induce oncolysis, rupture or lysis of cancer cells, slow down, inhibit and / or reduce the growth or size of the tumor, and in some cases include the eradication of the tumor. In some embodiments, an effective amount of an oncolytic virus is applied to a subject with cancer in an amount sufficient to weaken or stop the division of cancer cells.

[0221] Treatment of cancer includes improving, curing, and / or maintaining cure (i.e., preventing or delaying recurrence) and / or its related symptoms. For example, if after receiving a therapeutic amount of the composition described herein, the object shows a reduction or absence of one or more observable and / or measurable signs and symptoms of cancer, such as a reduction in the number of cancer cells or the absence of cancer cells; reduction in tumor size; inhibition (i.e., slowing down and preferably stopping) tumor metastasis; inhibition of tumor growth to a certain extent; increased relief time and / or relief degree of one or more symptoms associated with a specific cancer; reduction in morbidity and mortality, and improvement of quality of life issues, then successfully treating the cancer of the object. Treatment also includes preventing cancer from worsening, slowing down the rate of progression, and / or preventing cancer from recurring after initial elimination. Suitable dosages and treatment regimens can vary according to the specific oncolytic virus used, the mode of delivery of the oncolytic virus, and whether it is used alone or in combination with one or more other oncolytic viruses.

[0222] In some embodiments, a method comprises administering a recombinant Zika virus as described herein to a subject having a tumor, such that tumor cell growth or proliferation is inhibited. In some cases, tumor growth or proliferation is reduced by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100%, and includes inhibiting tumor cell division and / or inducing tumor cell death.

[0223] In some embodiments, a method comprises administering a recombinant Zika virus as described herein to a subject having a tumor, so that tumor cell progression (e.g., tumorigenesis, tumor growth and proliferation, invasion and metastasis) is inhibited. In some cases, inhibiting tumor progression refers to inhibiting the development, growth, proliferation, or spread of a tumor, including but not limited to the following effects: inhibiting the growth of cells in the tumor, (2) inhibiting tumor growth to a certain extent, including slowing or complete growth arrest; (3) reducing the number of tumor cells; (4) reducing the size of the tumor; (5) inhibiting (i.e., reducing, slowing or completely stopping) the infiltration of tumor cells into adjacent peripheral organs and / or tissues; (6) inhibiting (i.e., reducing, slowing or completely stopping) metastasis; (7) increasing the survival time of a patient or patient group after tumor treatment; and / or (8) reducing the mortality rate of a patient or patient group at a given time point after tumor treatment. In some cases, tumor progression is reduced by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100%.

[0224] In some embodiments, a therapeutic benefit is achieved after administration of a recombinant Zika virus as described herein. Therapeutic benefit includes any benefit that promotes or enhances the health of a subject in terms of medical treatment of his / her condition, including treatment of precancer, cancer, and hyperproliferative diseases. For example, extending the life of a subject for any period of time, reducing or delaying tumor development of a disease, reducing hyperproliferation, reducing tumor growth, delaying metastasis, reducing cancer cell or tumor cell proliferation rate, and reducing pain in a subject that can be attributed to the subject's condition.

[0225] The pharmaceutical composition is applied to the object by the recombinant Zika virus described herein contained therein will contact the mode of the target cell.Specific approach will depend on some variables, such as cancer cells, and can be determined by skilled practitioners.The suitable method of the composition comprising the pharmaceutical composition of the present invention applied to the patient includes any in vivo administration route suitable for delivering the virus to the patient.The exemplary method of in vivo administration includes but is not limited to intravenous administration, intraperitoneal administration, intramuscular administration, intracoronary administration, intraarterial administration (for example, entering the carotid artery), subcutaneous administration, transdermal delivery, intratracheal administration, subcutaneous administration, intraarticular administration, intraventricular administration, inhalation (for example, aerosol), brain, intranasal, oral, pulmonary administration, catheter dipping, and direct injection into tissue.In the embodiment where the target cell is located in or near the tumor, the preferred administration route is to be directly injected into the tissue of the tumor or the peri-tumor.

[0226] Various routes of administration are designed for various tumor types. In the case of discrete tumor masses or solid tumors that can be identified, various direct, local and regional approaches can be taken. For example, the tumor is injected directly with the composition. The tumor bed can be treated before, during or after resection and / or one or more other treatments. After resection or one or more other treatments, the adenovirus will usually be delivered through a catheter that can enter the tumor or residual tumor site after surgery. Methods of treating cancer include treating the tumor and treating the area near or around the tumor. This includes the body cavity where the tumor is located, as well as the cells and tissues next to the tumor.

[0227] In some embodiments, the recombinant Zika viruses described herein may be suitable for systemic delivery.

[0228] In some embodiments, a recombinant Zika virus as described herein may be capable of immune evasion.

[0229] In some embodiments, systemic delivery can include oral administration, parenteral administration, intranasal administration, sublingual administration, rectal administration, transdermal administration, or any combination thereof.

[0230] In some embodiments, parenteral delivery may include intravenous injection.

[0231] In some embodiments, the recombinant Zika viruses described herein may be suitable for intratumoral delivery.

[0232] In some embodiments, a method of treating cancer may include administering to a subject a therapeutically effective amount of a recombinant Zika virus as disclosed herein, or a pharmaceutical composition as disclosed herein, wherein the method further may include administering another therapy.

[0233] In some embodiments, the another therapy may include chemotherapy, radiation therapy, oncolytic virus therapy with another virus, treatment with an immunomodulatory protein, CAR T cell therapy (chimeric antigen receptor T cell therapy), an anti-cancer agent, or any combination thereof.

[0234] Another aspect of the present disclosure provides a method of producing a toxic effect in a cancer cell, the method comprising: administering to the cancer cell a therapeutically effective amount of a recombinant Zika virus as disclosed herein. In some embodiments, the cancer cell may be present in a subject. In some embodiments, a subject may require a method of producing a toxic effect in a cancer cell.

[0235] Another aspect of the present disclosure provides a method of treating cancer in a subject, the method comprising administering a recombinant Zika virus as disclosed herein or a pharmaceutical composition comprising the same in combination with a chemotherapeutic prodrug.

[0236] Another aspect of the present disclosure provides a method for treating cancer in a subject, the method comprising: (i) administering a recombinant Zika virus as disclosed herein or a pharmaceutical composition comprising the same; (ii) determining the viral titer in first and second biological samples isolated from the subject, wherein the first biological sample may contain cancer cells and the second biological sample may contain non-cancerous cells; and (iii) if the viral titer in the second sample may be equal to or higher than the viral titer in the first sample, administering a chemotherapeutic prodrug, wherein administration of the chemotherapeutic prodrug results in inhibition of recombinant Zika virus replication in the subject.

[0237] Another aspect of the present disclosure provides a method for treating cancer in a subject, the method comprising: (i) administering a recombinant Zika virus as described herein or a pharmaceutical composition comprising the same; (ii) determining the viral titer in first and second biological samples isolated from the subject, wherein the first biological sample may contain cancer cells and the second biological sample may contain non-cancerous cells; and (iii) if the viral titer in the second sample may be equal to or higher than the viral titer in the first sample, administering a chemotherapeutic prodrug, wherein administration of the chemotherapeutic prodrug results in inhibition of replication of the recombinant Zika virus as described herein in the subject.

[0238] In some embodiments, a method of treating cancer in a subject may include administering a recombinant Zika virus as disclosed herein or a pharmaceutical composition as disclosed herein, wherein the recombinant Zika virus or pharmaceutical composition may be administered as a bolus injection or a slow infusion.

[0239] In some embodiments, a method for treating cancer in a subject may include administering a recombinant Zika virus as disclosed herein or a pharmaceutical composition as disclosed herein to a subject in need, wherein the subject may be a human. In some embodiments, a method for treating cancer in a subject may include administering a recombinant Zika virus as disclosed herein or a pharmaceutical composition as disclosed herein to a subject in need, wherein the subject has been diagnosed with cancer prior to administering the recombinant Zika virus or the pharmaceutical composition. In some embodiments, a method for treating a subject may include administering a recombinant Zika virus as disclosed herein or a pharmaceutical composition as disclosed herein to a subject in need, wherein the subject has been diagnosed with a tumor prior to administering the recombinant Zika virus or the pharmaceutical composition. In some embodiments, a method for treating cancer in a subject may include administering a recombinant Zika virus as disclosed herein or a pharmaceutical composition as disclosed herein to a subject in need in combination with another therapy, wherein the subject has been diagnosed with cancer or a tumor prior to administering the recombinant Zika virus or the pharmaceutical composition or another therapy. In some embodiments, a method for treating a subject may include administering a recombinant Zika virus as disclosed herein or a pharmaceutical composition as disclosed herein to a subject in need in combination with another therapy, wherein the subject has been diagnosed with a tumor prior to administering the recombinant Zika virus or the pharmaceutical composition or another therapy.

[0240] The present disclosure provides methods for treating a subject by administering one or more recombinant Zika viruses, as disclosed herein. "Individual" or "subject" as used interchangeably herein refers to a human or non-human subject. Non-limiting examples of non-human subjects include non-human primates, dogs, cats, mice, rats, guinea pigs, rabbits, pigs, poultry, horses, cattle, goats, sheep, cetaceans, etc. In some embodiments, the subject is a human.

[0241] A method of producing a toxic effect in a cancer cell is provided, the method comprising administering to the cancer cell a therapeutically effective amount of a recombinant Zika virus as described herein or a pharmaceutical composition comprising the same. The present disclosure further provides a method of inhibiting at least one of the growth and proliferation of a second cancer cell, the method comprising administering to a first cancer cell a recombinant Zika virus as described above, such that the first cancer cell is infected with the virus. Therefore, in some embodiments of the methods disclosed herein, it is expected that after administering a therapeutically effective amount of a recombinant Zika virus as described herein or a pharmaceutical composition comprising the same, not every cancer or tumor cell is infected, and the growth of uninfected cells can be inhibited without direct infection.

