Application of long noncoding RNA MIR3142HG in the diagnosis and treatment of colorectal cancer

Abstract

The present invention provides the application of long-chain non-coding RNA MIR3142HG in the diagnosis and treatment of colorectal cancer. Provide new applications of long-chain non-coding RNA MIR3142HG, including as a marker for early screening diagnosis and prognosis of colorectal cancer, and provide new molecular targets for the treatment of colorectal cancer; the expression of MIR3142HG in colorectal cancer tissue is significantly higher than that in adjacent cancer tissue, and the expression in cancer tissue decreases with the improvement of clinical pathological grade, and the prognosis of patients with high expression of MIR3142HG is better than that of the low expression group. The present invention also provides the application of long-chain non-coding RNA MIR3142HG inhibitor, which can reduce the vitality and clone formation of colorectal cancer cells by knocking down MIR3142HG, and inhibit the migration and invasion ability of colorectal cancer cells, inhibit the growth of colorectal cancer organoids and colorectal cancer cells in mice, and can be used in clinical treatment, with clinical transformation value.

Description

Technical Field

[0001] The patent of this invention relates to the field of colorectal cancer technology, especially the application of long non-coding RNA MIR3142HG in the diagnosis and treatment of colorectal cancer. Background Art

[0002] Colorectal cancer (CRC) is the third most common cancer and the second leading cause of cancer-related death worldwide. Early detection of CRC helps to minimize morbidity and mortality, however, due to the lack of obvious early symptoms, most CRCs are usually diagnosed at an advanced stage, missing the best opportunity for early treatment. Therefore, identifying new therapeutic targets and biomarkers can help detect CRC early and conduct personalized treatment and monitoring to improve prognosis.

[0003] MIR3142HG, located at 5q33.3, has a total length of 2301 bases and contains two exons. Its sequence is highly conserved in higher vertebrates. Studies have reported that MIR3142HG accelerates lipopolysaccharide-induced acute lung injury by downregulating miR-450b-5p14 and miR-95-5p15. In myeloid leukemia, MIR3142HG is co-expressed with genes related to inflammatory response and plays a dual role in the inflammatory process regulated by the NF-kB pathway. The SNP site polymorphism of MIR3142HG is also associated with the susceptibility and prognosis of glioma. However, the role of MIR3142HG in colorectal cancer is still unclear. Summary of the invention

[0004] The purpose of the present invention is to solve the existing technical problems and provide the application of long non-coding RNA MIR3142HG in the diagnosis and treatment of colorectal cancer.

[0005] The present invention provides a reagent for detecting the expression of long non-coding RNA MIR3142HG in the preparation of a colorectal cancer detection kit, wherein the gene sequence of MIR3142HG is shown in SEQ ID NO: 1:

[0006]

[0007] Preferably, the kit is used for diagnosis and / or prognosis assessment of colorectal cancer; compared with adjacent adjacent cancer tissues, the MIR3142HG is highly expressed in colorectal cancer cells or tissues, and its expression in cancer tissues decreases with the improvement of clinical pathological grade; detection of the MIR3142HG expression level can, to a certain extent, enable early diagnosis of colorectal cancer.

[0008] Furthermore, the kit includes a marker that specifically binds to the long non-coding RNA MIR3142HG. The marker can be a fluorescently labeled probe that binds to the long non-coding RNA MIR3142HG, or a biomacromolecule that binds to the long non-coding RNA MIR3142HG, wherein the biomacromolecule includes an antibody or an antibody functional fragment, or an RNA binding protein or a functional fragment thereof.

[0009] Furthermore, the probe can be designed to target the 322-1389 bp region of MIR3142HG.

[0010] The present invention provides an inhibitor of long non-coding RNA MIR3142HG, wherein the inhibitor of long non-coding RNA MIR3142HG is an antisense oligonucleotide, and the sequence of the antisense oligonucleotide targeting MIR3142HG is shown in SEQ ID NO: 2 and / or SEQ ID NO: 3:

[0011] CACTCTTCCTAAAGCAAACC (SEQ ID NO.2);

[0012] CTTGGTATCTTGGAATTTCC (SEQ ID NO.3).

