A multi-gene base editing vector, editing method and application
By using a cytosine base editing system and a multi-gene base editing vector, and by expressing sgRNA using replicon elements and the U6 promoter, the problems of low efficiency and cell damage in multi-gene editing have been solved, achieving efficient multi-gene silencing and disease-resistant breeding.
Patent Information
- Application Number
- CN202411415041.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-11
- Publication Date
- 2026-01-13
- Estimated Expiration
- 2044-10-11
AI Technical Summary
Existing technologies are inefficient in multi-gene editing and may cause cell damage, especially the adverse effects of double-strand breaks through the CRISPR/Cas9 system, which affect cell health.
Using a cytosine base editing system, premature stop codons are generated by mutating bases on exons. sgRNA is expressed using tandem replicon elements and the U6 promoter to construct multi-gene base editing vectors, avoiding double-strand breaks and achieving multi-gene silencing.
This improved the efficiency of multi-gene editing, reduced cell damage, successfully constructed multi-gene silencing cell lines, and provided materials for disease-resistant breeding.
Smart Images

Figure CN119144652B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of gene editing technology, specifically relating to a multi-gene base editing vector, editing method, and application. Background Technology
[0002] Gene knockout is a gene-editing technology that disrupts the normal sequence of a target gene, causing it to lose its normal function. Since the advent of the CRISPR / Cas9 system, gene knockout operations have become simpler and less expensive, leading to its increasing application in the biomedical field. Gene knockout technology also has significant applications in animal breeding; studies have shown that knocking out specific genes can increase disease resistance in pigs and improve economic efficiency. Since desirable traits are usually controlled by multiple genes, knocking out multiple genes is of great significance for breeding. However, to edit multiple genes simultaneously, the editing efficiency needs further improvement, especially for obtaining homozygous cell lines with multiple gene knockouts. Therefore, improving the efficiency of multi-gene editing is crucial for breeding and even agricultural development. Currently, gene knockout efficiency mainly relies on the CRISPR / Cas9 system to cut the target strand, creating double-strand breaks. The cell's own repair system then allows for the insertion or deletion of bases in the repaired double strand, resulting in frameshift mutations that cause the gene to lose its function. However, double-strand breaks can have adverse effects on cells, potentially activating proto-oncogenes or suppressing tumor suppressor genes. Summary of the Invention
[0003] This invention provides a multi-gene base editing vector, editing method, and application. By using a cytosine base editing system, premature stop codons are generated by mutating bases on exons, resulting in multi-gene silencing and preventing the target gene from being expressed normally, while avoiding the harm caused by double strand breaks.
[0004] This invention provides a vector for multi-gene base editing, the vector comprising tandem replicon elements, a U6 promoter, and sgRNA for each target gene;
[0005] Each U6 promoter initiates the expression of the sgRNA sequence of a target gene.
[0006] In one specific embodiment of the present invention, the replicator element includes EBNA1 and OriP.
[0007] In one specific embodiment of the present invention, the number of target genes is not less than one.
[0008] In one specific embodiment of the present invention, the target gene includes genes related to the field of pig breeding and genes related to pig quality.
[0009] In one specific embodiment of the present invention, the backbone of the vector includes the following elements: a single-base editor, an epi replicator element, and multiple U6 tandem or csy4 tandem.
[0010] This invention provides a tandem vector for multi-gene base editing, comprising removing replicon elements from the vector.
[0011] In one specific embodiment of the present invention, the vector is digested with the restriction endonucleases NheI and AscI.
[0012] This invention provides a method for targeted silencing of multiple genes, comprising transforming the above-mentioned vector or the above-mentioned tandem vector into target cells to obtain multi-gene silencing cells.
[0013] This invention provides multi-gene silencing cells constructed using the above method.
[0014] This invention provides a homozygous cell line for multi-gene silencing obtained by screening the above-mentioned multi-gene silencing cells.
[0015] Beneficial effects: This invention provides a vector for multi-gene base editing. By using replicon elements and U6 and sgRNA in tandem, plasmids containing replicon elements (epi elements) can persist in cells, thereby enabling other elements on the plasmid to be continuously expressed in the cell, thus improving the efficiency of multi-gene gene silencing.
