Cell comprising gene expression repression factor and / or synthetic pathway activator and / or inducible payload

Abstract

Provided herein are systems comprising one or both of a cytokine and / or a synthetic pathway activating factor. Also provided herein are systems comprising one or both of a cytokine and / or a synthetic pathway activating factor and one or more gene expression repression factors. Also provided are systems of a chimeric promoter receptor that binds to ALPG and / or ALPP, a chimeric antigen receptor that binds to MSLN, and at least one of one or both of a cytokine and / or a synthetic pathway activating factor and / or one or more gene expression repression factors; a cell expressing the system; and methods of their use.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 333,076 filed on April 20, 2022, U.S. Provisional Application No. 63 / 369,656 filed on July 27, 2022, U.S. Provisional Application No. 63 / 376,531 filed on September 21, 2022, U.S. Provisional Application No. 63 / 376,499 filed on September 21, 2022, and U.S. Provisional Application No. 63 / 384,600 filed on November 21, 2022, each of which is hereby incorporated by reference in its entirety.

[0003] Sequence Listing

[0004] This application contains a sequence listing that has been submitted through Patent Center and is hereby incorporated by reference in its entirety. The copy was created on April 20, 2023, is named ANB-214WO_SL.xml, and is 358,271 bytes in size. Background Art

[0005] Cancer is a disease characterized by the uncontrolled growth of cells. Many approaches have been tried to treat cancer, including drugs and radiation therapy. Recent cancer treatments attempt to use the body's own immune cells to attack cancer cells. One promising approach uses T cells taken from a patient and genetically engineered to produce chimeric antigen receptors, or CARs, receptor proteins that give the T cells new abilities to target specific proteins. These receptors are chimeric because they combine antigen binding with T cell activation functions into a single receptor.

[0006] Immunotherapy using CAR-T cells is promising because the modified T cells have the potential to recognize cancer cells so that they can be targeted and destroyed more effectively.

[0007] After engineering T cells with CAR, the resulting CAR-T cells are introduced into the patient to attack tumor cells. CAR-T cells can be derived from T cells in the patient's own blood (autologous) or from T cells from another healthy donor (allogeneic). Once CAR-T cells are injected into the patient, they come into contact with the targeted antigen on the cells. CAR-T cells bind to the antigen and become activated. After antigen binding, CAR T cells can proliferate exponentially, initiating the production of tumor cytokines and the killing of target tumor cells.

[0008] However, there are still some problems and limitations with CAR T cell-based immunotherapy. Some CAR T cells may engage with normal cells that express low levels of target antigens, leading to off-target toxicity. Therefore, additional therapies are needed to reduce off-target toxicity. Summary of the invention

[0009] The present disclosure generally relates to systems and methods for enhancing the function of immune cells expressing CAR (e.g., by using a logic gate comprising CAR and a priming receptor and a synthetic pathway activator (SPA) that enhances immune cell stimulation by inducing constitutive cytokine signaling). In summary, the systems and methods disclosed herein provide improved efficacy and antigen-specific targeting of CAR immune cells.

[0010]

[0013] In various embodiments, disclosed herein is a system comprising: a first chimeric polypeptide comprising a priming receptor; a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); and a cytokine.

[0011] In various embodiments, disclosed herein is a system comprising: a first chimeric polypeptide comprising a priming receptor; a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); and a third chimeric polypeptide comprising a synthetic pathway activator (SPA).

[0012] In various embodiments, disclosed herein is a system comprising: a first chimeric polypeptide comprising a priming receptor; a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); a third chimeric polypeptide comprising a synthetic pathway activator (SPA); and a cytokine.

[0013] In various embodiments, disclosed herein is a system comprising: (a) a first chimeric polypeptide comprising a activating receptor, (b) a second chimeric polypeptide comprising a chimeric antigen receptor (CAR), (c) a gene expression inhibitor, and (d) (i) a third chimeric polypeptide comprising a synthetic pathway activator (SPA) and / or (ii) one or both of cytokines. In some embodiments, the activating receptor comprises from N-terminus to C-terminus: a first extracellular antigen binding domain; a first transmembrane domain comprising one or more ligand-induced proteolytic cleavage sites; and an intracellular domain comprising a human or humanized transcriptional effector.

[0014] In some embodiments, the first extracellular antigen binding domain specifically binds to germ cell alkaline phosphatase (ALPG / P). In some embodiments, the first extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, wherein the variable heavy (VH) chain sequence comprises three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, and the variable light (VL) chain sequence comprises three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence shown in SEQ ID NO: 1, 39, 40, 41 or 42, CDR-H2 comprises the sequence shown in 2, 43, 44, 45 or 46, CDR-H3 comprises the sequence shown in SEQ ID NO: 3, 47 or 48, CDR-L1 comprises the sequence shown in SEQ ID NO: 4, 49 or 50, CDR-L2 comprises the sequence shown in SEQ ID NO: 5 or 51, and CDR-L3 comprises the sequence shown in SEQ ID NO: 6 or 53. In some embodiments, the VH chain sequence comprises the sequence shown in SEQ ID NO: 7. In some embodiments, the VL chain sequence comprises the sequence set forth in SEQ ID NO: 8. In some embodiments, the first extracellular antigen binding domain comprises the sequence set forth in SEQ ID NO: 9. In some embodiments, binding of ALPG / P to the first extracellular antigen binding domain results in cleavage at one or more ligand-inducible proteolytic cleavage sites within the intracellular domain.

