Plant trichome development regulation gene NtJAZ11, its coding protein, expression vector and application thereof

Abstract

This invention discloses a gene regulating plant glandular trichome development. NtJAZ11, This application aims to address the current technical problem of unclear developmental mechanisms and lack of effective regulatory methods and utilization pathways for glandular trichomes and protective trichomes in plants (such as tobacco). The gene encoding this gene, its expression vector, and its applications are described. NtJAZ11 Overexpression and gene-editing vectors were constructed, and corresponding overexpression and gene-editing lines were obtained through transformation. Subcellular localization, tissue expression, MeJA response pattern analysis, and plant phenotypic identification showed that... NtJAZ11‑2 It can negatively regulate the development of tobacco glandular hairs, and has important application value in regulating the development of plant epidermal hairs.

Description

Technical Field

[0001] This invention application relates to the field of bioengineering technology, specifically to a gene regulating plant glandular trichome development. NtJAZ11 Its encoded proteins, expression vectors, and applications. Background Technology

[0002] Epidermal trichomes are specialized hair-like appendages extending from the epidermal tissue of most plant above-ground parts. They not only protect plants from biotic and abiotic stresses but also have high economic and medicinal value. Epidermal trichomes are classified into two types based on their secretory capacity: glandular trichomes and non-glandular trichomes (protective trichomes). Glandular trichomes are distributed on the surface of stems, leaves, floral organs, and even fruits, producing glandular secretions that enhance resistance to biotic and abiotic stresses, earning them the title of "biosynthetic factories." As an important component of epidermal trichomes, the secondary metabolites produced by glandular trichomes play a crucial role in improving the aroma quality of tobacco leaves and resisting external stresses. Non-glandular trichomes play an important role in enhancing plant stress resistance.

[0003] Epidermal trichomes, a natural barrier for plants to defend against external damage, are induced by jasmonic acid (JA). JA is an important natural plant endogenous hormone involved in controlling plant growth, development, and stress responses. JA regulation of epidermal trichomes primarily relies on the degradation of JAZ proteins to restore the activity of downstream transcription factors, thereby regulating trichome development. The regulatory network of the JA signaling pathway is complex and diverse. JAZ, as a core component, regulates downstream related transcription factors to balance plant physiological activities and defense responses, such as root and stem growth, chlorophyll degradation, anthocyanin accumulation, and stress tolerance. bHLH transcription factors are important downstream regulatory genes in the JA signaling pathway and also participate in epidermal trichome development. For example, Arabidopsis thaliana AtMYC1 affects epidermal trichome density. Tomato SlMYC1 activates JA-mediated formation of type VI glandular trichomes in tomatoes. Cucumber CsMYC2 acts as a negative regulator in glandular trichome formation.

[0004] In addition, other genes related to the JA pathway are also involved in the formation and development of plant epidermal trichomes. (Arabidopsis thaliana) AtMYB82 It positively regulates the development of epidermal hairs. AaGL3-like JA induces positive regulation of Artemisia annua epidermal hair density; AaMIXTA1 It affects the initiation of artemisia annua glandular trichomes, and AaHD8 / AaMIXTA1 Able to form complexes to promote AaHD1 Gene expression regulates the formation of Artemisia annua trichomorphs. SlHD8-SlJAZ4 As a key module, it mediates JA signals to promote the elongation of tomato trichomes;SlWo Positively regulates the density of type I epidermal hairs in tomatoes, while SlCycB2 As Wo Downstream genes are involved in the formation of trichomes on the tomato epidermis. Heterologous expression of genes from snapdragons... MIXTA and MIXTA-like This leads to a significant increase in the density of epidermal hairs on tobacco leaves and stems, and... MIXTA The gene is homologous to the cotton ovule gene. CotMYB After being transferred into tobacco, it increases the density of its epidermal hairs. (This is from Benedict's tobacco.) NbWo and NbCycB2 It forms a negative feedback regulatory loop to regulate glandular hair development. NtHD-ZIP-IV-1 As Wo The homologous gene responds to jasmonic acid-induced trichomes in tobacco. NtHD9 and NtHD12 Regulates the development of glandular trichomes in tobacco stalks via the JA signaling pathway. NtHD8 The interaction between these two factors also affects the density of the glandular hairs on the tobacco stalk. NtCycB2 Regulates glandular hair production via the jasmonic acid pathway, while NtCycB2 and NtJAZ1 Gene co-knockout can increase glandular hair density and promote glandular head development.