[0013] The present invention provides an inhibitor of long-chain non-coding RNA MIR3142HG for use in preparing a drug for treating colorectal cancer. The nucleotide sequence of MIR3142HG is shown in SEQ ID NO: 1, and the inhibitor of long-chain non-coding RNA MIR3142HG is used for targeted knockdown of long-chain non-coding RNA MIR3142HG.

[0014] The beneficial effects of the present invention are: providing a new application of long-chain non-coding RNA MIR3142HG, including as a marker for early screening diagnosis and prognosis of colorectal cancer, and providing a new molecular target for the treatment of colorectal cancer; the expression of MIR3142HG in colorectal cancer tissue is significantly higher than that in adjacent cancer tissue, and the expression in cancer tissue decreases with the improvement of clinical pathological grade, and the prognosis of patients with high expression of MIR3142HG is better than that of the low expression group. The present invention also provides the application of long-chain non-coding RNA MIR3142HG inhibitor, which can reduce the vitality and clone formation of colorectal cancer cells by knocking down MIR3142HG, and inhibit the migration and invasion ability of colorectal cancer cells; inhibit the growth of colorectal cancer organoids and tumors in nude mice, which can be used in clinical treatment and has clinical transformation value. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The expression level of MIR3142HG in CRC tissues / cells and its clinical correlation with CRC in Example 2 of the present invention are analyzed as follows; wherein, Figure 1 A in the figure is the result of TCGA website analysis of the expression of MIR3142HG in colorectal cancer tissues (n=647) and normal tissues (n=51); Figure 1 B in the figure shows the expression level of MIR3142HG in colon and rectal tissue specimens analyzed by GEPIA2 site; Figure 1 C in the figure is the result of analyzing the correlation between MIR3142HG expression and clinical stage of CRC tumors in the TCGA database; Figure 1 D in the figure is the result of Kaplan-Meier and log-rank test analysis on the correlation between MIR3142HG expression level and overall survival rate of CRC patients;

[0016] Figure 2 The RNA ISH staining results of cancer tissue and adjacent tissue in the pathological tissue chip of Example 2 of the present invention (DIG labeled probe, hematoxylin staining);

[0017] Figure 3 The results of RNA ISH analysis of cancer tissues from 443 CRC patients and paracancerous tissues from 59 control groups in Example 2 of the present invention are as follows; wherein: Figure 3 A in the figure is the positive expression rate of MIR3142HG; Figure 3 B in Figure 3 -The ROC curve of A has an AUC value of 0.8070, p < 0.0001;

[0018] Figure 4 The ISH results of cancer tissues of 443 CRC patients in Example 2 of the present invention are combined with the statistical analysis results of clinical data; wherein, Figure 4 A in the figure is the relationship between the expression level of MIR3142HG and the clinical stage of colorectal cancer; Figure 4 B in the figure is the relationship between the expression level of MIR3142HG and the pathological stage of colorectal cancer;

[0019] Figure 5 The ISH results of cancer tissues of 443 CRC patients in Example 2 of the present invention were combined with clinical data to perform Kaplan-Meier survival evaluation analysis; wherein, Figure 5 A in the figure is the relationship between the expression level of MIR3142HG and the overall survival rate of CRC patients; Figure 5 B in the figure is a quantitative bar graph of the overall survival rate, and the vertical axis is the survival and mortality rate of the patients; Figure 5 C in the figure is the relationship between the expression of MIR3142HG and the disease-free survival rate of CRC patients; Figure 5 D in the figure is a quantitative bar graph of disease-free survival rate, and the vertical axis is the survival and mortality rate of patients;

[0020] Figure 6 The fluorescence results of RNA-FISH detection of SW480 cells in Example 2 of the present invention, the probe is labeled with Alexa Fluor 488;

[0021] Figure 7 This is a result diagram of the quantitative PCR validation of the MIR3142HG knockdown efficiency of DLD-1 and SW620 cells in Example 3 of the present invention, p<0.001;

[0022] Figure 8 This is a graph showing the CCK-8 results of DLD-1 and SW620 cells in Example 3 of the present invention;

[0023] Fig. 9 The plate culture staining results and relative cell number statistics of DLD-1 and SW620 cells in Example 3 of the present invention are shown;

[0024] Fig.10 The figure is a diagram showing the staining results of the DLD-1 cell Transwell experiment and the statistical results of the relative number of cells in Example 3 of the present invention;