[0016] In this invention, four disease-resistance-related genes (CALR, ANPEP, CD163, and ANTXR1) and one pork quality-related gene (MSTN) in the field of pig breeding were selected for gene silencing. The epiBE4-5U6-sg vector was constructed by tandemly combining replicon elements and sgRNA of each gene with a U6 promoter. This invention also provides a tandem vector, i.e., removing the epi element from the above vector, resulting in the BE4-5U6-sg vector constructed in this embodiment. Both multi-gene editing vectors constructed in this invention silence the target sites, with the epiBE4-5U6-sg vector exhibiting higher editing efficiency. This invention also obtains homozygous cell lines with 5 gene silencing through drug enrichment screening, providing materials and methods for disease-resistance breeding. Attached Figure Description
[0017] Figure 1 The plasmid map of pKLV2-U6gRNA(Bbs1)-PGKpuro-2AZsGreen;
[0018] Figure 2 The plasmid map of the epiBE4-5U6-sg vector;
[0019] Figure 3 The plasmid map of the BE4-5U6-sg vector;
[0020] Figure 4 The graph shows the cell editing efficiency results of epiBE4-5U6-sg vector (abbreviated as epiBE4) and BE4-5U6-sg vector (abbreviated as BE4) on enrichment day 3 (D3) and day 6 (D6);
[0021] Figure 5 This is a cluster of single cells after 9 days of culture in high-concentration serum.
[0022] Figure 6 The image shows the results of a homozygous clone with 5 gene silence. Detailed Implementation
[0023] This invention provides a vector for multi-gene base editing, the vector comprising tandem replicon (epi) elements, a U6 promoter, and sgRNA for each target gene;
[0024] Each U6 promoter initiates the expression of the sgRNA sequence of a target gene.
[0025] In one specific embodiment of the present invention, the epi element includes EBNA1 and OriP, wherein the sequence of EBNA1 is shown as SEQ ID No.1 and the sequence of OriP is shown as SEQ ID No.2.
[0026] In one specific embodiment of the present invention, the nucleotide sequence of the U6 promoter may be as shown in SEQ ID No. 3. Each U6 promoter of the present invention initiates the expression of one target gene sgRNA.
[0027] The number of target genes described in this invention is not less than one. In one specific embodiment, sgRNAs of five target genes are designed simultaneously. For example, in the example, four disease-related genes (CALR, ANPEP, CD163 and ANTXR1) and one pork quality-related gene (MSTN) in the field of pig breeding are selected for gene silencing, and the sgRNA sequences shown in Table 1 are designed.
[0028] Table 1 sgRNA sequence listing
[0029] gene sequence SEQ ID No. CALR sg1F CACCGATCCCCGGAGTACCCTTATG 4 CALR sg1R AAACCATAAGGGTACTCCGGGGATC 5 MSTN sg1F CACCGCAGCGAGCAAAAGGAAAATG 6 MSTN sg1R AAACCATTTTCCTTTTGCTCGCTGC 7 MSTN sg3F CACCGAAACAACCTGAATCCAACTT 8 MSTN sg3R AAACAAGTTGGATTCAGGTTGTTTC 9 MSTN sg4F CACCGGTGCACCAAGCAAACCCCAG 10 MSTN sg4R AAACCTGGGGTTTGCTTGGTGCACC 11 ANPEP sg1F CACCGCCCCCAGTTCTCCATGGCAC 12 ANPEP sg1R AAACGTGCCATGGAGAACTGGGGGC 13 ANPEP sg2F CACCGGGATCGATGGACCCTGCAGA 14 ANPEP sg2R AAACTCTGCAGGGTCCATCGATCCC 15 ANPEP sg3F CACCGGCCCCCAGGCAAAGTCCCAC 16 ANPEP sg3R AAACGTGGGACTTTGCCTGGGGGCC 17 ANTXR1 sg1F CACCGGAACTCCAGAAGGTTCTGCC 18 ANTXR1 sg1R 19 AAACGGCAGAACCTTCTGGAGTTCC ANTXR1 sg2F 20 CACCGTCCTTTCAAGTAGTGGTGAG ANTXR1 sg2R 21 AAACCTCACCACTACTTGAAAGGAC ANTXR1 sg3F 22 CACCGCTTCCGACACGCCCGCAATG ANTXR1 sg3R 23 AAACCATTGCGGGCGTGTCGGAAGC ANTXR1 sg4F 24 CCGACCAGAGGAGAGCCAGGGCC ANTXR1 sg4R 25 AAACGGCCCTGGCTCTCCTCTGGTC ANTXR1 sg5F 26 CACCGGAACCACCAGAGGAGAGCCA ANTXR1 sg5R 27 AAACTGGCTCTCCTCTGGTGGTTCC CD163 sg1F 28 CACCGTGGTCGAGTTAACGCCAGTG CD163 sg1R 29 AAACCACTGGCGTTAACTCGACCAC CD163 sg2F 30 CACCGGTCCCAGTGAGAGTTGCAGA CD163 sg2R 31 AAACTCTGCAACTCTCACTGGGACC CD163 sg3F CACCGGTGTGCCGACAGCTGGGCTG 32 CD163sg3R AAACCAGCCCAGCTGTCGGCACACC 33 CD163sg4F CACCGAAGTACAACATGGAGACACG 34 CD163sg4R AAACCGTGTCTCCATGTTGTACTTC 35