[0242] In some examples, in order to induce oncolysis, kill cells, inhibit growth, inhibit metastasis, reduce tumor size, and otherwise reverse or reduce the malignant phenotype of tumor cells, using the methods and compositions disclosed herein, cancer cells or tumors can be contacted with a therapeutically effective dose of a recombinant Zika virus as described herein or a pharmaceutical composition containing it. In certain embodiments, the effective amount of the recombinant Zika virus of the present disclosure (such as a recombinant Zika virus or its pharmaceutical composition as described herein) may include an amount sufficient to induce oncolysis, rupture or lysis of cancer cells, or inhibition or reduction of cancer cell growth or size. Reducing the growth of cancer cells can be demonstrated, for example, by a slower replication rate or a reduced growth rate of a tumor containing the cells or an extended survival of an object containing the cancer cells by cell death or a tumor containing the cells.

[0243] In some embodiments, a method for treating an object suffering from cancer or a tumor is provided, the method comprising administering to the object an effective amount of a modified virus as described above. The effective amount in this method may include an amount that reduces the growth rate or spread of cancer or prolongs the survival of the object. The present disclosure provides a method for reducing tumor growth, the method may include administering to the tumor an effective amount of a recombinant Zika virus as described above. In certain embodiments, the effective amount of a modified virus or its pharmaceutical composition may include an amount sufficient to induce a slowing down of tumor growth or size, inhibit or reduce tumor growth or size and may include the eradication of a tumor. Reducing the growth of a tumor may be demonstrated, for example, by a reduced growth rate or the prolonged survival of an object containing a tumor.

[0244] The present disclosure also provides a method for determining the infectivity or anti-tumor activity or tumor-specific viral replication amount of a recombinant Zika virus as described herein, which may include: (i) administering to a subject a therapeutically effective amount of a recombinant Zika virus as described herein or a pharmaceutical composition according to the present disclosure, which further expresses a luciferase reporter gene, alone or in combination with another therapy; (ii) collecting a first biological sample from the subject immediately after administering the virus, and determining the level of the luciferase reporter gene in the first biological sample; (iii) collecting a second biological sample from the subject after administration in step (ii), and (iii) detecting the level of the luciferase reporter gene in the second biological sample, wherein if the luciferase level in step (iii) is higher than that in step (ii), it is determined that the recombinant Zika virus as described herein is infectious, exhibits anti-tumor activity, and exhibits tumor-specific viral replication. The second biological sample is collected at about 30 minutes, about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 12 hours, about 15 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 15 days, about 1 month, to about 2 months after the administration in step (i). In some embodiments, the above method may further include, in steps (i) and (iii), detecting one or more cytokine levels (e.g., IL-2, IL-7, IL-8, IL-10, IFN-γ, GM-CSF, TNF-α, IL-6, IL-4, IL-5, and IL-13) in a plasma sample collected from the subject after administering a therapeutically effective amount of a recombinant Zika virus of the present disclosure (such as a recombinant Zika virus as described herein or a pharmaceutical composition comprising the same). In some embodiments of the present disclosure, the increase in luciferase bioluminescence between the above steps (ii) and (iv) is higher for a recombinant Zika virus as described herein, compared to an otherwise identical virus that does not comprise a modification in the recombinant Zika virus. Other exemplary techniques for detecting and monitoring viral load after administering a recombinant Zika virus include real-time quantitative PCR.

[0245] Further provided is a method for monitoring pharmacokinetics after administering a therapeutically effective amount of a recombinant Zika virus described herein according to the present disclosure (such as a recombinant Zika virus as described herein or a pharmaceutical composition comprising a Zika virus as described herein). An exemplary method for monitoring pharmacokinetics may include the following steps: (i) administering a therapeutically effective amount of a recombinant Zika virus as described herein or a pharmaceutical composition comprising the same to a subject, alone or in combination with another therapy; (ii) at about 15 minutes, about 30 minutes, about 45 minutes, about 60 minutes, about 75 minutes, about 90 minutes, about 120 minutes, about 180 minutes, and about 240 minutes, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 15 minutes ... In some cases, the viral genome copy number / mL in the sample collected at 15 minutes time point may be the highest, and the sample collected at 240 minutes time point may not include the viral genome of detectable amount. Therefore, in some cases, the viral peak can be observed at about 15 minutes after administration, and most of the viruses can be removed from the system of the object after about 240 minutes (or 4 hours). In some cases, a first viral peak can be observed after about 15 minutes after administration, and a second viral peak can be observed in a biological sample collected at a subsequent time point, such as about 30 minutes, about 45 minutes, about 60 minutes, or about 90 minutes. In an exemplary embodiment, the biological sample can be blood, and the amount of viral genomes / mL can be determined by quantitative PCR or other appropriate techniques. In some examples, a first viral peak can be observed after about 15 minutes after administration and a second viral peak can be observed after about 30 minutes, about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 12 hours, about 15 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 15 days, about 1 month, to about 2 months after administration of the recombinant Zika virus of the present disclosure.

[0246] In some cases, the tumor selective replication of recombinant Zika virus as described herein can be measured by using a reporter gene (such as a luciferase gene). In some embodiments, the luciferase gene can be inserted into the genome of the virus, and the tumor cell can be infected by the virus. The bioluminescence in the infected tumor cell can be measured to monitor tumor selective replication. Some examples show that compared with the otherwise identical Zika virus that does not include modification in the recombinant Zika virus, the luciferase reporter gene bioluminescence in the recombinant Zika virus of the present disclosure has increased.

[0247] Production method

[0248] The recombinant Zika virus of the present disclosure can be produced by methods known to those skilled in the art. In certain embodiments, the recombinant Zika virus can be propagated in suitable host cells (e.g., HeLa cells, HEK 293 cells, Aedes albopictus clone C6 / 36 cells, CHO cells or Vero cells), separated from the host cells and stored under conditions that promote viral stability and integrity, so that the loss of infectivity over time is minimized. In certain exemplary methods, a cell pile, a rolling bottle or a perfusion bioreactor are used to breed recombinant Zika virus in host cells. In some instances, the downstream method for purifying recombinant Zika virus may include filtration (e.g., depth filtration, tangential flow filtration or a combination thereof), ultracentrifugation or chromatographic capture. Recombinant Zika virus can be stored, for example, by freezing or drying, such as by lyophilization. In certain embodiments, before administration, the recombinant Zika virus of storage as described herein can be reconstructed (if dried for storage) and diluted in a pharmaceutically acceptable carrier for administration.

[0249] Some embodiments provide that the recombinant Zika virus described herein exhibits higher titers in HeLa cells, HEK293 cells, Aedes albopictus clone C6 / 36 cells, CHO cells, and Vero cells compared to an otherwise identical virus that does not comprise a modification in the recombinant Zika virus. In some cases, higher titers of the recombinant Zika virus described herein are seen in HeLa cells, HEK 293 cells, Aedes albopictus clone C6 / 36 cells, CHO cells, and Vero cells.

[0250] cancer

[0251] As used herein, cancer is a class of diseases characterized by uncontrolled cell growth. Cancer includes all types of hyperproliferative growth, hyperplastic growth, neoplastic growth, cancerous growth or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, regardless of histopathological type or stage of invasion.

[0252] In some embodiments, when applied to patients with cancer, the compositions provided herein prevent and / or reduce tumor cell growth. In some embodiments, when applied to patients with cancer, the compositions herein prevent and / or reduce tumor cell invasion. In some embodiments, when applied to patients with cancer, the compositions herein prevent and / or reduce tumor cell metastasis. In some embodiments, the compositions herein are oncolytic viruses comprising or derived from Zika virus. In some embodiments, the compositions herein are oncolytic viruses comprising recombinant Zika virus.

[0253] The types of cancer include, but are not limited to, solid tumors (such as tumors of the bladder, intestine, brain, breast, endometrium, heart, kidney, lung, liver, uterus, lymphoid tissue (lymphoma), ovary, pancreas or other endocrine organs (thyroid), prostate, retina, testis, skin (melanoma or basal cell carcinoma)) and blood tumors (such as leukemia and lymphoma) at any stage of the disease, with or without metastasis. In some embodiments, the cancer includes a brain tumor. Non-limiting examples of tumors that can be treated with the compositions provided herein include adenoma, angiosarcoma, astrocytoma, epithelial cancer, germ cell tumor, glioblastoma, glioma, hamartoma, hemangioendothelioma, angiosarcoma, hematoma, hepatoblastoma, leukemia, lymphoma, medulloblastoma, melanoma, neuroblastoma, osteosarcoma, retinoblastoma, rhabdomyosarcoma, sarcoma, and teratoma. Glioma refers to a tumor of the glial origin of the brain or spinal cord. Gliomas are derived from glial cell types, such as astrocytes and oligodendrocytes, and therefore gliomas include astrocytomas and oligodendrogliomas, as well as anaplastic gliomas, glioblastomas, and ependymomas. Additional brain tumors include meningiomas, ependymomas, pineal region tumors, choroid plexus tumors, neuroepithelial tumors, embryonal tumors, peripheral neuroblastomas, cranial nerve tumors, hematopoietic tumors, germ cell tumors, and sellar region tumors.

[0254] In embodiments of the present disclosure, it is envisioned that a method for treating hyperproliferative diseases (such as cancer or tumors) by delivering recombinant Zika virus. As described herein, the cancer that can be treated by recombinant Zika virus can include but is not limited to melanoma, hepatocellular carcinoma, breast cancer, lung cancer, peritoneal cancer, prostate cancer, bladder cancer, ovarian cancer, leukemia, lymphoma, kidney cancer, pancreatic cancer, epithelial cancer, gastric cancer, colon cancer, duodenal cancer, pancreatic adenocarcinoma, mesothelioma, glioblastoma multiforme, astrocytoma, multiple myeloma, prostate cancer, hepatocellular carcinoma, bile duct cancer, pancreatic adenocarcinoma, head and neck squamous cell carcinoma, colorectal cancer, intestinal type gastric adenocarcinoma, cervical squamous cell carcinoma, osteosarcoma, epithelial ovarian cancer, acute lymphoblastic lymphoma, myeloproliferative tumors and sarcoma.