[0005] Methyl jasmonate (MeJA) is a derivative of jasmonic acid (JA) and is often used to replace JA to enhance plant resistance to biotic and abiotic stresses. Currently, the developmental mechanism of glandular trichomes in common tobacco is unclear, and there is a lack of effective regulatory methods and utilization pathways. Furthermore, research on its involvement in responding to MeJA-mediated glandular trichome development and alkaloid synthesis is limited.

[0006] The information disclosed in this background section is intended only to enhance the understanding of the background technology of this disclosure and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0007] The purpose of this invention application is to provide a gene regulating plant glandular trichome development. NtJAZ11 The aim is to construct overexpression and gene editing vectors and transform plants using these vectors, in order to solve the current technical problems of unclear development mechanism of common tobacco glandular trichomes and lack of effective regulation methods and utilization pathways, thereby achieving the goal of targeted improvement of plant glandular trichome types and / or increasing the content of glandular trichome secretions.

[0008] The first aspect disclosed in this application provides a gene for regulating plant glandular trichome development. NtJAZ11 Its nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0009] A second aspect of this application discloses a protein encoding a protein whose amino acid sequence is shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0010] A third aspect of this application discloses an expression vector containing the aforementioned plant glandular trichome development regulatory gene. NtJAZ11 Or a fragment thereof.

[0011] In some embodiments of this application, the expression vector is an overexpression vector pCAMIA2300-GFP- for plant genetic transformation. NtJAZ11-1 and pCAMIA2300-GFP- NtJAZ11-2 Gene editing vectors NtJAZ11-1 -CasPF and NtJAZ11-2 - Any of the CasPF types.

[0012] The fourth aspect disclosed in this application discloses the plant glandular trichome development regulatory gene. NtJAZ11 Its encoded proteins or expression vectors are used to create plant materials with different glandular hair densities.

[0013] The fifth aspect disclosed in this application discloses the plant glandular trichome development regulatory gene. NtJAZ11 Alternatively, expression vectors may be used to regulate plant glandular hair density or / and protect hair density traits.

[0014] The sixth aspect disclosed in this application discloses the plant glandular trichome development regulatory gene. NtJAZ11 Alternatively, expression vectors may be used in the selection and breeding of plant varieties / lines related to glandular hair density and / or the protection of hair density traits.

[0015] In some embodiments of this application, based on the plant glandular trichome development regulatory gene NtJAZ11 The open reading frame sequence was used to construct an overexpression vector by combining the CaMV35S promoter and the reporter gene GFP. This overexpression vector was then transformed into recipient plants and cultured to obtain plant materials with significantly reduced glandular hair density in both long-stalked and short-stalked plants and significantly increased protective hair density.

[0016] In some embodiments of this application, the plant glandular trichome development regulatory gene is used. NtJAZ11 The fragment TCCTCAATACCTCTCTTTCAAGG at position 126-148 bp in the open reading frame sequence was used as the target site. A gene editing vector was constructed, transformed into recipient plants, and cultured to obtain plant materials with significantly increased density of long-stalked and short-stalked glandular hairs.

[0017] In some embodiments of this application, the recipient plant is tobacco.

[0018] One or more technical solutions provided in the embodiments of this application have at least one of the following technical effects or advantages:

[0019] 1. A plant glandular trichome-specific expression gene was screened and identified. NtJAZ11 Based on the phenotypic and physiological characteristics of its overexpression and knockout lines, identification and detection studies have shown that... NtJAZ11-2 It can negatively regulate the development of long-stalked and short-stalked glandular trichomes in tobacco, and has important application value in regulating the increase of glandular trichome secretion content and directionally improving glandular trichome type.

