A composition and qualitative and quantitative detection method for detecting mycoplasma based on high-throughput sequencing

Abstract

The present invention discloses a composition and a qualitative and quantitative detection method for detecting mycoplasma based on high-throughput sequencing, and belongs to the technical field of microbial detection. The composition for detecting mycoplasma by high-throughput sequencing includes molecular marker magnetic beads and primer 2, primer 3 and primer 4, and the molecular marker magnetic beads include magnetic beads and coupled molecular marker sequences; the molecular marker sequence is as shown in SEQ ID NO. 1, wherein N represents any one of A, T, C, and G, and is randomly synthesized, the sequence of primer 2 is as shown in SEQ ID NO. 2, the sequence of primer 3 is as shown in SEQ ID NO. 3, and the sequence of primer 4 is as shown in SEQ ID NO. 4, and the magnetic beads contain fluorescent group modification. The present invention is based on high-throughput sequencing to qualitatively and quantitatively analyze the mycoplasma in the sample, and the unknown mycoplasma that can be detected has a higher coverage than the existing method; the detection period is 1-3 days, and the rapid detection of mycoplasma can be achieved, and the sensitivity of mycoplasma detection is high.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial detection, and in particular relates to a composition for detecting mycoplasma based on high-throughput sequencing and a qualitative and quantitative detection method. Background Art

[0002] Mycoplasma belongs to the class of Soft-coated Fungi, and its size is between that of bacteria and viruses. It is the smallest prokaryotic cell-type microorganism that can grow and reproduce in a non-living culture medium. It has no cell wall and is about 0.1-0.8μm in size. It is a common contaminant in cell culture. Mycoplasma easily passes through standard sterilizing filters and is difficult to remove. Mycoplasma contains multiple plasmids, which together with transposons encode drug resistance, making it easy for them to develop resistance to antimicrobial drugs. Mycoplasma contamination is hidden, and the culture medium is generally not turbid and cannot be observed under a conventional optical microscope. In fact, cell growth has been inhibited at this time, and it can cause chromosomal aberrations, etc. Due to the huge impact on the results of cell culture experiments, in the research and development process of biopharmaceutical companies or scientific research institutions, all processes involving cell culture need to be tested for mycoplasma to ensure that both the released products and the cells used for scientific research do not contain mycoplasma.

[0003] Mycoplasma detection methods include culture method, indicator cell culture method and fluorescent quantitative PCR method. The culture method takes 7-14 days, and the indicator cell culture method takes 28 days, which is time-consuming. The fluorescent probe method qPCR is to design primers and probes for known sequences to quickly detect mycoplasma, but it cannot detect unknown mycoplasma and cannot perform qualitative and quantitative detection of mycoplasma. Summary of the invention

[0004] In view of the problems that mycoplasma detection methods are time-consuming, have low detection efficiency, and cannot achieve qualitative and quantitative detection, the present invention provides a composition and a qualitative and quantitative detection method for detecting mycoplasma based on high-throughput sequencing, which can quickly and efficiently achieve qualitative and quantitative detection of mycoplasma.

[0005] The present invention is achieved through the following technical solutions:

[0006] A composition for detecting mycoplasma based on high-throughput sequencing, comprising molecular marker magnetic beads and primer 2, primer 3 and primer 4, wherein the molecular marker magnetic beads comprise magnetic beads and coupled molecular marker sequences;

[0007] The molecular marker sequence is shown in SEQ ID NO. 1, wherein N represents any one of A, T, C, and G, and is randomly synthesized;

[0008] The sequence of the primer 2 is shown in SEQ ID NO. 2;

[0009] The sequence of the primer 3 is shown in SEQ ID NO.3;

[0010] The sequence of the primer 4 is shown in SEQ ID NO. 4;

[0011] The magnetic beads are modified with fluorescent groups.

[0012] Furthermore, the fluorescent group is Cy5.

[0013] Furthermore, an amine group is used to replace a hydroxyl group at the C6 position of the nucleotide at the 5' end of the molecular marker sequence; and the surface of the magnetic bead is modified with a carboxyl group.

[0014] In the present invention, the composition for detecting mycoplasma based on high-throughput sequencing is used in the qualitative and quantitative detection of mycoplasma.