[0255] Cancer cells that can be treated by the methods of the present disclosure include cells from the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestinal tract, gums, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testicles, tongue, or uterus. In addition, the cancer may be specifically of the following histological types, but is not limited to these: tumor, malignant; carcinoma; carcinoma, undifferentiated; giant cell carcinoma and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyps; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; bronchioloalveolar adenocarcinoma; papillary adenocarcinoma; chromophobe cell carcinoma; oncocytic carcinoma; oncocytic adenocarcinoma; basophilic cell carcinoma; clear cell adenocarcinoma; granulosa cell carcinoma; Follicular adenocarcinoma; Papillary and follicular adenocarcinoma; Nonencapsulated sclerosing carcinoma; Adrenal cortical carcinoma; Endometrioid carcinoma; Carcinoma of skin appendages; Apocrine carcinoma; Sebaceous adenocarcinoma; Cerumen carcinoma; Mucoepidermoid carcinoma; Cystadenocarcinoma; Papillary cystadenocarcinoma; Papillary serous cystadenocarcinoma; Mucinous cystadenocarcinoma; Mucinous adenocarcinoma; Signet ring cell carcinoma; Infiltrating ductal carcinoma; Medullary carcinoma; Lobular carcinoma; Inflammatory carcinoma; Paget's disease, breast; Acinar cell carcinoma; Adenosquamous carcinoma; Adenocarcinoma w / squamous metaplasia; Thymoma, malignant; Ovarian stromal tumor, malignant; Theca cell tumor, malignant; Granular cell tumor, malignant; Male blastoma, malignant; Sertoli cell carcinoma; Leydig cell tumor, malignant; Lipocytoma, malignant; Paraneural Ganglion, malignant; extramammary paraganglioma, malignant; pheochromocytoma; angiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrohistiocytoma, malignant; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant; mixed Müllerian tumor; Wilms' tumor; hepatoblastoma; carcinosarcoma; mesenchymal tumor, malignant; Brenner's tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma, malignant; dysgerminoma; embryonal carcinoma; teratoma tumor, malignant; ovarian goiter, malignant; choriocarcinoma; mesonephroma, malignant; angiosarcoma; angioendothelioma, malignant; Kaposi's sarcoma; hemangiopericytoma, malignant; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma osteosarcoma; chondrosarcoma; chondroblastoma, malignant; mesenchymal chondrosarcoma; giant cell tumor of bone; Ewing's sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma; pinealoma, malignant; chordoma; glioma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrous astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroglioma;primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant; neurofibrosarcoma; neurilemmary tumor, malignant; granular cell tumor, malignant; malignant lymphoma; Hodgkin's disease; Hodgkin's; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-Hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryocytic leukemia; myeloid sarcoma; and hairy cell leukemia. In some cases, metastatic solid cancers can be treated using the recombinant Zika viruses of the present disclosure, which facilitates systemic delivery. In some cases, inaccessible or difficult to access solid cancers, such as for the purpose of intratumoral delivery of therapeutic agents, can be treated using the recombinant Zika viruses of the present disclosure, which facilitates systemic delivery. In some examples, cancers associated with increased free fatty acid expression can be treated using the recombinant Zika viruses of the present disclosure, which facilitates systemic delivery and formation of increased amounts of EEV. ;

[0256] The present disclosure also contemplates methods for suppressing or preventing local invasion or metastasis or both of any type of primary cancer. For example, the primary cancer may be melanoma, non-small cell lung, small cell lung, lung, liver cancer, retinoblastoma, astrocytoma, glioblastoma, gums, tongue, leukemia, neuroblastoma, head, neck, breast, pancreas, prostate, kidney, bone, testis, ovary, mesothelioma, cervix, gastrointestinal tract, lymphoma, brain, colon or bladder. In certain embodiments, the primary cancer may be lung cancer. For example, the lung cancer may be non-small cell lung cancer. In addition, the present disclosure may be used to prevent cancer or treat precancerous or precancerous cells, including metaplasia, dysplasia and hyperplasia. It may also be used to suppress undesirable but benign cells, such as squamous metaplasia, dysplasia, benign prostatic hyperplasia cells, hyperplastic lesions, etc. In some embodiments, the progression of cancer or more serious forms of cancer may be stopped, interrupted, or delayed by methods disclosed herein involving recombinant Zika viruses.

[0257] In some embodiments, the cancer is brain cancer, retinal cancer, testicular cancer, or prostate cancer. In some specific embodiments, the brain cancer is astrocytoma, oligodendroglioma, ependymoma, meningioma, schwannoma, craniopharyngioma, germ cell tumor, pineal cell tumor, or a combination thereof.

[0258] Dosage and treatment regimen

[0259] The frequency of administration of a pharmaceutical composition comprising a recombinant Zika virus provided herein can vary based on the method being performed, the physical characteristics of the subject, the severity of the cancer, the type of cancer, and the formulation and method used to administer the composition.

[0260] The duration of treatment will be based on the condition being treated and can be determined by the attending physician. In many cases, the duration of administration varies depending on many factors. Exemplary factors include, but are not limited to, patient response, symptom severity, and cancer type. In some conditions, treatment lasts for days, weeks, or months. In other conditions, complete treatment is achieved by administering one, two, or three doses of the pharmaceutical composition throughout the treatment process. In some aspects, complete treatment can be achieved using a single dose of the pharmaceutical composition.

[0261] In certain embodiments where the patient's condition does improve, the dose of the recombinant Zika virus described herein or a pharmaceutical composition thereof being administered may be temporarily reduced or temporarily suspended for a period of time (ie, a "drug holiday").

[0262] In certain embodiments, the dose of the administered composition is temporarily reduced or temporarily suspended for a period of time (ie, "drug shift").

[0263] In some embodiments, once the patient's condition improves, a maintenance dose is administered (if necessary). Subsequently, in certain embodiments, depending on the symptoms, the dosage, or the frequency of administration, or both are reduced to a level that retains the improved disease, disorder, or condition. However, in certain embodiments, if there is any recurrence of symptoms, the patient requires long-term intermittent treatment.

[0264] The amount of the recombinant Zika virus provided herein varies according to factors such as the specific virus, the disease condition and its severity, the identity of the subject in need of treatment (e.g., weight, sex), but can still be determined based on the specific circumstances surrounding the case. In some embodiments, the desired dose is conveniently provided in a single dose, or in divided doses administered simultaneously (or over a short period of time) or at appropriate intervals (e.g., in two, three, four or more sub-doses per day).

[0265] In some embodiments, administration of a recombinant Zika virus provided herein is dependent on titer, and the titer of the recombinant Zika virus is about 10 5 PFU / mL to about 10 10 PFU / mL.

[0266] In some embodiments, the amount of a recombinant Zika virus of the present disclosure administered to a subject can be about 10 3 and 10 12Infectious virus particles or plaque forming units (PFU).

[0267] In some embodiments, the recombinant Zika virus of the present disclosure may contain about 10 3 Virus particles / dose to about 10 14 The dose is administered at a rate of 1 viral particle / dose.

[0268] In some embodiments, the recombinant Zika virus of the present disclosure may contain about 10 3 PFU / kg to about 10 14 PFU / kg dose was administered.

[0269] In some embodiments, the recombinant Zika virus of the present disclosure may contain about 10 3 Virus particles / kg to about 10 14 The dose was 100 virus particles / kg.

[0270] Pharmaceutical compositions and formulations

[0271] Provided herein is a recombinant Zika virus formulated into a pharmaceutical composition. The pharmaceutical composition is prepared in a conventional manner using one or more pharmaceutically acceptable inactive ingredients, which promote the processing of active agents into pharmaceutically usable preparations. A summary of the pharmaceutical composition described herein can be found, for example, in: Remington: The Science and Practice of Pharmacy, 19th edition (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, HA and Lachman, L., ed., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY, 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, 7th edition (Lippincott Williams & Wilkins, 1999), which is incorporated herein by reference for this disclosure. For some viral delivery methods, a pharmaceutically acceptable vehicle is selected from known pharmaceutically acceptable vehicles for delivery, and should be a vehicle in which the virus is stable.

[0272] Further provided herein are pharmaceutical compositions comprising: a virus; a pharmaceutically acceptable inactive ingredient; other medicinal or pharmaceutical agents; a carrier; an adjuvant; a preservative, stabilizer, wetting agent or emulsifier; a solution promoter; a salt; a buffer; an excipient; a binder; a filler; a suspending agent; a flavoring agent; a sweetener; a disintegrant; a dispersant; a surfactant; a lubricant; a colorant; a diluent; a solubilizer; a wetting agent; a plasticizer; a penetration enhancer; an antifoaming agent; an antioxidant; a preservative; or a combination thereof.

[0273] Another aspect of the present disclosure provides a pharmaceutical composition comprising a recombinant Zika virus as described herein. In some embodiments, the pharmaceutical composition may include a solubilizer and an excipient. In some embodiments, the excipient may include one or more of the following: a buffer, a stabilizer, an antioxidant, an adhesive, a diluent, a dispersant, a rate controller, a lubricant, a glidant, a disintegrant, a plasticizer, a preservative, or any combination thereof. In some embodiments, the excipient may include disodium hydrogen phosphate dihydrate, sodium dihydrogen phosphate dihydrate, sodium chloride, inositol, sorbitol, or any combination thereof. In some embodiments, the pharmaceutical composition does not include a preservative. In some embodiments, the pharmaceutical composition may include one or more of a preservative, a diluent, and a carrier. In some embodiments, the pharmaceutical composition may include additional active ingredients or salts thereof. In some embodiments, the solubilizer may be sterile water. In some embodiments, the pharmaceutical composition may include additional active ingredients, wherein the additional active ingredient may be another oncolytic virus.

[0274] Another aspect of the present disclosure provides a method for enhancing the therapeutic effect of an oncolytic virus when the virus is delivered systemically to a subject, the method comprising systemically administering a recombinant Zika virus as disclosed herein, a recombinant Zika virus as described herein, or a pharmaceutical composition as disclosed herein.