[0025] Fig.11 This is a diagram showing the results of a nude mouse subcutaneous tumor formation experiment in Example 3 of the present invention; wherein, Fig.11 A in the figure is the relationship between subcutaneous tumor volume and tumor formation days; Fig.11 B in the figure is a photo of the peeled tumor tissue and a statistical chart of the tumor weight of each group;

[0026] Fig.12 This is a diagram showing the growth morphology of colorectal cancer organoids and the results of ATP quantitative cell viability detection in Example 3 of the present invention, wherein: Fig.12 A in the figure is the microscopic observation of each group of organoids after transfection; Fig.12 B in the figure is the statistical graph of luminescence intensity of ATP quantitative detection of each group of organoids after transfection;

[0027] Fig.13 This is a result diagram of quantitative PCR verification of MIR3142HG overexpression efficiency in SW480 and HT29 cells in Example 4 of the present invention;

[0028] Fig.14 This is a graph showing the CCK-8 results of SW480 and HT29 cells in Example 4 of the present invention;

[0029] Fig.15 This is a result diagram of the plate cloning experiment of SW480 and HT29 cells in Example 4 of the present invention; wherein, Fig.15 A in the figure shows the plate culture results of SW480 cells and the statistical results of the relative number of cells; Fig.15 B in the figure is the plate culture staining result of HT29 cells and the statistical result of relative cell number;

[0030] Fig.16 This is a diagram of the SW480 cell Transwell experiment results of Example 4 of the present invention. DETAILED DESCRIPTION

[0031] The technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.

[0032] Unless otherwise specified, the experimental methods used in the following examples are all conventional experimental methods.

[0033] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from existing commercial sources. SW620, DLD-1, SW480, HT29, and HEK-293T cells used in the following examples were purchased from the Cell Bank of the Committee for the Collection of Typical Cultures of the Chinese Academy of Sciences.

[0034] Example 1 Obtaining long non-coding RNA MIR3142HG

[0035] The nucleotide sequence of the long non-coding RNA MIR3142HG is shown in SEQ ID NO.1.

[0036] Example 2 The expression of MIR3142HG is significantly upregulated in colorectal cancer tissues

[0037] 2.1 Bioinformatics analysis was used to analyze the expression of MIR3142HG in colorectal cancer and adjacent tissues in the TCGA database. The results showed that the expression of MIR3142HG in colorectal cancer tissues (n=647) was significantly higher than that in normal tissues (n=51). Figure 1 A in the figure). Further analysis using GEPIA2 (http: / / gepia2.cancer-pku.cn / ) revealed that the expression level of MIR3142HG in colon cancer and rectal cancer tissue specimens was higher than that in adjacent tissue specimens ( Figure 1 B). TCGA database analysis showed that the expression of MIR3142HG decreased with the increase of clinical stage of CRC ( Figure 1 C in MIR3142HG, P<0.05); the overall survival (OS) of the MIR3142HG high expression group was significantly higher than that of the low expression group ( Figure 1 D in.

[0038] 2.2 The expression of MIR3142HG was detected in a colorectal cancer (CRC) tissue microarray, which included 443 paraffin-embedded tumor tissues and their corresponding 59 normal tissues. A total of 443 colorectal cancer patients were included. The cancer tissues of 443 CRC patients who underwent surgical treatment from January 2015 to January 2017 and had complete follow-up data, and 59 adjacent cancer tissues of the control group were made into pathological tissue microarrays (informed consent was signed by the patients and approved by the Ethics Committee of the First Affiliated Hospital of Wenzhou Medical University). RNA ISH staining was performed on the pathological tissue microarray using the RNA ISH chromogenic in situ hybridization kit (purchased from Advanced Cell Diagnostics), in which the (DIG-labeled) probe RNAscopeProbe-Hs-MIR3142HG was designed for the 322-1389 bp region of MIR3142HG (designed and synthesized by Advanced Cell Diagnostics). The above pathological tissue sections were deparaffinized, digested with proteinase K, hydrated, and deproteinized. Cover the slice surface with DIG-labeled probe RNAscopeProbe-Hs-MIR3142HG diluted in hybridization solution, and then incubate in a humidifying box at 42°C for 24 hours. After using blocking buffer for 30 minutes, incubate the specimen with diluted anti-DIG antibody at a constant temperature of 4°C overnight. Use hematoxylin for control staining of the slices and then dehydrate them. Observe under a bright field microscope. Figure 2 and Figure 3 As shown in the figure, the positive expression rate of MIR3142HG in colorectal cancer tissues in the pathological tissue chip was significantly higher than that in adjacent cancer tissues.