[0015] In some embodiments, the triggering receptor further comprises a first hinge domain positioned between the first extracellular antigen binding domain and the first transmembrane domain. In some embodiments, the first hinge domain comprises a CD8α or a truncated CD8α hinge domain. In some embodiments, the first hinge comprises a sequence as shown in SEQ ID NO: 18.

[0016] In some embodiments, the first transmembrane domain comprises a Notch1 transmembrane domain.In some embodiments, the first transmembrane domain comprises a sequence as shown in SEQ ID NO:19.

[0017] In some embodiments, the intracellular domain comprises an HNF1a / p65 domain or a Gal4 / VP64 domain. In some embodiments, the intracellular domain comprises the sequence set forth in SEQ ID NO:23.

[0018] In some embodiments, the trigger receptor further comprises a stop transfer sequence between the first transmembrane domain and the intracellular domain. In some embodiments, the stop transfer sequence comprises a sequence as shown in SEQ ID NO: 20. In some embodiments, the trigger receptor comprises a sequence as shown in SEQ ID NO: 24.

[0019] In some embodiments, the CAR comprises, from N-terminus to C-terminus: (a) a second extracellular antigen binding domain; (b) a second transmembrane domain; (c) an intracellular co-stimulatory domain; and (d) an intracellular activation domain.

[0020] In some embodiments, the second extracellular antigen-binding domain specifically binds to mesothelin (MSLN), and the second extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, wherein the variable heavy (VH) chain sequence comprises three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, and the variable light (VL) chain sequence comprises three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: (a) CDR-H1 comprises the sequence shown in SEQ ID NO: 10, 54, 56, 57 or 71, (b) CDR-H2 comprises the sequence shown in SEQ ID NO: 11, 58, 59, 60, 61 or 308, (c) CDR-H3 comprises the sequence shown in SEQ ID NO: 12, 62 or 63, (d) CDR-L1 comprises the sequence shown in SEQ ID NO: NO:14, 64, 65, 66 or 67, (e) CDR-L2 comprises the sequence shown in SEQ ID NO:15, 68, 69 or 70, and (f) CDR-L3 comprises the sequence shown in SEQ ID NO:16 or 72. In some embodiments, the VH chain sequence comprises the sequence shown in SEQ ID NO:13. In some embodiments, the VL chain sequence comprises the sequence shown in SEQ ID NO:17. In some embodiments, the second extracellular antigen-binding domain comprises the amino acid sequence shown in SEQ ID NO:30.

[0021] In some embodiments, CAR comprises a second hinge domain. In some embodiments, the second hinge domain comprises CD8α or a truncated CD8α hinge domain. In some embodiments, the second transmembrane domain comprises a CD8α transmembrane domain. In some embodiments, the intracellular costimulatory domain comprises a 4-1BB domain. In some embodiments, the intracellular activation domain comprises a CD3ζ domain. In some embodiments, CAR comprises a sequence as shown in SEQ ID NO: 31 or 32.

[0022] In some embodiments, SPA is an activator of STAT phosphorylation, optionally STAT1, STAT3 and / or STAT5 phosphorylation. In some embodiments, SPA comprises an extracellular domain connected to an intracellular signaling domain. In some embodiments, the intracellular signaling domain comprises an intracellular signaling region derived from a cytokine receptor. In some embodiments, the intracellular signaling domain comprises a polypeptide sequence derived from an interleukin receptor.

[0023] In some embodiments, the cytokine receptor comprises an interleukin 6 signal transducer (IL6ST). In some embodiments, the extracellular domain transmits constitutive activity to the intracellular signaling domain. In some embodiments, the extracellular domain comprises a dimerization region, optionally wherein the dimerization region comprises at least one of a cysteine ​​residue and a leucine zipper. In some embodiments, the dimerization region forms a homodimer.

[0024] In some embodiments, SPA comprises a leucine zipper-gp130 (L-gp130). In some embodiments, SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence shown in SEQ ID NO: 74. In some embodiments, SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence shown in SEQ ID NO: 75. In some embodiments, SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence shown in SEQ ID NO: 75.

[0025] In some embodiments, the extracellular domain comprises a polypeptide derived from a cytokine and mimics receptor agonism. In some embodiments, the SPA comprises membrane-bound interleukin 15 (mbIL-15). In some embodiments, the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the sequence shown in SEQ ID NO: 76. In some embodiments, the SPA comprises the amino acid sequence of SEQ ID NO: 76.