[0275] Pharmaceutical compositions containing modified viruses (such as recombinant Zika viruses described herein) can be prepared as solutions, dispersions in glycerol, liquid polyethylene glycol, oils, solid dosage forms, inhalable dosage forms, intranasal dosage forms, liposome formulations, dosage forms comprising nanoparticles, dosage forms comprising microparticles, polymer dosage forms, or any combination thereof. In some embodiments, pharmaceutical compositions as described herein may include stabilizers and buffers. In some embodiments, pharmaceutical compositions as described herein may include solubilizers, such as sterile water, Tris buffer. In some embodiments, pharmaceutical compositions as described herein may include excipients. Excipients may be excipients described in Handbook of Pharmaceutical Excipients, American Pharmaceutical Association (1986). Non-limiting examples of suitable excipients may include buffers, preservatives, stabilizers, binders, compacting agents, lubricants, chelating agents, dispersion enhancers, disintegrants, flavoring agents, sweeteners, colorants.

[0276] In some embodiments, the excipient may be a buffer. In some embodiments, the excipient may include a preservative. Non-limiting examples of suitable preservatives may include antioxidants and antimicrobial agents. In some embodiments, the pharmaceutical composition as described herein may include a binder as an excipient. In some embodiments, the pharmaceutical composition as described herein may include a lubricant as an excipient. In some embodiments, the pharmaceutical formulation may include a dispersion enhancer as an excipient. In some embodiments, the pharmaceutical composition as described herein may include a disintegrant as an excipient. In some cases, the pharmaceutical composition as described herein may include a chelating agent.

[0277] Combination products comprising one or more of the recombinant Zika viruses described herein are also contemplated.

[0278] Under normal storage and use conditions, pharmaceutical compositions as described herein may contain preservatives to prevent microbial growth. In some instances, pharmaceutical compositions as described herein may not contain preservatives. Pharmaceutical forms suitable for injection use may include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injection solutions or dispersions. Prevention of microbial action can be achieved by various antibacterial and antifungal agents.

[0279] For example, for parenteral administration in the aqueous solution, if necessary, liquid dosage forms can be appropriately buffered, and the liquid diluent can be made isotonic with enough saline or glucose.Liquid dosage forms are particularly suitable for intravenous, intramuscular, subcutaneous, intratumoral and intraperitoneal administration.In this respect, according to the present disclosure, the sterile aqueous medium that can be adopted will be known to those skilled in the art.For example, a dosage can be dissolved in 1mL to 20mL isotonic NaCl solution, and added to the fluid (for example, sodium bicarbonate buffered saline) of 100mL to 1000mL, or injected into the infusion site of suggestion.

[0280] In certain embodiments, the recombinant Zika virus according to the present disclosure, the recombinant Zika virus as described herein, or a pharmaceutical composition containing it can be mixed with various other ingredients listed above (as required) in a suitable solvent in the required amount, followed by filtration sterilization to prepare a sterile injection solution. Generally speaking, dispersions are prepared in the following manner: various sterilization active ingredients are mixed into a sterile vehicle, the vehicle containing a basic dispersion medium and other ingredients required from those ingredients listed above. Compositions disclosed herein can be formulated into neutral or salt forms. After preparation, the pharmaceutical composition can be administered in a manner compatible with dosage formulations and in a therapeutically effective amount.

[0281] In certain embodiments, the pharmaceutical composition of the present disclosure may include an effective amount of the recombinant virus disclosed herein in combination with a pharmaceutically acceptable carrier. "Pharmaceutically acceptable" as used herein includes any carrier that does not interfere with the effectiveness of the biological activity of the active ingredient and / or is nontoxic to the patient to which it is applied. Non-limiting examples of suitable pharmaceutical carriers include phosphate buffered saline, water, emulsions (such as oil / water emulsions), various types of wetting agents and sterile solutions. Other non-limiting examples of drug-compatible carriers may include gels, bioabsorbable matrix materials, implant elements containing recombinant Zika virus or any other suitable vehicle, delivery or distribution tools or materials. Such carriers can be prepared by conventional methods and can be applied to objects in effective amounts.

[0282] Reagent test kit

[0283] In one aspect of the present disclosure, provided herein is a kit comprising one or more reagents or devices for performing the methods disclosed herein. In some embodiments, the kit comprises a recombinant Zika virus provided herein. In some embodiments, the kit comprises a device for administering a recombinant Zika virus provided herein.

[0284] In some embodiments, the kit includes suitable instructions for performing the methods of the kit. The instructions can provide information for performing any method disclosed herein, whether or not the methods can be performed using only the reagents provided in the kit. The kit and instructions may require additional reagents or systems.

[0285] In order to use in the therapeutic applications described herein, kits and articles are also described herein. In some embodiments, such kits include carriers, packaging or containers, which are separated to accommodate one or more containers, such as vials, tubes, etc., each of which includes one of the individual elements to be used in the methods described herein. Suitable containers include, for example, bottles, vials, syringes and test tubes. The container can be formed by a variety of materials such as glass or plastic. The articles provided herein contain packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, blister packages, bottles, tubes, inhalers, pumps, bags, vials, containers, syringes, bottles, and any packaging materials suitable for selected formulations and the predetermined mode of administration and treatment. The one or more containers optionally have a sterile access port (for example, the container is an intravenous solution bag or a vial with a stopper that can be pierced by a hypodermic needle). Such kits optionally include compositions and identification descriptions or labels or instructions related to their use in the methods described herein.

[0286] The kit will typically include one or more additional containers, each container having one or more of the various materials (such as reagents, optionally in concentrated form, and / or devices) that are desirable from a commercial and user perspective for using the recombinant Zika virus described herein. Non-limiting examples of such materials include, but are not limited to, buffers, diluents, fillers, needles, syringes; carriers, packaging, containers, vials, and / or tube labels listing the contents and / or instructions for use, and package inserts with instructions for use. A set of instructions is also typically included.

[0287] In some embodiments, the label is on or associated with the container. The label can be on the container when the letters, numbers, or other characters forming the label are attached, molded, or etched into the container itself; the label can be associated with the container, such as as a package insert, when the label is present in a receiver or carrier that also holds the container. The label can be used to indicate that the contents are used for a specific therapeutic application. The label can also indicate instructions for using the contents, such as in the methods described herein.

[0288] In certain embodiments, the pharmaceutical composition comprising the recombinant Zika virus provided herein and an optional additional active agent is present in a package or dispenser device that may contain one or more unit dosage forms. The package may, for example, contain metal or plastic foil, such as a blister package. The package or dispenser device may be accompanied by instructions for use. The package or dispenser may also be accompanied by a container-related notice in a form specified by a government agency for the manufacture, use or sale of a prescribed pharmaceutical preparation, the notice embodies the form of the drug approved by the agency for human or veterinary administration. For example, such a notice may be a drug label approved by the U.S. Food and Drug Administration, or an approved product insert. A composition containing the recombinant Zika virus described herein formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled with a condition indicated for treatment.