[0015] Furthermore, the method for qualitatively and quantitatively detecting mycoplasma by the composition for detecting mycoplasma based on high-throughput sequencing comprises the following steps:

[0016] (1) preparing magnetic beads and coupled molecular marker sequences into molecular marker magnetic beads;

[0017] (2) Using microfluidics technology, molecularly labeled magnetic beads are distributed into the droplet space. Each droplet space contains a molecularly labeled magnetic bead, forming a PCR reaction system containing SYBR Green fluorescent dye;

[0018] (3) Detect the fluorescence signal of the Cy5 fluorescent group at an excitation wavelength of 625 nm and a detection wavelength of 660 nm, and record the number of droplets containing the signal, which is counted as the number of effective droplets;

[0019] (4) Perform the first round of PCR amplification reaction, detect the fluorescence signal of SYBR Green fluorescent dye at 470nm excitation wavelength and 510nm detection wavelength. If there is a fluorescent signal in the droplets, break the emulsion to collect the magnetic beads, merge multiple samples, add primers 3 and 4 to perform the second round of PCR amplification to obtain the amplified product, and perform high-throughput sequencing;

[0020] (5) Assign the sequencing results to the corresponding samples according to the sample tag sequence; classify the sample sequencing results according to the 16s sequence and identify the species of mycoplasma; and perform quantitative analysis on the 16s sequence according to the droplet tag sequence corresponding to the 16s sequence.

[0021] Furthermore, the preparation method of the molecular marker magnetic beads in step (1) is: coupling the primer at the 5' end of the molecular marker sequence with the magnetic beads, and then concatenating the specific fragment of the molecular marker sequence from the 5' end to the 3' end of the remaining DNA by DNA ligase to prepare the molecular marker magnetic beads.

[0022] Furthermore, the PCR system in each droplet space in step (2) includes a molecular marker magnetic bead, 2.5 μl of 10xPCR reaction buffer containing fluorescent dye, 2.5 μl of 80 μmol / L primer 2 solution, 1 μl of the sample DNA solution to be tested, the marker magnetic bead is added to make the final concentration 1 marker magnetic bead / droplet, water is added to the volume 25 μl, and Naica R The company's digital PCR system and chip are used to prepare microdroplets.

[0023] Furthermore, the procedure of the first round of PCR amplification reaction in step (4) is pre-denaturation at 94°C for 10 min, cycle reaction at 95°C for 10 s, 60°C for 30 s, and 50 cycles; the procedure of the second round of PCR amplification reaction in step (4) is pre-denaturation at 94°C for 10 min, cycle reaction at 95°C for 10 s, 60°C for 30 s, and 25 cycles.

[0024] Furthermore, the second round PCR amplification system in step (4) is: 2.5 μl of 10xPCR reaction buffer, 2.5 μl of 10 μmol / L primer 3 and primer 4 solution, and magnetic beads obtained from the first round of PCR reaction, and water is added to the volume of 25 μl.

[0025] Furthermore, the quantitative analysis calculation formula in step (5) is: sample DNA concentration copies / μl=-ln[(effective droplet number-droplet label number) / effective droplet number]*effective droplet number*(total droplet volume-total magnetic bead volume) / PCR reaction solution volume / added sample solution volume.

[0026] Beneficial Effects

[0027] (1) The present invention conducts qualitative and quantitative analysis of mycoplasmas in samples based on high-throughput sequencing, so the coverage of unknown mycoplasmas that can be detected is higher than that of existing methods.

[0028] (2) The detection cycle of the method of the present invention is 1-3 days, which is faster than the culture method and the indicator cell method, and can achieve rapid detection of mycoplasma;

[0029] (3) The present invention divides the sample solution into microdroplets, with a detection limit of 5 cfu and high sensitivity for mycoplasma detection. DETAILED DESCRIPTION

[0030] The present invention is described in detail below in conjunction with specific embodiments, but the protection scope of the present invention is not limited by the embodiments. All technologies implemented based on the above content of the present invention are included in the scope of protection intended by the present invention.

[0031] Example 1 Carboxyl magnetic beads labeled with Cy5 fluorescent dye

[0032] Magnetic beads (magnetic beads) were purchased from Suzhou Zhiyi Microsphere Technology Co., Ltd. (Cat. No. MagCOOH-20190725), with a surface carboxyl coating and a diameter of 30 μm; Cy5-PEG-NH2 was purchased from Aladdin Biochemical Technology Co., Ltd. (Cat. No. C163486), and magnetic beads and Cy5-PEG-NH2 were mixed at a molar ratio of carboxyl to Cy5 of 10:1 to couple magnetic beads with Cy5.