[0030] The backbone vector of the present invention needs to include the following core elements: a single base editor, an epi replicator element, and multiple U6 tandem (or csy4 tandem), such as epiBE4-U6 selected in one embodiment.
[0031] In constructing the vector, as in the embodiments, the sequence obtained by annealing the above-mentioned sgRNA is linked to the U6 promoter to obtain a sequence of sg and U6 linked together in one gene, namely U6-sg. The sg and U6 sequences of five genes are tandemly linked, namely U6-sg1-U6-sg2-U6-sg3-U6-sg4-U6-sg5, to obtain the sequence shown in SEQ ID No. 36.
[0032] The epiBE4-U6 universal vector was selected as the sgRNA expression vector. The vector backbone was digested with PaqCI, and the digested product was recovered. The sequence shown in SEQ ID No. 36 was ligated to the digested product to obtain the constructed epiBE4-5U6-sg vector. The epiBE4-U6 sequence is shown in SEQ ID No. 37.
[0033] This invention provides a tandem vector for multi-gene base editing, comprising removing replicon elements from the vector.
[0034] In one specific embodiment of the present invention, the epiBE4-5U6-sg vector is digested with the restriction endonucleases NheI and AscI; then, a linear linker fragment of NheI and AscI is designed and the fragment is linked to successfully construct the BE4-5U6-sg vector.
[0035] This invention provides a method for targeted silencing of multiple genes, comprising transforming the above-mentioned vector or the above-mentioned tandem vector into target cells to obtain multi-gene silencing cells.
[0036] The present invention does not specifically limit the method of conversion, and conventional methods in the art, such as electroporation, can be used for conversion.
[0037] This invention provides multi-gene silencing cells constructed using the above method.
[0038] In this embodiment of the invention, the Changbai PFF cells were revived by electroporation using the vector or tandem vector constructed above, and the target fragment of the edited gene was amplified by PCR. The results showed that both multi-gene editing vectors could silence the target site.
[0039] This invention provides a homozygous cell line for multi-gene silencing obtained by screening the above-mentioned multi-gene silencing cells.
[0040] The screening method described in this invention includes culturing the above-mentioned multi-gene silencing cells in a medium with a high concentration of serum (20%), changing the medium every 2 days, and after 9 days, when single cells form clusters, picking the cell clone clusters with a cloning loop and transferring them to 48-well plates for culture. After the cells have grown to confluence, half of the cells are taken to identify the genotype, while the remaining cells are transferred to 24-well plates for culture. The cells are identified as homozygous edited single clones, frozen in cryopreservation solution, and stored in a liquid nitrogen tank, which is the multi-gene silencing homozygous cell line described in this invention.