[0289] Non-limiting numbered embodiments

[0290] (1) A method for treating cancer, the method comprising administering a recombinant Zika virus to a subject in need thereof. (2) The method of embodiment 1, wherein the recombinant Zika virus produces a higher level of subgenomic flaviviral RNA (sfRNA) in the subject's cancer cells than wild-type Zika virus. (3) The method of embodiment 1, wherein the higher level of sfRNA is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100% higher. (4) The method of the preceding embodiments, wherein the cancer is brain cancer, retinal cancer, testicular cancer, breast cancer, or prostate cancer. (5) The method of embodiment 4, wherein the brain cancer is an astrocytoma, oligodendroglioma, ependymoma, meningioma, schwannoma, craniopharyngioma, germ cell tumor, pineal cell tumor, or a combination thereof. (6) A method as described in the preceding embodiments, wherein the recombinant Zika virus is produced by a nucleic acid composition comprising a polynucleotide encoding a Zika virus capsid protein ancC / C or a derivative of the Zika virus ancC / C, a polynucleotide encoding a Zika virus viral membrane protein (prM / M) or a derivative of the Zika virus prM / M, a polynucleotide encoding a Zika virus viral envelope protein E or a derivative of the Zika virus E, or any combination thereof. (7) A method as described in embodiment 6, wherein the nucleic acid composition comprises a polynucleotide encoding the Zika virus ancC / C or a derivative of the Zika virus ancC / C, a polynucleotide encoding the Zika virus prM / M or a derivative of the Zika virus prM / M, and a polynucleotide encoding the Zika virus E or a derivative of the Zika virus E. (8) The method of embodiment 7, wherein the polynucleotide encoding the Zika virus ancC / C or the derivative of the Zika virus ancC / C, the polynucleotide encoding the Zika virus prM / M or the derivative of the Zika virus prM / M, and the polynucleotide encoding the Zika virus E or the derivative of the Zika virus E are expressed on one or more independent nucleic acids. (9) The method of one of embodiments 6-8, wherein the polynucleotide encoding the derivative of the Zika virus ancC / C comprises at least one substitution, at least one deletion, and / or at least one insertion compared to wild-type Zika virus ancC / C. (10) A method as described in embodiment 9, wherein the Zika virus ancC / C or a derivative of the Zika virus ancC / C comprises an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of Table 1.(11) The method of one of embodiments 6-8, wherein the polynucleotide encoding the derivative of Zika virus prM / M comprises at least one substitution, at least one deletion, and / or at least one insertion compared to wild-type Zika virus prM / M. (12) The method of embodiment 11, wherein the Zika virus prM / M or the derivative of Zika virus prM / M comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of Table 2. (13) The method of one of embodiments 6-8, wherein the polynucleotide encoding the derivative of Zika virus E comprises at least one substitution, at least one deletion, and / or at least one insertion compared to wild-type Zika virus E. (14) The method of embodiment 13, wherein the polynucleotide encoding E is translated into wild-type Zika virus E type. (15) The method of embodiment 13 or 14, wherein the Zika virus E or the derivative of Zika virus E comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of Table 3. (16) The method of one of embodiments 6-15, wherein the nucleic acid composition further comprises the 5' untranslated region (5'UTR) of the Zika virus. (17) The method of one of embodiments 6-16, wherein the nucleic acid composition further comprises the 3' untranslated region (3'UTR) of the Zika virus. (18) A method as described in any one of embodiments 6-17, wherein the nucleic acid composition does not contain polynucleotides encoding one or more non-structural (NS) proteins selected from (i) NS1, (ii) NS2A, (iii) NS2B, (iv) NS3, (v) NS4A, (vi) NS4B, (vii) NS5, or (viii) (i)-(vii) two or more of the following. (19) A method as described in any one of embodiments 6-17, wherein the nucleic acid composition contains polynucleotides encoding one or more non-structural (NS) proteins selected from (i) NS1, (ii) NS2A, (iii) NS2B, (iv) NS3, (v) NS4A, (vi) NS4B, (vii) NS5, or (viii) (i)-(vii) two or more of the following.(20) A method as described in one of embodiments 18-19, wherein the NS1 is Zika virus NS1, the NS2A is Zika virus NS2A, the NS2B is Zika virus NS2B, the NS3 is Zika virus NS3, the NS4A is Zika virus NS4A, the NS4B is Zika virus NS4B, or the NS5 is Zika virus NS5, or any combination of two or more thereof. (21) A method as described in one of embodiments 6-20, wherein the components of the nucleic acid composition comprise African Zika virus components, Asian Zika virus components, or Brazilian Zika virus components, or a combination thereof. (22) A method as described in embodiment 21, wherein the Zika virus is an African MR766 strain. (23) A method as described in one of embodiments 6-22, wherein the components of the nucleic acid composition are expressed on one or more separate nucleic acids. (24) A method as described in one of embodiments 6-23, wherein the nucleic acid further comprises one or more operably linked expression control elements that confer expression of the nucleic acid composition in vitro or in vivo. (25) A method as described in embodiment 24, wherein the expression control element is a promoter that drives the expression of the nucleic acid composition in vitro. (26) A method as described in embodiment 25, wherein the promoter is T7, T3, SP6 or any phage promoter. (27) A method as described in embodiment 24, wherein the expression control element is a promoter that drives the expression of the nucleic acid composition in a target cell. (28) A method as described in embodiment 27, wherein the promoter is CMV, SV40 or any eukaryotic promoter. (29) A method as described in embodiment 27, wherein the target cell is a neuron or non-neuronal cell, Vero, CHLA, COS, CHO, C6 / 36, HeLa, HEK, or HepG2. (30) A method as described in embodiment 27, wherein the target cell is an oligodendrocyte, a microglia, or an astrocyte. (31) The method of one of embodiments 6-30, wherein the recombinant Zika virus is produced by expressing the nucleic acid composition in a producer cell, wherein the producer cell is further infected with a second Zika virus such that the Zika virus C or a derivative of the Zika virus C, the Zika virus prM / M or a derivative of the Zika virus prM / M, and the Zika virus E or a derivative of the Zika virus E are present in the recombinant Zika virus. (32) The method of embodiment 31, wherein the second Zika virus is a wild-type Zika virus. (33) The method of embodiment 32, wherein the wild-type Zika virus is an African, Asian, and Brazilian strain. (34) The method of embodiment 31, wherein the second Zika virus is a modified Zika virus. (35) The method of embodiment 34, wherein the modified Zika virus comprises one or more microRNA-based gene silencing mechanisms.(36) The method of embodiment 35, wherein the one or more microRNA-based gene silencing mechanisms control viral replication. (37) The method of one of embodiments 6-30, wherein the recombinant Zika virus produced by expressing the nucleic acid composition in a production cell is free of infection by a second Zika virus, wherein the Zika virus C or a derivative of the Zika virus C, the Zika virus prM / M or a derivative of the Zika virus prM / M, and the Zika virus E or a derivative of the Zika virus E are present in the recombinant Zika virus or the Zika virus-like particle. (38) The method of one of embodiments 31-37, wherein the production cell is a Vero E6 or C6 / 36 cell. (39) The method of one of embodiments 6-38, wherein the recombinant Zika virus is replication-competent. (40) The method of one of embodiments 6-38, wherein the recombinant Zika virus is replication-incompetent and does not reduce vector titer or impair expression of exogenous polynucleotides. (41) The method of one of embodiments 6-40, wherein the recombinant Zika virus has reduced insertion mutations. (42) The method of any one of embodiments 6-41, wherein the recombinant Zika virus has a reduced immune response. (43) The method of embodiment 2, wherein the recombinant Zika virus produces higher levels of subgenomic flaviviral RNA (sfRNA) in the cancer cells of the subject than wild-type Zika virus through the presence of microRNA (miRNA) of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or a combination thereof. (44) The method of any one of embodiments 1-43, wherein the recombinant Zika virus comprises an exogenous polynucleotide. (45) The method of embodiment 44, wherein the exogenous polynucleotide anneals to a miRNA present in the subject. (46) The method of embodiment 45, wherein the miRNA is present in a non-cancerous cell of the subject. (47) The method of embodiment 45 or embodiment 46, wherein the miRNA is selected from Table 6B. (48) The method of any one of embodiments 45-47, wherein the exogenous polynucleotide is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence of Table 6A. (49) The method of any one of embodiments 45-47, wherein the exogenous polynucleotide comprises a sequence, wherein the sequence is at least 70% identical to the complement of a miRNA sequence of Table 6B.(50) A method as described in any one of embodiments 44-49, wherein the Zika virus comprises a nucleic acid encoding a 2k protein, and the exogenous polynucleotide is located within the nucleic acid encoding the 2k protein. (51) A method as described in any one of embodiments 6-49, wherein the Zika virus comprises a 5'UTR and a sequence encoding one or more structural proteins, and the exogenous polynucleotide is located between the 5'UTR and the sequence encoding the one or more structural proteins. (52) A method as described in any one of embodiments 44-49, wherein the Zika virus comprises a 5'UTR, and the exogenous polynucleotide is located downstream of the 5'UTR. (53) A method as described in any one of embodiments 44-49, wherein the Zika virus comprises a 3'UTR and a sequence encoding one or more non-structural proteins, and the exogenous polynucleotide is located between the 3'UTR and the sequence encoding the one or more structural proteins. (54) A method as described in any one of embodiments 44-49, wherein the Zika virus comprises a 3'UTR, and the exogenous polynucleotide is located upstream of the 5'UTR. (55) The method of any one of embodiments 54, wherein the exogenous polynucleotide is located between the coding region of the wild-type Zika virus and the 3'UTR. (56) The method of any one of embodiments 16-55, wherein the 5'UTR comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 6 or SEQ ID NO: 239. (57) The method of any one of embodiments 17-55, wherein the 3'UTR comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to any one of SEQ ID NO:7, SEQ ID NO:241, or SEQ ID NO:244. (58) The method of any one of embodiments 44-55, wherein the sequence encoding one or more nonstructural proteins comprises a sequence that is at least 70% identical to any one of SEQ ID NO:240, SEQ ID NO:243, SEQ ID NO:245, SEQ ID NO:247, SEQ ID NO:248, or SEQ ID NO:249. (59) The method of any one of embodiments 44-55, wherein the Zika virus further comprises a noncoding region.(60) The method of embodiment 59, wherein the noncoding region comprises a sequence that is at least 70% identical to any one of SEQ ID NO:238, SEQ ID NO:242, SEQ ID NO:246, or ACTGAT. (61) The method of any one of embodiments 44-60, wherein the Zika virus further comprises at least one ribozyme. (62) The method of embodiment 60, wherein the at least one ribozyme comprises hammerhead, HDV, or a combination thereof. (63) The method of embodiment 44, wherein the recombinant Zika virus comprises at least one copy of the exogenous polynucleotide. (64) The method of any one of embodiments 1-63, wherein administering to a subject in need thereof comprises introducing the recombinant Zika virus via intraventricular injection. (65) The method of any one of embodiments 1-63, wherein the subject is a mammal.

[0291] Example

[0292] Example 1: Design and generation of recombinant Zika virus particles

[0293] The recombinant Zika virus genome was cloned into a plasmid. Viral RNA was produced by in vitro transcription. The viral RNA was transfected into Vero cells. Recombinant Zika virus was produced and released in the culture supernatant. Figure 4A and Figure 4B As shown, recombinant Zika virus derived from in vitro transcription and Vero cell transfection maintains its oncolytic effect in medulloblastoma cell lines 48 hours after infection. Example Engineered Zika virus was generated from a Brazilian Zika virus strain. Viral RNA was designed based on genomic sequences deposited in the MH882527.1 (ZIKV-17) and KU365780.1 (ZIKV-IEC) databases. The ZIKV viral genome containing 10,806 base pairs was obtained by DNA synthesis service (GenScript). In addition to the complete ZIKV genome, the virus was designed to contain the following additional items to improve the efficiency of the modified virus generation process: (a) a hammerhead ribozyme upstream of the 5'UTR; (b) an HDV ribozyme downstream of the 3'UTR; and (c) a T7 promoter. Figure 1A is an example schematic of this construct, which was cloned into the bacmid pCC1, for a total of 21.8 kb.

[0294] The T7 promoter allows in vitro transcription (RNA synthesis in a test tube) derived from plasmid DNA. This method is considered to improve the quality of the final product by avoiding viral mutation and attenuation (which may occur after continuous infection). Another eukaryotic promoter, CMV, is also considered in genetic engineering strategies to improve the production efficiency of RNA during in vitro transcription. In this way, the production of active virus concentrates is carried out by in vitro transcription of linearized plasmids and transfection (insertion) of the RNA into Vero cells or another pedigree of interest.

[0295] Once the viral RNA is transfected (inserted) into the cell, the ribozyme allows for the automatic cleavage of the viral RNA, thereby automatically releasing the ZIKV RNA. Once the viral RNA comes into contact with the host cell's translation machinery, it produces a polyprotein that will be cleaved, thereby producing structural proteins (which will be part of the viral particle) and non-structural proteins (responsible for genomic viral replication).