[0039] 2.3 The ISH results of cancer tissues from 443 CRC patients were combined with clinical data for statistical analysis to analyze the relationship between the expression of MIR3142HG in colorectal cancer tissues and the clinical pathological characteristics of colorectal cancer, such as Figure 4 As shown, the MIR3142HG high staining intensity group in the pathological tissue chip has a higher proportion than the low staining intensity group in the early stage of clinical pathological grading; Figure 5 As shown, Kaplan-Meier survival evaluation found that the overall survival (OS) and disease-free survival (DFS) of patients with low expression of MIR3142HG in the pathology chip cohort were lower than those of patients with high expression of MIR3142HG, and the MIR3142HG high expression group had a good prognosis.

[0040] 2.4 RNA-FISH staining was performed on SW480 cells using the fluorescent in situ hybridization RNA detection kit ViewRNA® Cell Plus Assay (purchased from ThermoFisherScientific), where the (Alexa Fluor 488 labeled) probe FISH Tag RNA Probe-Hs-MIR3142HG (designed and synthesized by Thermo Fisher Scientific) was designed to target the nucleotide sequence shown in SEQ ID NO. 4:

[0041]

[0042] SW480 cells were fixed and permeabilized for 0.5 h at room temperature at approximately 70% confluence. The diluted ViewRNA Cell Plus probe was incubated with SW480 cells at 40°C for 2 h, followed by gentle washing four times with ViewRNA Cell Plus RNA wash buffer. SW480 cells were then incubated with the pre-amplification mixture, then with the amplification mixture, and finally with the labeled probe mixture for 1 h, each incubation temperature at 40°C. The slides were mounted with ProLong™ Diamond Antifade Mountant containing DAPI (purchased from Thermo Fisher Scientific, Waltham, MA, USA) and the fluorescence was observed under a microscope. The fluorescence results are shown in Figure 6 As shown, it was shown that MIR3142HG was mainly localized in the nucleus in SW480 cells.

[0043] Example 3 Effects of knockdown of MIR3142HG on the growth, migration and invasion of colorectal cancer cells in vitro

[0044] 3.1 Detection of knockdown efficiency of long noncoding RNA MIR3142HG

[0045] ASO specifically targeting MIR3142HG was used to knock down MIR3142HG in colorectal cancer cells. The nucleotide sequences of ASO are shown in SEQ ID NO: 2 and SEQ ID NO: 3 (synthesized by Guangzhou Ruibo Biotechnology Co., Ltd.):

[0046] ASO1: CACTCTTCCTAAAGCAAACC (SEQ ID NO: 2)

[0047] ASO2: CTTGGTATCTTGGAATTTCC (SEQ ID NO: 3).

[0048] Lipofectamine 3000 reagent provided by Invitrogen was used to transfect DLD-1 and SW620 cells (both purchased from the Cell Bank of the Chinese Academy of Sciences Typical Culture Collection Committee):

[0049] (1) After trypsin digestion, the cells were collected and resuspended at 2×10 5 / well added into 6-well plate;

[0050] (2) Dilute ASO to 125 μl / well Opti-MEM (final concentration in transfected cells is 100 nM) and 5 μl P3000 TM / well, gently mix to obtain ASO dilution solution;

[0051] (3) Dilute 7.5 μl / well Lipofectamine 3000 with 125 μl / well Opti-MEM and mix gently;

[0052] (4) Mix the above-mentioned Lipofectamine 3000 and ASO dilution, add to a 6-well plate, and incubate at room temperature for 10 min;

[0053] (5) Discard the culture medium in the 6-well plate, gently wash the cells twice with PBS buffer, and add 750 μl Opti-MEM to each well.

[0054] (6) Add 250 μl / well of DNA-liposome complex to a 6-well cell plate to make a final volume of 1 ml and gently mix evenly;

[0055] (7) 37°C, 5% CO 2 The cells were cultured in an incubator for 48 h to obtain transfected cells.