[0041] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, provides a multi-gene base editing vector, its construction method, and its applications. However, these descriptions should not be construed as limiting the scope of protection of the present invention.
[0042] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0043] Example 1
[0044] Primers for amplification sequences were designed for five gene target sites, and expression vectors for sgRNAs at the five gene sites were constructed.
[0045] I. Validating genomic SNPs
[0046] One pair of primers was designed targeting the GGGG mutation in the intron of the CALR gene (CALR calreticulin [Sus scrofa(pig)] Gene ID: 100381266); three pairs of primers were designed targeting exons 6, 11, and 18 of the ANPEP gene (ANPEP alanylaminopeptidase,membrane [Sus scrofa(pig)] Gene ID: 397520); three pairs of primers were designed targeting exons 1, 2, and 3 of the MSTN gene (MSTN myostatin [Sus scrofa(pig)] Gene ID: 399534); three pairs of primers were designed targeting exons 4, 10, and 13 of the ANTXR1 gene (ANTXR1 ANTXR cell adhesion molecule 1 [Sus scrofa(pig)] Gene ID: 100513853); and three pairs of primers were designed targeting the CD163 gene (CD163...). Four pairs of primers were designed for exons 5, 7, 8, and 12 of the CD163 molecule [Susscrofa(pig)] Gene ID: 397031. The designed upstream and downstream primers were used to amplify the genome of Large White PFF cells (obtained from fibroblasts isolated from Large White sows at 35 days gestation from Yangxiang Company) by PCR, yielding the PCR products. The primer sequences are shown in Table 2.
[0047] Table 2. Primer Sequence List for PCR Amplification
[0048]
[0049]
[0050] After being sent to the company for sequencing, the sequencing results were compared with those from NCBI and showed normal results with no SNPs.
[0051] II. Construction of the Expression Carrier
[0052] 1. To construct efficient vectors, highly efficient sgRNAs with low off-target rates were designed using the crispbets website targeting specific genes. One gRNA (CALR-sg1) was designed targeting the intron GGGG mutation of the CALR gene; three gRNAs (ANPEP-sg1, ANPEP-sg2, ANPEP-sg3) were designed targeting exons 6, 11, and 18 of the ANPEP gene; four gRNAs (MSTN-sg1, MSTN-sg2, MSTN-sg3, MSTN-sg4) were designed targeting exons 1, 2, and 3 of the MSTN gene; and a gRNA targeting the ANTXR1 gene was designed. Five gRNAs (ANTXR1-sg1, ANTXR1-sg2, ANTXR1-sg3, ANTXR1-sg4, and ANTXR1-sg5) were designed for exons 4, 10, and 13 of the CD163 gene, and four gRNAs (CD163-sg1, CD163-sg2, CD163-sg3, and CD163-sg4) were designed for exons 5, 7, 8, and 12 of the CD163 gene. Annealing primers for these gRNAs were designed and synthesized accordingly, as shown in Table 1.
[0053] 2. Select as follows Figure 1 The pKLV2-U6gRNA(Bbs1)-PGKpuro-2AZsGreen shown is an sgRNA expression vector. The vector backbone was digested with Bbs1 to prepare a 50 μL system: 3 μg of pKLV2-U6gRNA(Bbs1)-PGKpuro-2AZsGreen plasmid, 5 μL of 10×rCutSmartBuffer, 1 μL of Bbs1-HF, and the remainder H2O. After digestion for 3 hours, the digested product was recovered.
[0054] 3. Take 5 μL of each of the sgRNA oligonucleotide sequences with complementary sticky ends synthesized in Table 1 into a PCR tube, vortex and centrifuge to mix, and then place it in a PCR instrument for annealing. The annealing program is: 95℃ for 10 min, 65℃ for 30 min to obtain the annealed product.
[0055] 4. Use DNA ligase to ligate the annealing product to the enzyme digestion vector and prepare a 10 μL system: 50 ng of pKLV2-U6gRNA(Bbs1)-PGKpuro-2AZsGreen enzyme digestion product, 1 μL of annealing product, 5 μL of DNAligation mix and the remainder H2O.