[0033] Example 2 Preparation of Molecular Labeling Magnetic Beads Containing 16srDNA Amplification Primers

[0034] (1) Design molecular marker sequences, divide the molecular marker sequences into five segments, and connect the segments by DNA ligase. The segments starting from 5' are product amplification primer 1, droplet tag sequence 1, droplet tag sequence 2, droplet tag sequence 3, and 16srDNA amplification primer 1. Except for the first segment whose 5' end of the positive strand is amino-modified and whose 3' end contains overhanging bases, and the fifth segment whose negative strand contains overhanging bases, the other segments' positive and negative strands all contain overhanging bases. The overhanging bases are used to connect different segments by DNA ligase. The sequences of each segment are shown in Table 1 below.

[0035] Table 1

[0036]

[0037] Among them, 6×N is the core sequence of the droplet tag sequence, which corresponds to the same core sequence of the same magnetic bead and different core sequences of different magnetic beads, because each site has four options: A, T, C, and G;

[0038] (2) All sequences were synthesized separately, of which 96 sequences were designed for the droplet tag sequence in all sequences, each sequence was placed independently, and an amine group was used to replace the hydroxyl group at the C6 position of the nucleotide at the 5' end of the first sequence;

[0039] (3) The magnetic beads prepared in Example 1 are coupled to the first segment sequence, collected and divided into 96 equal parts, mixed with 96 types of second segment sequences and then subjected to DNA ligase ligation; the collected and mixed parts are divided into 96 equal parts, mixed with 96 types of third segment sequences and then subjected to DNA ligase ligation; the collected and mixed parts are divided into 96 equal parts, mixed with 96 types of fourth segment sequences and then subjected to DNA ligase ligation; the collected and mixed parts are added to the fifth segment sequence and then subjected to DNA ligase ligation; the mixture is washed at 98° C. to remove the negative strand, and the molecular labeled magnetic beads are obtained;

[0040] (4) Molecular marker sequence (SEQ ID NO. 1): 5'

[0041] -GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTNNNNNNCGACTCACTAGGTTCNNNNNNTCGGTGACACGACTTNNNNNNTGCTAGTTTTACGATTCCCTACGGGRSGCAGCAG-3'.

[0042] Example 3

[0043] Preparation of primers for 16s rDNA amplification

[0044] PCR requires two amplification primers, and the other primer sequence structure is as follows: starting from 5', it is the product amplification primer, the 6-base 24-sample marker, and the 16srDNA amplification primer, and the sequence is as follows:

[0045] Primer 2 (SEQ ID NO. 2): 5'

[0046] -ATCTCGTATGCCGTCTTCTGCTTGNNNNNNATTACGCGGCTGCTGGC -3'.

[0047] Example 4: Microdroplet preparation

[0048] The molecular marker magnetic beads were distributed into about 30,000 droplet spaces with a diameter of 120 μm by microfluidics technology, with one molecular marker magnetic bead in each space. The specific steps were as follows: 2.5 μl of 10xPCR reaction buffer (including SYBR Green fluorescent dye), 2.5 μl of 80 μmol / L primer 2 solution, 1 μl of DNA solution to be detected, and the marker magnetic beads were added to make the final concentration of 1 marker magnetic bead / droplet. Water was added to the volume of 25 μl. Naica R The company's digital PCR system and chip are used to prepare microdroplets; an excitation wavelength of 625nm and a detection wavelength of 660nm are used to observe the microdroplets, and the number of microdroplets with fluorescent signals is recorded as the number of effective droplets.

[0049] Example 5 PCR reaction and high-throughput sequencing

[0050] In Example 4, microdroplets were prepared for the first round of PCR (pre-denaturation at 94° C. for 10 min, cycle reaction at 95° C. for 10 s, 60° C. for 30 s, and 50 cycles), and the fluorescence signal was recorded at an excitation wavelength of 470 nm and a detection wavelength of 510 nm. If a fluorescence signal appeared in any droplet, the magnetic beads were demulsified and collected, and primers 3 and 4 were added to perform a second round of PCR amplification (pre-denaturation at 94° C. for 10 min, cycle reaction at 95° C. for 10 s, 60° C. for 30 s, and 25 cycles). The amplified products were collected for high-throughput sequencing; the sequencing results were attributed to the corresponding samples according to the sample tag sequence; the sample sequencing results were classified according to the 16s sequence, and the species of mycoplasma were identified; and various 16s sequences were quantitatively analyzed according to the droplet tag sequence corresponding to the 16s sequence. The sequence of primer 3 is as follows (SEQ ID NO. 3): GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, and the sequence of primer 4 is as follows (SEQ ID NO. 4): ATCTCGTATGCCGTCTTCTGCTTG.