[0056] like Figure 7 As shown, qRT-PCR verified the knockdown efficiency of MIR3142HG. Compared with the NC group, both ASO1 and ASO2 had significant knockdown effects (p < 0.001), which can be used for subsequent experiments.

[0057] 3.2 Effect of MIR3142HG knockdown on the proliferation activity of colorectal cancer cells in vitro

[0058] Colorectal cancer cells DLD-1 and SW620 were seeded in 96-well plates at a number of 5000 cells / well. After the cells adhered to the wall, 100 nM ASO1, ASO2 and control NC were transfected into the cells using lipofectamine 3000 transfection reagent, and the cells were tested at 24 h, 48 h and 72 h after transfection. 10 μl of CCK8 reagent (purchased from Dojindo, Japan) was added to each well, and the absorbance at 450 nm was measured after incubation at 37°C for 4 h. The CCK-8 results are shown in Figure 2. Figure 8 As shown, compared with the NC group, the cell proliferation ability was significantly decreased after knocking down MIR3142HG.

[0059] 3.3 Effect of knockdown of MIR3142HG on the clonogenicity of colorectal cancer cells in vitro

[0060] After 48 hours of transfection with ASO1, ASO2 and NC, DLD-1 and SW620 cells were trypsinized, resuspended in complete medium into cell suspension, and counted. 800 cells / well were inoculated in a 6-well plate and grown in a 37°C incubator for 14 days, with the medium changed once. After cloning, the cells were fixed for 30 min with 4% paraformaldehyde treatment, then stained with 0.1% crystal violet stain for 10 min, washed with PBS, inverted to dry and photographed. The results of the plate cloning experiment are shown in the figure. Fig. 9 As shown, compared with the NC group, knockdown of MIR3142HG inhibited the colony-forming ability of colorectal cancer cells.

[0061] 3.4 Effect of knockdown of MIR3142HG on the migration and invasion ability of colorectal cancer cells in vitro

[0062] Cell migration assay: DLD-1 cells transfected with ASO1, ASO2 and NC for 36 h were trypsinized and then 5×10 4 Each cell was resuspended in 200 μl serum-free medium and inoculated on the upper layer of the Transwell chamber, and 800 μl of culture medium containing 20% ​​FBS was added to the lower chamber. The cells were cultured in a 37°C incubator for 48 h, fixed with 4% paraformaldehyde for 30 min, stained with 0.1% crystal violet solution, and the unmigrated cells in the upper layer were wiped off with a cotton swab, and photographed and counted under a microscope.

[0063] Cell invasion assay: Matrigel glue was pre-coated on the upper chamber membrane and placed in a 37°C incubator overnight. The remaining steps were the same as the migration assay. Cells were photographed and counted under a microscope.

[0064] Count the 200X photos and perform data analysis to compare the differences in migration and invasion ability among ASO1, ASO2 and NC groups: calculate the number of migration and invasion cells, standard deviation, and p value obtained by T-Test analysis in each group to determine whether there is a statistical difference. Fig.10 As shown, compared with the NC group, knockdown of MIR3142HG inhibited the migration and invasion ability of colorectal cancer cells.

[0065] 3.5 Nude mouse subcutaneous tumor model

[0066] 4-8 week old nude mice were raised in an SPF barrier environment for 7 days, and then SW480 cells were inoculated subcutaneously on the right back of the nude mice. After waiting for subcutaneous tumors to form, the nude mice were randomly divided into ASO1, ASO2 and NC groups, and ASO1, ASO2 and NC were injected into the tumors at a dose of 5 nmol / mouse every 3 days. The weight of the mice and the tumor volume were measured every 3 days. After 30 days, the nude mice were killed, the tumor tissues were removed and photographed, and the tumor-forming ability of SW480 cells in vivo was detected.

[0067] The results are as follows Fig.11 As shown, compared with the NC group, knockdown of MIR3142HG effectively inhibited the proliferation of SW480 cells in vivo, among which ASO2 had a significant inhibitory effect.