[0056] After mixing, place in a constant temperature metal bath at 25℃ for 10 min. After ligation, remove and add to DH5α competent cells. After incubation on ice for 5 min, incubate in a 42℃ water bath for 45 s, and incubate on ice for 2 min, then spread onto solid medium for transformation. After incubating upside down overnight, pick appropriately sized single colonies into 1.5 ml centrifuge tubes and add 700 μL / L liquid medium. Incubate at 37℃ and 220 rpm on a shaker for 8 h. Send to the company for sequencing to confirm successful vector construction, then expand the culture and extract plasmids.
[0057] Example 2
[0058] Cellular experiments were used to verify the editing efficiency of different sgRNAs for various genes.
[0059] PK15 BE4 cell lines were plated in 10cm dishes, and the sg vector plasmid was expressed by electroporation when the cell density reached 90%–100%. 10 μg of plasmid was transfected into each 1 / 3 10cm dish. After 72 hours, a split chromatography was performed to separate GFP-positive cells. Genomic DNA was extracted from these cells and amplified by PCR using the primers previously used for genomic DNA amplification. The amplified products were sent to a sequencing facility, and the editing efficiency of the sgRNA was analyzed using the online website http: / / baseeditr.com / . Finally, the sgRNA with the best activity at each gene locus was selected for subsequent multi-gene editing experiments.
[0060] The final selected sgRNAs are CALR sg 1, MSTN sg 4, ANPEP sg 1, ANTXR1 sg 2 and CD163 sg 4, as shown in Table 1.
[0061] Example 3
[0062] Constructing four tandem five-gene KO vectors
[0063] I. Construction of the epiBE4-5U6-sg vector
[0064] The epiBE4-5U6-sg tandem vector was constructed by combining the silenced U6 promoters of five genes with sgRNAs and epi elements. The sgRNAs of the five genes were tandemly linked, with each U6 promoter activating one sgRNA, resulting in the sequence shown in SEQ ID No. 36. This sequence was then cloned into the epiBE4-U6 universal vector and synthesized as shown in the image. Figure 2 The epiBE4-5U6-sg vector is shown.
[0065] II. Construction of BE4-5U6-sg tandem vector
[0066] (1) Double digestion of the vector: Based on the epiBE4-5U6-sg vector, the EBNA1 and oriP elements were digested, and double digestion was performed using restriction endonucleases NheI and AscI.
[0067] Prepare a 50 μL enzyme digestion system: 1 μg plasmid, 5 μL 10×rCutSmartBuffer, 1 μL NheI-HF, 1 μL AscI-HF, and the remainder H2O;
[0068] NheI F (SEQ ID No. 64): CTAGCAATTACTCGCAGCCCGGAA;
[0069] AscI R (SEQ ID No. 65): CGCGTTCCGGGCTGCGAGTAATTG.
[0070] (2) Design a linker fragment to connect the above double-enzyme digestion backbone.
[0071] Take 5 μL of each of the two linear fragments mentioned above, centrifuge to mix, and then anneal in a PCR instrument. The annealing program is: 95℃ for 10 min, 65℃ for 30 min. Dilute the annealed product with 90 μL of sterile water.
[0072] (3) Connection
[0073] The annealed product and the linearized double-digested vector were ligated using the DNA Ligation Kit. The 10 μL ligation mixture consisted of 100 ng of the linearized double-digested backbone, 1 μL of the annealed product, 5 μL of DNA ligation mix, and the remainder H2O. Ligation was performed at 25°C for 10 min, followed by transformation. Positive clones were identified by sequencing. Endotoxin was removed, and the plasmid was extracted for later use. Following these steps, the vector was successfully constructed as shown in the image. Figure 3 The BE4-5U6-sg vector is shown.
[0074] Example 4
[0075] Cellular experiments have demonstrated that multi-gene editing vectors can achieve targeted silencing of five genes.
[0076] I. Electroporation of replicon vectors and conventional vectors into Changbai fibroblasts for cellular drug enrichment.