[0051] Example 6 Sample matrix interference experiment

[0052] Three Clostridia (Clostridium acetobutylicum, Clostridium perfringens and Clostridium sporogenes), one Lactobacillus (Lactobacillus thermophilus), three Streptococci (Streptococcus pneumoniae, Streptococcus agalactiae and Streptococcus mutans), eight engineered cells (CHO, Vero, 293T, HEK293, MDCK, Sf9, Hi5 and NS0) and four engineered bacteria (Escherichia coli, Pichia pastoris, Saccharomyces cerevisiae and Hansenula) genomic DNA were used as the solution to be detected, and cross-interference experiments were performed according to the processes of Examples 1 to 5. None of them were effectively amplified (no fluorescent signal was detected), indicating that there was no interference with the mycoplasma detection method of the present invention.

[0053] Example 7 Detection limit experiment

[0054] A DNA solution of oral mycoplasma 16srDNA diluted to a concentration of 5 copies / μl was taken and tested according to the procedures of Examples 1 to 5. The experiment was repeated 6 times. The test results are shown in Table 2 below:

[0055] Table 2

[0056]

[0057] SEQ ID NO. 5:5'

[0058] -GGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAACGATGATCATTAGTCGGTGGAAAACTACTGACGCAGCTAACGCATTAATGATCCGCCCTGAGTAGTATGCTCGCAAGAGTGAACTTAAAGGGAATTGACGGGGACCCGCACAAGCGGTGGAGCATGTGGTTTAATTTGAAGATACGCGGAGAACCCTACCCACTCTTGACATCCCCCTGCAAAGCTATAGAGATATAGTAGAGGTTAA CAGGGTGACAGATGGTGCA-3'.

[0059] Example 8 Sample Inspection

[0060] 16srDNA of oral mycoplasma, pneumoniae, hyorhinis, and arginine mycoplasma were added to the CHO cell genomic DNA to make the concentrations 100 copies / μl, respectively. The detection was performed according to the processes of Examples 1 to 5. The calculation formula is: 16srDNA concentration (copies / μl) = -ln[(effective droplet number - droplet label number) / effective droplet number] * effective droplet number * (total droplet volume - total magnetic bead volume) / PCR reaction solution volume / added sample solution volume. The detection results are shown in Table 2 below. The 16srDNA of oral mycoplasma, pneumoniae, hyorhinis, and arginine mycoplasma correspond to SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, and SEQ ID NO. 8, respectively:

[0061] Table 2

[0062]

[0063] SEQ ID NO. 6: 5'

[0064] -GGGAGCAAAATAGGATTAGATACCCTAGTAGTCCACGCCGTAAACGATGAGTACTAAGTGTTGGGGTAACTCAGCGCTGCAGCTAACGCATTAAGTACTCCGCCTGAGTAGTATGCTCGCAAGAGTGAACTCAAAGGGAATTGACGGGGA CCCGCACAAGTGGTGGAGCATGTGGTTTAATTCGAAGCAACACGAAGAACCTTACCAGGGTCTTGACATCCAGTGCA AAGCTATAGAGATATAGTAGAGGTTAA CATTGAGACAGGTGGTGCA-3’;

[0065] SEQ ID NO. 7: 5’

[0066] -GGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGATCATTAGTTGGTGGAAATAATTTCTACTAACGCAGCTAACGCGTTAAATGATCCGCCCTGAGTAGTATGCTCGCAAGAGTGAACTTAAAGGGAATTGACGGGAACCCGCACAAGCGGTGGAGCATGTGGTTTAATTTGAAGATACGCGTAGAACCTTACCCACTCTTGACATCTTCTGCA AAGCTATAGAGATATAGTGGAGGTTAA CAGAATGACAGATGGTGCA-3’;

[0067] SEQ ID NO. 8:5’

[0068] -GGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGATCATTAGTCGGTGGAGAGTTCACTGACGCAGCTAACGCATTAATGATCCGCCCTGAGTAGTATGCTCGCAAGAGTGAACTTAAAGGGAATTGACGGGGA CCCGCACAAGCGGTGGAGCATGTGGTTTAATTTGAAGATACGCGGAGAACCCTACCCACTCTTGACATCCTTCGCAATGCTATAGAGATATAGCGGAGGTTAA CGGAGTGACAGATGGTGCA-3’。