[0296] After replication, encapsulation occurs, releasing modified and active Zika virus. The efficiency of the process was initially confirmed by clear observation of cytopathic effect (cell destruction or damage, thereby confirming the presence of viral activity). Analysis of the presence of Zika NS1 protein was also performed by chromatographic testing. Subsequently, other analytical tests were performed, such as titration (PFU) of active viral particles and copies (RT-qPCR) of viral RNA.

[0297] Genetically engineered (or recombinant) viruses are also designed to allow for the insertion of foreign sequences into the virus without altering the oncolytic ability of the virus. Figure 1B-Figure 1D Example viruses are shown in which foreign nucleotides are inserted into the coding region of the 2k protein ( Figure 1B ), after the 5'UTR but before the coding sequence ( Figure 1C ), and before the 3'UTR but after the coding sequence ( Figure 1D ).

[0298] Figure 1E-1G An example schematic diagram of an engineered virus having an exogenous polynucleotide located within the 2k coding sequence and before the 3'UTR is provided ( Figure 1G ). Figure 3A Examples of designing miRNA target insertion sequences and restriction sites for miR-219a-2-3p at three exemplary modification regions (2k, 5'UTR, and 3'UTR) are provided. Figure 3B-Figure 3E As shown, additional miRNA targets of miR-219a-5p, miR-129-5p, miR-1225-5p, miR-377-p were also tested, respectively.

[0299] An initial set of miRNAs of interest were identified based on their expression levels in different patient tissues, and the initial miRNA sequences are presented in Tables 6A-6B. The miRNAs were inserted into reporter plasmids and expression analysis was performed on seven glioblastoma cell lines (A172, C343, HCB151, U138, U251, U87, LN18), five CNS embryonic tumor cell lines (medulloblastoma: HDM03, Daoy, P13; ATRT: CHLA06 and P7), three normal human lines (mesenchymal: M12 and M10; neural progenitor cells: NPC) and Vero cells (kidney epithelial cells derived from African green monkeys), which were used to generate modified viruses. As Figure 2A-2F As shown, the expression level of each miRNA in various tumor cell lines using TaqMan RT-qPCR shows the feasibility of targeting miR-219a-2-3p, miR-219a-5p, miR-129-5p and miR-377-3p (Table 6A) with target sequences in recombinant Zika virus. The target sequences of these four miRNAs were then inserted into the model plasmid. MiR-1225-5p was included as a negative control. Example 3 provides additional details.

[0300] Table 6A. Tested miRNAs and corresponding SEQ ID NOs are in parentheses.

[0301]

[0302] Table 6B. Exemplary miRNA sequences for use as regulatory polynucleotides.

[0303]

[0304]

[0305]

[0306]

[0307] Example 2: Oncolysis in Medulloblastoma and Glioblastoma Cells Following Infection with Recombinant Zika Virus Particles

[0308] Oncolytic effects in both glioblastoma and medulloblastoma cell lines were evaluated in vitro. Briefly, cell viability of medulloblastoma and glioblastoma cell lines U138MG, U251MG, U343MG, ONS-76, Daoy was measured using a cell growth kinetics assay using the xCELLigence real-time cell system (Agilent) in the presence or absence of recombinant Zika virus particles. Figure 5AAs shown, the viability of glioblastoma cells (U138MG, U251MG, and U343MG cell lines) and medulloblastoma cells (ONS-76 and Daoy cell lines) was inhibited after infection with recombinant Zika virus at an MOI of 2 when compared to control (CT). Figure 5B As shown, infection with recombinant Zika virus (oZIKV-0p) induced higher oncolysis in the Daoy medulloblastoma cell line when compared with infection with African wild-type Zika virus.

[0309] Example 3. Oncolytic effect of recombinant Zika particles

[0310] Confirmation of RNA replication and translation inhibition after insertion of miRNA sequences

[0311] Model assays were performed to demonstrate inhibition of RNA replication and translation following insertion of miRNA target sequences. These assays used a small reporter plasmid instead of the complete ZIKV genome, which is a model system for studying the ZIKV genome before modifying viruses containing the complete ZIKV genome. A reporter plasmid containing some of the ZIKV structure (5'UTR, capsid, 3'UTR) was used to insert the modified region containing the miRNA target sequence ( Figure 6 ).

[0312] After selecting the desired miRNA sequence for the assay, a plasmid construct with recombinant Zika virus protein was synthesized. Figure 6 A representative construct of a replicon plasmid (pRep) is shown, which has a portion of the ZIKV genome (NS4B, 2k, NS4A) and a reporter sequence (NanoLuciferase or "NanoLuc"). The BswiI site was introduced into pRep to replace HA (hemagglutinin), which was performed by fusion PR (overlap extension PCR). The region between the T7 promoter and HA (in the middle of the 2k region) and the 3'UTR were amplified. The amplicon (2.2kb) is necessary because there are no unique restriction sites in this region. In order to minimize mutations, a high-fidelity Taq polymerase was used. In this vector, the target is cloned directly. For each target sequence, a pair of partially complementary oligomers were designed to recombinant target sequences (miRNA seeds) and restriction sites for cleavage. The resulting constructs are presented in Table 7. The integration of the miRNA target (or seed) insert was confirmed via sequencing. Some plasmids showed two or more copies of the insert of interest. All variants were tested in cells to assess the relationship between the number of copies present in the plasmid and the regulatory effect of the miRNA.

[0313] Table 7. Different plasmids with selected miRNAs and corresponding sequencing details (e.g., target (or seed) copy number)

[0314] pREPID miRNA Sequencing details 1c 129-5p 1 target copy le 129-5p 2 copies of target 2b 219a-2-3p 1 target copy 3a 219a-5p 1 target copy 3d 219a-5p 5 copies of target 4c 377-3p 1 target copy 4e 377-3p 2 target copies / region with low specificity pRep 0 Use empty plasmid as control

[0315] After generating plasmids containing the target sequence, transfections were performed in Vero cells and CHLA cells to observe the inhibition of plasmid expression by the NanoLuc reporter gene. To confirm the inhibitory effect of the inserted sequence, miRNA expression modulation (overexpression and inhibition of endogenous miRNA) was performed to observe the reversal of the effect, as shown in Figures 7 and Figure 8 The detection of clones whose translation was silenced in Vero (1d / 1c) and CHLA06 (4c) indicated the potential of several sequences to silence the entire ZIKV genome (pCC 1 clones), since the mimic miRNA was in fact able to inhibit NanoLuc translation by pairing with the inserted target sequence (Figures 7 and Figure 8 ). In addition, absolute silencing was observed in clone 1c, as the luminescence difference was not significant compared to the baseline of untransfected cells (Figure 7). Therefore, clone 1c exhibited approximately 100% efficiency.

[0316] In the CHLA-06-ATRT tumor cell line, transfection of the control miRNA altered the translation of NanoLuc, even in empty pRep, which interfered with the analysis of the results. However, after miRNA overexpression, comparison of NanoLuc translation of the miRNA control showed upregulation in all clones ( Figure 8 ).

[0317] To confirm its efficiency, a second assay was performed on CHLA-06-ATRT transfected with a miRNA inhibitor. The goal was to inhibit the endogenous miRNA of the cell and thus observe an increase in NanoLuc translation. Figure 8 As shown, inhibition of endogenous miRNA had the effect of increasing NanoLuc translation when compared to the control. Thus, miR-129-5p target sequence inhibition was confirmed. Among the miR-129-5p clones (1c and 1e), the one with the strongest regulatory effect was 1c, which had only one copy of the target sequence.

[0318] Generation of several oZIKV candidates

[0319] An oZIKV (oncolytic ZIKV) candidate with the complete ZIKV genome in a low-copy plasmid (PCC1-ZIKVBR) was generated. Fig. 9 A representative plasmid containing the ZIKV genome, ribozyme, and T7 promoter at 2000 base pairs of the 5'UTR is shown. Fig.10 ), a combination of BsiWI and XhoI sites ( Fig.11 ) and AarI site ( Fig.12) Insert the miRNA target into the 5'UTR region of different plasmids. Different pCC1-ZIKV constructs were synthesized with at least a T7 promoter, a hammerhead ribozyme, a miRNA target insert, a region (all or part) of the ZIKV genome, and a 3'UTR. The constructs are generally presented in Table 8. Fig.13 is a representative image of plasmid 013 (Table 8), which has the complete ZIKV genome, the ribozyme at its ends, the T7 promoter 800 base pairs from the 5'UTR, and the modification inserted in the 2k region. Fig.14 is a representative image of plasmid 014, which has the complete ZIKV genome, the ribozyme at its ends, the T7 promoter 800 base pairs from the 5'UTR, and the modification inserted in the 3'UTR. Fig.15 is a representative image of plasmid 017, which has the complete ZIKV genome, the ribozyme at its end, the T7 promoter next to the 5'UTR, and the modification inserted into the 5'UTR.

[0320] Table 8. Recombinant Zika virus constructs in pCC1-ZIKV vector.

[0321]

[0322] Table 9A. Composition of recombinant Zika virus constructs in the pCC1-ZIKV vector of Table 8, wherein each construct comprises a promoter, a noncoding region, a 5'UTR, a coding region, a 3'UTR, a miRNA target flanked by two restriction sites. SEQ ID NOs are presented in brackets.

[0323]

[0324]

[0325] Table 9B. Sequences of the vectors in Table 9A.