[0020] 2. This application relates to genes regulating glandular trichome development. NtJAZ11 Cloning and functional studies have revealed the regulatory mechanisms of glandular hair and protective hair growth and development, and provided ways to utilize them in agricultural production. Attached Figure Description

[0021] Figure 1 As shown in one embodiment of this application NtJAZ11-1 and NtJAZ11-2 Agarose gel electrophoresis results, protein sequence alignment, and phylogenetic tree analysis.

[0022] Figure 2 As shown in one embodiment of this application NtJAZ11-1 and NtJAZ11-2 Relative expression levels in different tissues of tobacco.

[0023] Figure 3 As shown in one embodiment of this application NtJAZ11-1 and NtJAZ11-2 Expression analysis of responses after treatment with different concentrations of MeJA.

[0024] Figure 4 As shown in one embodiment of this application NtJAZ11-1 and NtJAZ11-2 Subcellular localization map of the fusion protein.

[0025] Figure 5 As shown in one embodiment of this application NtJAZ11-2 Image showing the results of screening and identification of overexpression lines.

[0026] Figure 6 As shown in one embodiment of this application NtJAZ11-2 The sequence analysis results of the gene-edited homozygous strain are shown in the figure.

[0027] Figure 7 As a control strain in one embodiment of this application, NtJAZ11-2 Observation and statistical data of leaf epidermal hair morphology of overexpression lines and gene-edited lines.

[0028] Figure 8 This represents the relative expression level of genes related to glandular trichomeogenesis in one embodiment of this application.

[0029] above Figure 7 , Figure 8 In the middle, K326 is used as a control. NtJAZ11 -OE4 is an overexpression strain; NtJAZ11 -KO13 is a gene-edited strain. Detailed Implementation

[0030] The specific embodiments of the present invention will be described below with reference to the accompanying drawings and examples. However, the following examples are only used to illustrate the present invention in detail and do not limit the scope of the present invention in any way.

[0031] Unless otherwise specified, the plasmid vectors used in the following examples are all conventional commercial vectors; the biochemical reagents used are all commercially available conventional reagents; and the test and detection methods used are all conventional methods unless otherwise specified.

[0032] Preliminary research for this application found that, NtJAZ11 It is expressed in tissues such as tobacco epidermis and hairs, and is activated by MeJA. Therefore, the inventors homologously cloned... NtJAZ11 Gene sequence, completed NtJAZ11 Bioinformatics analysis clarified its location in the cell membrane and nucleus, and identification was performed using tobacco transgenic materials. NtJAZ11 It participates in regulating the development of tobacco glandular trichomes. Implementation of this application will contribute to clarifying... NtJAZ11 The gene function in the formation and development of tobacco glandular trichomes is studied, and the theoretical and material basis for the later creation of tobacco materials with different glandular trichome densities is provided.

[0033] Example 1: NtJAZ11 Gene cloning and bioinformatics analysis

[0034] This case utilizes homologous cloning technology, based on the Solanaceae genome website genome sequence, and uses the first strand of cDNA synthesized from total RNA reverse transcription of common tobacco K326 leaves as a template to amplify for the first time the gene negatively regulating glandular trichome development in K326. NtJAZ11 Two homologous sequences NtJAZ11-1 (Nitab4.5_0001264g0110.1) and NtJAZ11-2 (Nitab4.5_0002046g0020.1) (see) Figure 1 ),in, NtJAZ11-1 The coding region is 1143 bp in length and encodes 380 amino acids. (后续内容请根据实际需求继续翻译或补充完整) The coding region is 1182 bp in length, encoding 393 amino acids. The nucleotide similarity between the two is 92.81%, and the amino acid sequence similarity is 89.31%. Protein multiple sequence alignment results indicate that... NtJAZ11-2 and NtJAZ11-1All of them contain the typical TIFY and Jas domains of JAZ proteins.