[0068] 3.6 Knockdown of MIR3142HG inhibits the growth of colorectal cancer organoids

[0069] 3.6.1 Primary culture of organoids

[0070] Organoid tissue was sampled from biopsy samples of colorectal cancer patients in the First Affiliated Hospital of Wenzhou Medical University. The tissue was removed as much fat or muscle tissue as possible using surgical scissors or scalpels and forceps under a dissecting microscope; it was rinsed four times with PBS containing 1% double antibody; the tissue was minced into minced meat and then transferred to a 15 ml centrifuge tube, 5-10 ml tumor tissue digestion solution was added, and digested at 37°C for 30 min until there were no obvious tissue blocks; after digestion, it was filtered using a 100 μm cell filter, and the filtered cells were centrifuged at 4°C and 250 g for 3 min; the supernatant was discarded and the pellet was resuspended in 5 ml basal culture medium, centrifuged at 4°C and 250 g for 3 min, and this step was repeated once; after the supernatant was cleaned, the cell pellet was resuspended in 50 ul basal culture medium, and after counting, the cells were centrifuged at 1-2×10 4 Resuspend in Matrigel and pipette up and down 50 times at 4°C. Add 50 μl of Matrigel containing organoids to each well of a 24-well cell culture plate. Invert the plate and place it in a 37°C, 5% CO 2 The cells were incubated in an incubator for 25 min, and then 500 μl of colorectal cancer organoid complete culture medium was added to each well. When the organoids grew to a diameter of more than 200 μm, they could be passaged.

[0071] 3.6.2 Organoid Passaging

[0072] The organoids were blown with pre-cooled basal culture medium, and the suspension of organoids and culture medium was transferred to a 15 ml centrifuge tube; centrifuged at 250 g for 3 min at room temperature; the supernatant was discarded, and 10 times the volume of organoid digestion solution was added to digest the organoids and gel at 37°C; after digestion, 5 ml basal culture medium was used for neutralization, and then centrifuged at 250 g for 3 min at room temperature; the supernatant was discarded, and the organoid pellet was resuspended with an appropriate amount of matrix gel and inoculated; after the matrix gel solidified, 500 μl of complete culture medium was added to each well and placed at 37°C CO 2 Culture in an incubator and set aside.

[0073] 3.6.3 Organoid transfection with ASO and ATP quantitative cell viability detection

[0074] After the organoids in the 24-well plate grew to a certain size, fresh medium was replaced and ASO was added to the medium under sterile conditions to make the final concentration of ASO in each well 5 µM. The culture medium was incubated at 37°C with 5% CO 2 Incubate organoids in a cell culture incubator; observe the growth status of organoids at all times during incubation, change the medium and supplement ASO after three days. Organoids should be harvested no later than 6 days after treatment.

[0075] The harvested organoids were evenly spread in the center of a 96-well plate. After attachment, MIR3142HG-ASO and control NC were added to the plate at a concentration of 5 μM and incubated for 4-5 days, with the medium changed once in the middle. CellTiter-Glo® 2.0 Cell Viability Assay (Promega) was added in an amount equal to the cell culture medium in each well, mixed and incubated at room temperature for 10 min, and the fluorescence intensity was detected by an instrument. Fig.12 As shown, the fluorescence intensity showed that the number of live cells in the ASO1 and ASO2 groups was significantly reduced compared with the NC group, confirming that the ATP activity of organoids decreased after knocking down MIR3142HG. Microscopic observation showed that after the organoids cultured from colorectal cancer tissue were treated with knocking down MIR3142HG, the number and size of the organoids in the ASO group were significantly reduced compared with the NC group, and the organoid morphology changed significantly, with increased necrosis.

[0076] Example 4 Effect of overexpression of MIR3142HG on the growth, migration and invasion of colorectal cancer cells in vitro

[0077] 4.1 Establishment of SW480 and HT29 cell lines stably overexpressing MIR3142HG

[0078] Lentivirus recombinant packaging: 12 μg of green fluorescent protein-labeled MIR3142HG overexpression lentivirus expression vector, lentivirus packaging plasmids pCMV-VSVG (3.5 μg), pMDLg / pRRE (6.5 μg) and pRSV-REV (3.5 μg) were co-transfected into HEK-293T cells plated in a 10 cm culture dish, and the medium was changed after 8 hours. The supernatant was collected after centrifugation at 3000 g for 10 minutes at 4°C to remove HEK-293T cell debris, and then filtered with a 0.45 μm filter membrane, ultracentrifuged at 70000 g for 2 hours, and the virus precipitate was collected and dissolved in a small amount of PBS buffer, and stored in aliquots at -80°C as recombinant lentivirus particles for later use. The MIR3142HG overexpression lentivirus expression vector is a recombinant vector containing the coding gene described in SEQ ID NO: 1.