[0326]

[0327]

[0328]

[0329]

[0330]

[0331]

[0332]

[0333]

[0334]

[0335]

[0336]

[0337]

[0338]

[0339]

[0340]

[0341]

[0342]

[0343]

[0344]

[0345]

[0346]

[0347]

[0348]

[0349]

[0350]

[0351]

[0352]

[0353]

[0354]

[0355]

[0356]

[0357]

[0358]

[0359]

[0360]

[0361]

[0362]

[0363]

[0364]

[0365]

[0366]

[0367]

[0368]

[0369]

[0370]

[0371]

[0372]

[0373]

[0374]

[0375]

[0376]

[0377]

[0378]

[0379]

[0380] Viral RNA was generated by in vitro transcription. Figure 4A Viral RNA was transfected into Vero cells via electroporation using the protocol described in . Recombinant Zika virus was produced and released in the culture supernatant. RNA transcripts produced and released into the supernatant were analyzed and visualized using RNA electrophoresis. T7-HIGH kit (New England) (where samples were pretreated with DNase) and HiScribe TMT7 ARCA mRNA kit (with tailing; ThermoFisher) was used for analysis. Fig.16 RT-qPCR was performed to compare the amount of ZIKV genome viral copies produced at different time intervals, as shown. Fig.17 As shown. The amount of ZIKV copies / μL in the cell pellet and supernatant was compared. The amount of ZIKV copies / μL in the Vero cell pellet was quantified at 24h, 48h, 72h, and 96h after transfection. The amount of ZIKV copies in the supernatant was quantified at 24h and 72h after transfection. Intact RNA (beginning (black) and end (grey)) was observed in the culture supernatant.

[0381] Transfection of viral RNA was accomplished by co-transfection with lipofectamine (a CMV promoter) and electroporation with an initial RNA amount of about 10 μg to about 35 μg RNA. After concentrating the virus, the culture was then reinfected in another T25 to enable observation of viral production ( Fig.18 ).

[0382] like Fig.18 As shown, Vero cells transfected with modified ZIKV RNA were observed after 1 day, 4 days, 5 days and 6 days (DPI) after infection. Images marked with (*) show obvious cytopathic effects of ZIKV RNA on cell populations. Cells transfected with samples TI_15 (pCC1-ZIKV-3P-T7), TI_16 (pCC1-ZIKV-0P-T7), TI_17 (pCC1-ZIKV-2P-T7) and TI_18 (pCC1-ZIKV-3P-T7) showed cell death after 5DPI, while cells transfected with TI_14 showed cell death after 6DPI. During the establishment of the in vitro transcription protocol, 24 RNA products were produced. All RNAs produced were transfected, and eight modified viruses were produced so far. Fig.18 The course of virus production compared to the negative control is shown. Starting from the fourth day after reinfection, a cytopathic effect (production of infectious virus) could be observed in all RNAs tested (TI_14, TI_15, TI_16, TI_17, TI_18).

[0383] To confirm the presence of the virus, a chromatographic test was used to identify the ZIKV NS1 protein in the culture supernatant. Fig.19 As shown, two positive bars (one control, "C" and one test, "T") indicated the presence of ZIKV in the supernatant.

[0384] Oncolytic activity and safety in normal cells

[0385] Virus safety was tested in neural progenitor cells (NPC) derived from iPS human cells. The Go / No-go phenotype test using tumor cell lines to examine oncolysis was used to determine virus safety. After tumor and non-tumor virus infection, supernatant samples were collected to evaluate viral replication by using RT-qPCR quantitative RNA copies, and viral diffusion was evaluated by plaque assay (PFU) to quantify the amount of infectious virus. The results are shown in Table 10 and Table 11.

[0386] Table 10. Different recombinant Zika virus constructs and effects on cell titers.

[0387]

[0388] *: 0-30; **: 30-50; ***: >50

[0389] Table 11. Effects of different recombinant Zika virus particles on tumor cells (CHLA, DAOY) and normal cells (neural progenitor cells, "NPC"), as quantified by RT-PCR and PFU.

[0390]

[0391] Oncolysis - Tumor Cell Lines

[0392] Cell viability assay was performed to confirm the oncolytic effect of the eight modified viruses. Fig. 20A ) and 5DPI( Fig. 20B ) and then tested the cells. Fig. 20A A luciferase-based ATP-dependent assay (CELLTITER 2.0 cell viability assay, PROMEGA) results. Fig. 20B As shown, different recombinant Zika virus particles have different effects on cell viability as evaluated using a trypan blue exclusion assay. The results confirmed the oncolytic effects of several samples (including ZIKV_4, ZIKV_14, ZIKV_17, and ZIKV_18). When compared to wild-type viruses, recombinant Zika viruses ZIKV_4 and ZIKV_18 showed higher oncolytic effects.

[0393] Security

[0394] After confirming the oncolytic effects of several recombinant Zika viruses, the safety of using these recombinant Zika viruses was tested in NPC cells, such as Fig.21As shown. NPCs were imaged at 5DPI. When compared to the control (simulation), ZIKV_4 and ZIKV_18 strains did not exhibit significant cytotoxic effects on NPCs. As a second control, wild-type Zika virus exhibited cytotoxic effects on NPCs. Recombinant Zika virus ZIKV_17 had significant cytotoxic effects on NPCs, but to a lesser extent than wild-type Zika virus. Therefore, ZIKV_4 and ZIKV_18 strains exhibited oncolytic effects on CHLA tumor cells, while exhibiting little or no cytotoxic effects on normal NPCs.

[0395] Neurosphere analysis was performed on NPCs transfected with wild-type and recombinant Zika viruses, as shown in FIG22 . Fig.22A The measured neurosphere areas of different NPCs are shown, and Fig. 22B The girth of different NPCs is shown.

[0396] miRNA regulation: a replication repression system

[0397] Based on the miRNA expression profiles of the cell lines and the infection / safety of the Zika candidates, we tested the effectiveness of selective inhibitory mechanisms based on microRNA regulation for controlling viral replication. To this end, we overexpressed the corresponding miRNAs to observe viral inhibition and increased tumor cell viability. Fig.23 It was shown that ZIKV_14 was oncolytic in tumor cells and safe (equivalent to mock) in NPC and could be regulated by miR-219a-2-3p overexpression. Fig.23 Shown are cell viability analyses in Daoy cells and CHLA cells with recombinant ZIKV14 viral miRNA overexpression following viral infection, relative to negative controls. These results suggest that ZIKV_14 is oncolytic and safe in NPC.

[0398] Example 4: Spectrum of action of recombinant Zika virus

[0399] Using the same assay as described above, the viability of tumor and non-tumor cells was tested in a virus concentration curve of MOI 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, 0.002 after ZIKV 14 infection. The tumor cell lines tested included hCMEC, Hs1.Tes, Daoy, ONS, ATRT, glioblastoma, prostate, triple negative breast tumor cells, colon tumor cells, and luminal breast tumor cells. Cells were plated in 96-well plates with an initial seeding density of 2x10 3cells / well. After 24 h, wild-type Zika virus, recombinant Zika virus, or mock were added to the cells in a final volume of 20 μL. After incubating the cells at room temperature for 30 min, wild-type Zika virus, recombinant Zika virus, or mock were removed and replaced with 100 μL of fresh medium. Live cells were determined at 3 DPI using the PROMEGA 2.0 cell viability assay (PROMEGA). Eight replicates were run for each cell line.

[0400] The results of the assay are Figure 24-Figure 34 Presented in. Fig.24 It was shown that recombinant Zika virus (ZIKV14) did not reduce cell viability in brain microvessels (hCMEC cell line), demonstrating the safety of ZIKV14 when compared to wild-type ZIKV. Fig.25 The ability of recombinant Zika virus (ZIKV14) and wild-type ZIKV to reduce cell viability of microglia (hMC3 cell line) is shown. Fig.26 It was shown that recombinant Zika virus (ZIKV14) and wild-type ZIKV did not reduce the cell viability of testicular cancer (Hs1.Tes cell line). Fig.30 It was shown that ZIKV14 was more potent in oncolysis in glioblastoma cell lines (U138 and LN18) when compared to ZIKV wild type. Figure 27-Figure 29 We showed that infection with recombinant Zika virus (ZIKV14) reduced cell viability when compared to wild-type ZIKV in embryonal CNS tumors, medulloblastoma (DAOY and ONS), and ATRT (CHLA-06-ATRT). Figure 31-Figure 34 showed that infection with ZIKV14 and wild-type ZIKV reduced prostate cancer (DU-145 cell line) ( Fig.31 ) and triple-negative breast tumors (MDA-MB-231 cell line) ( Fig.32 ) but not in the MCF7 cell line (luminal breast cancer) ( Fig.34 ) and hCT-8 cell lines (colon tumor) ( Fig.33 ) is not tumor lytic.

[0401] Example 5: Mouse Model

[0402] ZIKV_14 was validated in in vivo models of nervous system tumors (orthotopic and metastatic). Fig.35 The modified Zika virus (ZIKV14) was shown to be able to stabilize tumor growth, reduce tumor progression, and even eradicate tumor sites. In addition, the modified Zika virus was able to inhibit the development of axonal metastases and eliminate pre-existing tumor metastases ( Fig.35Briefly, Balb / c nude mice were administered tumor cells that had or had not metastasized axonally. In the control group, mice received intracerebroventricular (icv) vehicle of mock or wild-type Zika virus. The icv injection (6 x 10 3 Other mice were treated with ZIKV14 at 100 PFU and monitored. Images were collected before treatment (T0), 7 days after treatment (T1), and 14 days after treatment (T2) with recombinant ZIKV14.

[0403] Table 5. Additional example sequences

[0404]

[0405]

[0406]

[0407]

[0408]

[0409]

[0410]

[0411] The foregoing only illustrates the principle of the present disclosure. It should be understood that those skilled in the art will be able to envision various arrangements, although these arrangements are not explicitly described or shown herein, they embody the principle of the present invention and are included in its spirit and scope. In addition, all embodiments and conditional language cited herein are mainly intended to help readers understand the principle of the present disclosure and the conception of promoting technology provided by the inventor, and should be interpreted as not limiting such particularly cited embodiments and conditions. In addition, all statements citing the principles, aspects and embodiments of the present invention and its specific embodiments herein are intended to cover their structural equivalents and functional equivalents. In addition, it is intended that such equivalents include currently known equivalents and equivalents developed in the future, that is, regardless of the structure, any element developed to perform the same function. Therefore, the scope of the present disclosure is not intended to be limited to the exemplary embodiments shown and described herein. On the contrary, the scope and spirit of the present disclosure are embodied by the appended claims.