[0035] The cloned NtJAZ11 protein sequence was compared with homologous proteins from various plants using multiple sequence alignment. NtJAZ11-2 The results show that: Figure 1 Possibly derived from parental fluffy tobacco NtJAZ11-1 The two are 100% similar. NtomJAZ11 Possibly from parent tobacco forests NtJAZ11-2 The similarity between the two was 94.4%. Two genes were found in the TN90 genome of Burley tobacco. NsylJAZ11 Homologous genes, NtJAZ11 and NtJAZ11-1 , TN90JAZ11-1 The similarities were 96.69% and 83.91%, respectively. TN90JAZ11-2 and NtJAZ11-2 , TN90JAZ11-1 The similarities were 89.31% and 100%, respectively. Two copies were also present in the aromatic tobacco basil. TN90JAZ11-2 and NtJAZ11-1 , BXJAZ11-1 The similarities were 96.69% and 89.57%, respectively. BXJAZ11-2 and NtJAZ11-2 , BXJAZ11-1 The similarities were 89.31% and 99.75%, respectively. In Benzoic tobacco, BXJAZ11-2 1 , NtJAZ11- and NtJAZ11-2 The similarity was 88.3% for both species. Compared to other species, NbJAZ11 , NtJAZ11-1 With tomatoes NtJAZ11-2 Artemisia annua SlNtJAZ11 Arabidopsis thaliana AaNtJAZ11 The similarities were 74.52%, 27.16%, and 30.29%, respectively. These results indicate that... AtNtJAZ11 The gene is highly conserved across different types and varieties of cultivated tobacco, and is similar to that in Nicotiana benthamiana. NtJAZ11 It is closely related to tomatoes, artemisia, and Arabidopsis.

[0036] Organizational expression pattern analysis revealed ( NbJAZ11 ), Figure 2 and NtJAZ11-1 It is expressed in the roots, stems, leaves, flowers, and epidermal hairs of tobacco. NtJAZ11-2 and NtJAZ11-1 The relative expression levels of this gene showed a consistent trend across different tobacco tissues, with the highest expression level in leaves, followed by epidermal hairs, stems, and flowers, and the lowest expression level in roots, indicating that the gene exhibits tissue-specific expression. NtJAZ11-2 The relative expression levels in the above tissues were all higher than NtJAZ11-2The above results indicate that... NtJAZ11-1 It may play a more crucial role in the growth and development of tobacco.

[0037] Treatment with different concentrations of MeJA revealed ( NtJAZ11-2 ), Figure 3 and NtJAZ11-1 The expression level gradually increased, first rising and then decreasing over time, reaching its highest level 3 hours after treatment. The results indicate that... NtJAZ11-2 Strongly influenced by MeJA, and MeJA's influence on... NtJAZ11 The effects of gene induction are time-sensitive.

[0038] Subcellular localization assay results showed that ( NtJAZ11 ), Figure 4 and NtJAZ11-1 They can be located in the cell nucleus and cell membrane, respectively.

[0039] Example 2: NtJAZ11- Acquisition of genetically modified materials

[0040] This example constructs pCAMIA2300-GFP- (后续内容请根据实际需求继续翻译或补充完整) overexpression vectors and NtJAZ11-2 Gene-editing vectors were introduced into tobacco through leaf disc transformation.

[0041] First, 8 positive plants were obtained by PCR screening ( NtJAZ11-2 ), using qRT-PCR analysis to find NtJAZ11-2-CasPF The expression level of the target gene in the -OE4 strain was 5.83 times that of K326. The progeny of this single plant and its T1 generation were selected for further in-depth gene function analysis.

[0042] Secondly, using hygromycin screening and sequencing, 9 T0 generation plants were obtained from 20 positive plants. Figure 5 Gene-edited seedlings, with a gene-editing efficiency of 45% ( NtJAZ11 Sequencing of the T1 generation plants with gene mutation revealed that... NtJAZ11 -KO13 Figure 6 and NtJAZ11 The sgRNA regions all exhibited homozygous mutations with base deletions. NtJAZ11-1 and NtJAZ11-2 All mutations involve the deletion of the T base, which causes premature termination of translation. Therefore, the KO-13 homozygous mutant (T2 generation) was used for further analysis. NtJAZ11-1 Gene function research.