[0079] Lentivirus-infected cells: SW480 and HT29 cells were cultured at 1×10 4The number of cells / well was inoculated in a 24-well plate. After the cells adhered to the wall, 8 μg / mL polybrene and recombinant lentiviral particles were mixed at room temperature and infected with colorectal cancer cells. The medium was changed after 8 h of culture. After 48 h of culture, the expression of green fluorescent protein in the cells was observed under a fluorescence microscope. SW480 and HT29 cell lines stably overexpressing MIR3142HG were established for subsequent experiments, and the overexpression efficiency of MIR3142HG was verified by quantitative PCR ( Fig.13 ).

[0080] 4.2 Effect of overexpression of MIR3142HG on the proliferation activity of colorectal cancer cells in vitro

[0081] SW480 and HT29 cell lines overexpressing MIR3142HG and their blank plasmid control groups were inoculated in a 96-well plate at a number of 5000 cells / well, and 10 μl of CCK8 reagent (purchased from Dojindo, Japan) was added to each well. After incubation at 37°C for 4 h, the absorbance at a wavelength of 450 nm was measured. The results are shown in Fig.14 As shown, compared with the vector group, CCK-8 results showed that overexpression of MIR3142HG significantly enhanced the viability of colorectal cancer cells.

[0082] 4.3 Effect of overexpression of MIR3142HG on the clonal formation ability of colorectal cancer cells in vitro

[0083] After trypsin digestion, the SW480 and HT29 cell lines overexpressing MIR3142HG and their blank plasmid control groups were resuspended in complete medium into a cell suspension and counted. 800 cells / well were inoculated in a 6-well plate and grown in a 37°C incubator for 14 days, with the medium changed once. After cloning, the cells were fixed for 30 min with 4% paraformaldehyde treatment, then stained with 0.1% crystal violet stain for 10 min, washed with PBS, inverted to dry and photographed. The results of the plate cloning experiment are shown in Figure 2. Fig.15 As shown, compared with the vector group, overexpression of MIR3142HG promoted the colony-forming ability of colorectal cancer cells.

[0084] 4.4 Effect of overexpression of MIR3142HG on the migration and invasion ability of colorectal cancer cells in vitro

[0085] Cell migration assay: SW480 cells overexpressing MIR3142HG and their blank plasmid control group were digested with trypsin and then 4Each cell was resuspended in 200 μl serum-free medium and inoculated on the upper layer of the Transwell chamber, and 800 μl of culture medium containing 20% ​​FBS was added to the lower chamber. The cells were cultured in a 37°C incubator for 48 h, fixed with 4% paraformaldehyde for 30 min, stained with 0.1% crystal violet solution, and the unmigrated cells in the upper layer were wiped off with a cotton swab, and photographed and counted under a microscope.

[0086] Cell invasion assay: Matrigel glue was pre-coated on the upper chamber membrane and placed in a 37°C incubator overnight. The remaining steps were the same as those for the migration assay. Cells were photographed and counted under a microscope.

[0087] Count the 200X photos and perform data analysis to compare the differences in migration and invasion ability: calculate the number of migration and invasion cells, standard deviation, and p value obtained by T-Test analysis in each group to determine whether there is a statistical difference. Fig.16 As shown, compared with the vector group, overexpression of MIR3142HG promoted the migration and invasion ability of colorectal cancer cells.

[0088] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. An inhibitor of long non-coding RNA MIR3142HG, characterized in that The inhibitor of the long non-coding RNA MIR3142HG is an antisense oligonucleotide, and the antisense oligonucleotide is shown in SEQ ID NO: 2 and / or SEQ ID NO:

3.

2. The use of the inhibitor of long non-coding RNA MIR3142HG as claimed in claim 1 in the preparation of a drug for treating colorectal cancer, characterized in that: The nucleotide sequence of the MIR3142HG is shown in SEQ ID NO: 1, and the inhibitor of the long non-coding RNA MIR3142HG is used for targeted knockdown of the long non-coding RNA MIR3142HG.

Images