[0077] Changbai PFF cells were revived in 10cm dishes and electroporated when the cell density reached 100%. For each electroporation, one third of the cells in the 10cm dish was electroporated with 10μg of the epiBE4-5U6-sg plasmid at 520V. Another third of the cells in the 10cm dish was electroporated directly at 520V without plasmid addition as a negative control. After electroporation, the cells were transferred to antibiotic-free medium. The next day, after observing normal cell morphology, cells were enriched with puro (1μg / ml). Three days later, one-third of the cell density was used to assess editing efficiency. Cells were then further enriched with puro (2μg / ml) for another three days, and one-third of the cell density was used again to assess editing efficiency.
[0078] II. Verifying the efficiency of cell pools containing D3 and D6 multi-gene silencing vectors
[0079] The target fragment of the gene to be edited was amplified by PCR, and the amplification products were sent to the company for testing. The editing efficiency of each gene locus was analyzed using the EditR online website based on the peak plot of the test results. Results are as follows: Figure 4 As shown, both multi-gene editing vectors silenced the target sites, with the replicon vector exhibiting the highest cell editing efficiency when enriched at D6.
[0080] Example 5
[0081] Cellular experiments demonstrated that the epiBE4-5U6-sg vector successfully screened homozygous clones with 5 gene silencing.
[0082] The PFF cells enriched for 6 days using epiBE4-5U6-sg electroporation in Example 4 were serially diluted to obtain 10 cm dishes containing 100 cells each. These were cultured in a medium with a high concentration of serum (20%, normal serum concentration is 10%), with the medium changed every 2 days. After 9 days, individual cells formed clusters, such as... Figure 5 Cell clones were picked using a cloning loop and transferred to 48-well plates for culture. Once the cells reached confluence, half of the cells were used for genotyping, while the remaining cells were transferred to 24-well plates for identification as homozygous edited single clones. Figure 6 Frozen in cryopreservation solution and stored in liquid nitrogen tank.
[0083] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A method of targeted silencing of multiple genes, comprising, The method comprises transforming into target cells by using a vector to obtain a multi-gene silenced cell; The multi-gene is CALR, ANPEP, CD163, ANTXR1 and MSTN; The backbone vector of the vector comprises the following elements: a single base editor, an epi replicon element and a multi-U6 tandem or a csy4 tandem; The vector comprises a tandem of replicon elements, U6 promoters and sgRNAs for each target gene; The sgRNAs designed for CALR are CALR sg 1F and CALR sg 1R, the nucleotide sequence of the CALR sg 1F is shown as SEQ ID No. 4, and the nucleotide sequence of the CALR sg 1R is shown as SEQ ID No. 5; the sgRNAs designed for MSTN are MSTN sg 4F and MSTN sg 4R, the nucleotide sequence of the MSTN sg 4F is shown as SEQ ID No. 10, and the nucleotide sequence of the MSTN sg 4R is shown as SEQ ID No. 11; the sgRNAs designed for ANPEP are ANPEP sg 1F and ANPEP sg 1R, the nucleotide sequence of the ANPEP sg 1F is shown as SEQ ID No. 12, and the nucleotide sequence of the ANPEP sg 1R is shown as SEQ ID No. 13; the sgRNAs designed for ANTXR1 are ANTXR1 sg 2F and ANTXR1 sg 2R, the nucleotide sequence of the ANTXR1 sg 2F is shown as SEQ ID No. 20, and the nucleotide sequence of the ANTXR1 sg 2R is shown as SEQ ID No. 21; the sgRNAs designed for CD163 are CD163 sg 4F and CD163 sg 4R, the nucleotide sequence of the CD163 sg 4F is shown as SEQ ID No. 34, and the nucleotide sequence of the CD163 sg 4R is shown as SEQ ID No. 35; Each U6 promoter initiates the expression of the sgRNA sequence of one target gene; The replicon element comprises EBNA1 and OriP.
2. A multi-gene silenced cell obtained by the method of claim 1.
3. A multi-gene silenced homozygous cell line screened from the multi-gene silenced cell of claim 2.
Citation Information
Patent Citations
Development and application of multi-gene accurate and efficient editing system
CN118460613A