Claims

1. A composition for detecting mycoplasma based on high-throughput sequencing, characterized in that: It includes molecular marker magnetic beads and primer 2, primer 3 and primer 4, and the molecular marker magnetic beads include magnetic beads and coupled molecular marker sequences; The molecular marker sequence is shown in SEQ ID NO. 1, wherein N represents any one of A, T, C, and G, and is randomly synthesized. The molecular marker sequence includes a droplet tag sequence; The sequence of the primer 2 is shown in SEQ ID NO. 2, and the primer 2 includes a sample tag sequence; The sequence of the primer 3 is shown in SEQ ID NO.3; The sequence of the primer 4 is shown in SEQ ID NO. 4; The magnetic beads are modified with fluorescent groups.

2. The composition for detecting mycoplasma based on high-throughput sequencing according to claim 1, characterized in that: The fluorescent group is Cy5.

3. The composition for detecting mycoplasma based on high-throughput sequencing according to claim 1, characterized in that: The hydroxyl group is replaced by an amine group at the C6 position of the 5' end nucleotide of the molecular marker sequence; and the surface of the magnetic bead is modified with a carboxyl group.

4. Use of the composition for detecting mycoplasma based on high-throughput sequencing according to any one of claims 1 to 3 in the preparation of a reagent for quantitative detection of mycoplasma.

5. The use according to claim 4, characterized in that: The composition for detecting mycoplasma based on high-throughput sequencing for quantitatively detecting mycoplasma comprises the following steps: (1) preparing magnetic beads and coupled molecular marker sequences into molecular marker magnetic beads; (2) Using microfluidics technology, molecularly labeled magnetic beads are distributed into the droplet space. Each droplet space contains a molecularly labeled magnetic bead, forming a PCR reaction system containing SYBR Green fluorescent dye; (3) Detect the fluorescence signal of the Cy5 fluorescent group at an excitation wavelength of 625 nm and a detection wavelength of 660 nm, and record the number of droplets containing the signal, which is counted as the number of effective droplets; (4) Perform the first round of PCR amplification reaction, detect the fluorescence signal of SYBR Green fluorescent dye at 470nm excitation wavelength and 510nm detection wavelength. If there is a fluorescent signal in the droplets, break the emulsion to collect the magnetic beads, merge multiple samples, add primers 3 and 4 to perform the second round of PCR amplification to obtain the amplified product, and perform high-throughput sequencing; (5) Assign the sequencing results to the corresponding samples according to the sample tag sequence; classify the sample sequencing results according to the 16s sequence and identify the species of mycoplasma; perform quantitative analysis on the 16s sequence according to the droplet tag sequence corresponding to the 16s sequence; The PCR system formed in each droplet space in step (2) includes a molecular marker magnetic bead, 2.5 μl of 10xPCR reaction buffer containing fluorescent dye, 2.5 μl of 80 μmol / L primer 2 solution, 1 μl of the DNA solution of the sample to be tested, and water is added to the volume to 25 μl. The microdroplets are prepared using the digital PCR system and chip of NaicaR.

6. The use according to claim 5, characterized in that The preparation method of the molecular marker magnetic beads in step (1) is: coupling the primer at the 5' end of the molecular marker sequence with the magnetic beads, and then concatenating the specific fragment of the molecular marker sequence from the 5' end to the 3' end of the remaining DNA by DNA ligase to prepare the molecular marker magnetic beads.

7. The use according to claim 5, characterized in that The procedure for the first round of PCR amplification reaction in step (4) is pre-denaturation at 94°C for 10 min, followed by a cycle reaction at 95°C for 10 s, 60°C for 30 s, and 50 cycles; the procedure for the second round of PCR amplification reaction in step (4) is pre-denaturation at 94°C for 10 min, followed by a cycle reaction at 95°C for 10 s, 60°C for 30 s, and 25 cycles.

8. The use according to claim 7, characterized in that The second round PCR amplification system in step (4) is: 2.5 μl of 10xPCR reaction buffer, 2.5 μl of 10 μmol / L primer 3 and primer 4 solution, and magnetic beads obtained from the first round of PCR reaction, and water is added to the volume of 25 μl.

9. The use according to claim 5, characterized in that The quantitative analysis calculation formula in step (5) is: sample DNA concentration copies / μl = -ln[(effective droplet number - droplet label number) / effective droplet number] * effective droplet number * (total droplet volume - total magnetic bead volume) / PCR reaction solution volume / added sample solution volume.

Images