Claims

1. A nucleic acid comprising a Zika virus 5' untranslated region (5'UTR), a sequence complementary to a regulatory polynucleotide, and a Zika virus 3' untranslated region (3'UTR), wherein the regulatory polynucleotide comprises (i) miR-219a-2-3p, hsa-miR-377-3p, hsa-miR-1225-5p, hsa-miR-4298, hsa-miR-219a-5p, or hsa-miR-129-5p, (ii) a sequence that is at least 80% identical to a sequence of Table 6A or Table 6B, or (iii) (i) and (ii).

2. The nucleic acid of claim 1, wherein the sequence complementary to the regulatory polynucleotide comprises CCGACCTGT, AAAAACGCC, AAACGCCAG, GGCGTTTT, CTAACAGGT, TAACAGGTT, ACTAACAGG, ACCCTGTCC, CACCCATGC, CCCATGCCG, ACCCATGCC, AGTGTGTTT, CTTAACACC, TTAACACCG, CTTAACAGC, or TGCCGGTCA, or a combination of two or more thereof.

3. The nucleic acid of claim 1 or claim 2, wherein the 5'UTR is at least 80% homologous or identical to SEQ ID NO: 239 (AGTTGTTACTGTTGCTGACTCAGACTGCGACAGTTCGAGTTTGAAGCGAAAGCTAGCAACAGTATCAACAGGTTTTATTTGGATTTG GAAACGAGAGTTTCTGGTC).

4. The nucleic acid of any one of claims 1 to 3, wherein the 3'UTR is identical to SEQ ID NO: 241 (TAAGCACCAATCTTAATGTTGTCAGGCCTGCTAGTCAGCCAC AGCTTGGGGAAAGCTGTGCAGCCTGTGACCCCCCCAGGAGAAGCTGGGAAACCAAGCCTATAGTCAGGCCGAGAACGCCATGGCACGGAAGAAGCCATGCTGCCTGTGAGCCCCTCAGAGGACACTGAGTCAAAAAACCCCACGCGCTTGGAGGCGCAGGATGGGAAAAGAAGGTGGCGACCTTCCCCACCCTTCAATCT GGGGCCTGAACTGGAGATCAGCTGTGGATCTCCAGAAGAGGGACTAGTGGTTAGAGGAGACCCCCCGGAAAACGCAAAACAGCATATTGACGCTGGGAAAGACCAGAGACTCCATGAGTTTCCACCACGCTGGCCGCCAGGCACAGATCGCCGAATAGCGGCGGCCGGTGGGGAAATCCATGGGTCT) is at least 80% homologous or identical.

5. The nucleic acid of claim 1 or claim 2, wherein the 5'UTR is selected from the Zika virus of Table 12 and the 3'UTR is selected from the Zika virus of Table 13.

6. The nucleic acid of any one of claims 1-5, wherein the regulatory polynucleotide is expressed in non-cancerous cells, optionally wherein the regulatory polynucleotide has higher expression in non-cancerous cells compared to cancer cells in a subject.

7. The nucleic acid of any one of claims 1 to 6, wherein the regulatory polynucleotide is a micro-mRNA.

8. A nucleic acid as described in any one of claims 1 to 7, wherein the length of the sequence complementary to the regulatory polynucleotide is between 9 nucleotides and 22 nucleotides, optionally about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

9. A nucleic acid comprising: (a) Zika virus 5' untranslated region (5'UTR); (b) a polynucleotide encoding at least one Zika virus structural protein selected from the group consisting of capsid protein (ancC / C), membrane protein (prM / M) and envelope protein (E); and / or a polynucleotide encoding at least one Zika virus non-structural protein selected from the group consisting of NS1, NS2A, NS2B, NS3, NS4A, 2k peptide, NS4B, and NS5; (c) Zika virus 3' untranslated region (3'UTR); and (d) a sequence complementary to a regulatory polynucleotide; in: (i) the nucleic acid comprises the polynucleotide encoding at least one Zika virus non-structural protein, and the polynucleotide encoding the at least one Zika virus non-structural protein comprises the polynucleotide encoding the 2k peptide, wherein the sequence complementary to the regulatory polynucleotide is located within the polynucleotide encoding the 2k peptide; (ii) the nucleic acid comprises the polynucleotide encoding at least one Zika virus non-structural protein, and the polynucleotide encoding the at least one Zika virus non-structural protein comprises a polynucleotide encoding the NS4A and a polynucleotide encoding the NS4B, and a sequence complementary to the regulatory polynucleotide is located between the polynucleotide encoding the NS4A and the polynucleotide encoding the NS4B; (iii) a sequence complementary to the regulatory polynucleotide is located between the 5'UTR and the polynucleotide encoding at least one Zika virus structural protein and / or the polynucleotide encoding at least one Zika virus non-structural protein; and / or (iv) a sequence complementary to the regulatory polynucleotide is located between the 3'UTR and the polynucleotide encoding at least one Zika virus structural protein and / or the polynucleotide encoding at least one Zika virus non-structural protein.

10. A nucleic acid as described in claim 9, wherein the nucleic acid comprises the polynucleotide encoding at least one Zika virus non-structural protein, and the polynucleotide encoding the at least one Zika virus non-structural protein comprises a polynucleotide encoding the 2k peptide, wherein the sequence complementary to the regulatory polynucleotide is located within the polynucleotide encoding the 2k peptide.

11. A nucleic acid as described in claim 9, wherein the nucleic acid comprises the polynucleotide encoding at least one Zika virus non-structural protein, and the polynucleotide encoding the at least one Zika virus non-structural protein comprises a polynucleotide encoding the NS4A and a polynucleotide encoding the NS4B, and the sequence complementary to the regulatory polynucleotide is located between the polynucleotide encoding the NS4A and the polynucleotide encoding the NS4B.

12. The nucleic acid of claim 9, wherein the sequence complementary to the regulatory polynucleotide is located between the 5'UTR and the polynucleotide encoding at least one Zika virus structural protein and / or the polynucleotide encoding at least one Zika virus non-structural protein.

13. The nucleic acid of claim 9, wherein the sequence complementary to the regulatory polynucleotide is located between the 3'UTR and the polynucleotide encoding at least one Zika virus structural protein and / or the polynucleotide encoding at least one Zika virus non-structural protein.

14. The nucleic acid of any one of claims 9-13, wherein the 5'UTR is at least 80% homologous or identical to SEQ ID NO:

239.

15. The nucleic acid of any one of claims 9-14, wherein the 3'UTR is at least 80% homologous or identical to SEQ ID NO:

241.

16. The nucleic acid of any one of claims 9-15, wherein the 5'UTR is selected from the Zika virus of Table 12, and the 3'UTR is selected from the Zika virus of Table 13.

17. A nucleic acid as described in any one of claims 9 to 16, wherein the nucleic acid comprises the polynucleotide encoding at least one Zika virus structural protein, and the nucleic acid comprising the polynucleotide encoding at least one Zika virus structural protein comprises: a polynucleotide encoding the capsid protein (ancC / C), a polynucleotide encoding the membrane protein (prM / M), and a polynucleotide encoding the envelope protein (E).

18. A nucleic acid as described in any one of claims 9 to 17, wherein the nucleic acid comprises the polynucleotide encoding at least one Zika virus non-structural protein, and the polynucleotide encoding at least one Zika virus non-structural protein comprises: a polynucleotide encoding the NS1, a polynucleotide encoding the NS2A, a polynucleotide encoding the NS2B, a polynucleotide encoding the NS3, a polynucleotide encoding the NS4A, a polynucleotide encoding the 2k peptide, a polynucleotide encoding the NS4B, and a polynucleotide encoding the NS5.

19. The nucleic acid of any one of claims 9-18, wherein the regulatory polynucleotide is expressed in non-cancer cells, optionally wherein the regulatory polynucleotide has higher expression in non-cancer cells compared to cancer cells in the subject.

20. The nucleic acid of any one of claims 9-19, wherein the regulatory polynucleotide is a micro-mRNA.

21. A nucleic acid as described in any of claims 9-20, wherein the length of the sequence complementary to the regulatory polynucleotide is between 9 nucleotides and 22 nucleotides, optionally about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

22. A recombinant Zika virus produced by the nucleic acid of any one of claims 1-21.

23. The recombinant Zika virus of claim 22, wherein the recombinant Zika virus is an oncolytic Zika virus having oncolytic activity.

24. A recombinant Zika virus comprising a polynucleotide complementary to a regulatory polynucleotide comprising (i) miR-219a-2-3p, hsa-miR-377-3p, hsa-miR-1225-5p, hsa-miR-4298, hsa-miR-219a-5p, or hsa-miR-129-5p, (ii) a sequence that is at least 80% identical to a sequence in Table 6A or Table 6B, or (iii) (i) and (ii).

25. The recombinant Zika virus of claim 24, wherein the sequence complementary to the regulatory polynucleotide comprises CCGACCTGT, AAAAACGCC, AAACGCCAG, GGCGTTTT, CTAACAGGT, TAACAGGTT, ACTAACAGG, ACCCTGTCC, CACCCATGC, CCCATGCCG, ACCCATGCC, AGTGTGTTT, CTTAACACC, TTAACACCG, CTTAACAGC, or TGCCGGTCA, or a combination of two or more thereof.

26. The recombinant Zika virus of claim 24 or claim 25, wherein the recombinant Zika virus is an oncolytic Zika virus having oncolytic activity.

27. A method of treating cancer in a subject in need thereof, the method comprising administering to the subject the recombinant Zika virus of any one of claims 22-26.

28. The method of claim 27, wherein the cancer is a central nervous system (CNS) cancer.

29. The method of claim 28, wherein the CNS cancer is brain cancer.

30. The method of claim 29, wherein the brain cancer is an astrocytoma, oligodendroglioma, ependymoma, meningioma, schwannoma, craniopharyngioma, germ cell tumor, or pineal cell tumor.

31. The method of claim 27, wherein the cancer is breast cancer, prostate cancer, colon cancer, retinal cancer, or testicular cancer.

32. The method of any one of claims 27-31, wherein the recombinant Zika virus does not infect and / or replicate in non-cancerous cells of the subject; or wherein the recombinant Zika virus infects and / or replicates less in non-cancerous cells of the subject than in cancer cells of the subject.

Images