[0043] Example 3: NtJAZ11-2 Functional verification of negative regulation of tobacco glandular trichome development

[0044] Under normal growth conditions, compared with the control K326 (NtJAZ11-2 NtJAZ11-2 Figure 7 ), NtJAZ11 Overexpression lines showed increased total density of epidermal hairs on leaf surfaces. NtJAZ11 The total density of epidermal trichomes was significantly increased in the knockout strain. Observations of different types of epidermal trichomes showed that... NtJAZ11- The number of long-stalked and short-stalked glandular trichomes in the OE4 strain decreased by 22.23% and 33.34% respectively, while the number of protective trichomes increased significantly, up 7 times compared to K326. NtJAZ11- The KO13 strain showed a significant increase in glandular trichome density for both long-stalked and short-stalked trichomes, increasing by 44.44% and 66.67%, respectively, while there was no significant difference in protective trichome density. These validation results indicate... NtJAZ11 Genes negatively regulate the growth and development of glandular hairs in both long and short stalks of tobacco plants.

[0045] RT-PCR analysis revealed that, NtWo , NtCycB2 , NtMIXTA , NtMYC2 , NtHD8 , NtHD9 and NtHD12 exist NtJAZ11 -KO13 expression was upregulated in all cases. NtJAZ11 Different degrees of downregulation occur in -OE4. Among them NtMYC2 The gene with the largest relative upregulation ( Figure 8 It increased significantly by 231.17% in KO13 and decreased significantly by 43.36% in OE4. NtWo , NtHD9 and NtHD12 The relative expression level of [the substance] in KO13 was significantly higher than that in the control and overexpression lines, being 2.52 times, 2.02 times, and 2.75 times higher than that in K326, respectively. NtCycB2 and NtMIXTA The relative expression levels in KO13 showed little change, being 1.50-fold and 1.26-fold higher than those in K326, respectively, and were also higher than those in the control and overexpression lines. These results indicate that... NtMYC2 Possibly as a key factor and NtJAZ11 Synergistic regulation of glandular hair generation NtWo , NtHD9 and NtHD12 Possibly involved NtJAZ11 Negative regulation of glandular trichomeogenesis NtCycB2 and NtMIXTA right NtJAZ11 It has little effect on regulating glandular hair development, while NtHD8 May not be with NtJAZ11 interaction.

[0046] The above embodiments are preferred embodiments of the present invention. However, those skilled in the art will understand that the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention should be considered equivalent substitutions and are included within the protection scope of the present invention.

Claims

1. A gene regulating plant glandular trichome development, with a nucleotide sequence as shown in SEQ ID NO.2 or encoding an amino acid sequence as shown in SEQ ID NO.

4. NtJAZ11 Its application in regulating tobacco glandular trichome density and protective trichome density traits is characterized by, Construct the plant glandular trichome development regulatory gene NtJAZ11 The overexpression vector was used to transform the receptor tobacco and culture it to obtain plant material with significantly reduced glandular hair density in both long-stalked and short-stalked varieties and significantly increased protective hair density.

2. A gene regulating plant glandular trichome development, with a nucleotide sequence as shown in SEQ ID NO.2 or encoding an amino acid sequence as shown in SEQ ID NO.

4. NtJAZ11 Its application in the selection and breeding of plant varieties / strains with different glandular hair densities and / or protective hair density traits is characterized by... The aforementioned plant glandular trichome development regulatory gene NtJAZ11 The fragment TCCTCAATACCTCTCTTTCAAGG at position 126-148 bp in the open reading frame was used as the target site to construct a gene editing vector, which was then used to transform tobacco and cultured to obtain plant material with significantly increased density of long-stalked and short-stalked glandular hairs.

Images