[0026] In some embodiments, the SPA comprises a CD34-interleukin 7 receptor (C7R). In some embodiments, the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence shown in SEQ ID NO: 77. In some embodiments, the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence shown in SEQ ID NO: 78. In some embodiments, the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence shown in SEQ ID NO: 78.

[0027] In some embodiments, the cytokine is a secreted cytokine. In some embodiments, the cytokine is an interleukin. In some embodiments, the cytokine includes at least one of interleukin (IL) -2, Super-2, IL-12, IL-12 / 23p40, IL-7, IL-15, IL-21, and IL-18. In some embodiments, the cytokine is IL-2. In some embodiments, the cytokine is Super-2. In some embodiments, the cytokine is IL-12. In some embodiments, the cytokine is IL-12 / 23p40. In some embodiments, the cytokine is IL-7. In some embodiments, the cytokine is IL-15. In some embodiments, the cytokine is IL-21. In some embodiments, the cytokine is IL-18.

[0028] In some embodiments, the cytokine comprises a non-natural signal peptide. In some embodiments, the non-natural signal peptide comprises a signal peptide from at least one of the following: CD44, CD3E, CD5, IGTAL, IL-2, GMCSF, chymotrypsinogen, trypsinogen, IgK, IgKVIII, IgE, OSM, IgG2H, BM40, secrecon and tPA. In some embodiments, the non-natural signal peptide comprises or consists of the amino acid sequence shown in SEQ ID NO: 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128 or 130. In some embodiments, the cytokine comprises the amino acid sequence shown in SEQ ID NO: 86, 88, 90, 92, 94, 96, 98 or 132.

[0029] In some embodiments, the gene expression repressor is an sgRNA or shRNA. In some embodiments, the gene expression repressor is an sgRNA. In some embodiments, the sgRNA represses the expression of a gene selected from the group consisting of PTPN2, RASA2, SOCS1, ZC3H12A, and CISH. In some embodiments, the sgRNA represses the expression of PTPN2. In some embodiments, the sgRNA represses the expression of RASA2. In some embodiments, the sgRNA represses the expression of SOCS1. In some embodiments, the sgRNA represses the expression of ZC3H12A. In some embodiments, the sgRNA represses the expression of CISH. In some embodiments, the sgRNA comprises a nucleic acid sequence as shown in any one of SEQ ID NOs: 160-164.

[0030] In some embodiments, the gene expression repressor is shRNA. In some embodiments, the shRNA represses the expression of a gene selected from the group consisting of RASA2, SOCS1, ZC3H12A, TGFBR1, and CISH. In some embodiments, the shRNA represses the expression of RASA2. In some embodiments, the shRNA represses the expression of SOCS1. In some embodiments, the shRNA represses the expression of ZC3H12A. In some embodiments, the shRNA represses the expression of TGFBR1. In some embodiments, the shRNA represses the expression of CISH. In some embodiments, the shRNA comprises a nucleic acid sequence as shown in any one of SEQ ID NOs: 165-172.

[0031] In some embodiments, the system comprises two or more gene expression repressors. In some embodiments, the system comprises shRNAs that repress TNFRSF6 (Fas) expression and other gene expression repressors. In some embodiments, the system comprises shRNAs that repress TNFRSF6 (Fas) expression, shRNAs that repress TGFBR2 expression, and other gene expression repressors. In some embodiments, the system comprises shRNAs that repress TNFRSF6 (Fas) expression, shRNAs that repress PTPN2 expression, and other gene expression repressors.

[0032] In some embodiments, the system comprises an sgRNA that suppresses CISH expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses PTPN2 expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses RASA2 expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses SOCS1 expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses ZC3H12A expression and a cytokine that is IL-2. In some embodiments, the system comprises an shRNA that suppresses RASA2 expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses PTPN2 expression and a cytokine that is IL-21. In some embodiments, the system comprises an sgRNA that suppresses ZC3H12A expression and a cytokine that is IL-21. In some embodiments, the system comprises an sgRNA that suppresses CISH expression and a SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses PTPN2 expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses RASA2 expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses SOCS1 expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses ZC3H12A expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses CISH expression and an SPA that is L-gp130. In some embodiments, the system comprises an sgRNA that suppresses RASA2 expression and an SPA that is L-gp130. In some embodiments, the system comprises an sgRNA that suppresses ZC3H12A expression and an SPA that is L-gp130. In some embodiments, the system comprises an shRNA that suppresses RASA2 expression, a cytokine that is IL-2, and an SPA that is L-gp130. In some embodiments, the system comprises an sgRNA that suppresses RASA2 expression, a cytokine that is IL-2, and a SPA that is L-gp130. In some embodiments, the system comprises an shRNA that suppresses RASA2 expression, a cytokine that is IL-15, and a SPA that is L-gp130. In some embodiments, the system comprises an sgRNA that suppresses RASA2 expression, a cytokine that is IL-15, and a SPA that is L-gp130.

[0033] In some embodiments, the activation receptor and CAR can bind to the same target cell. In some embodiments, the target cell is a human cell. In some embodiments, the target cell is a cancer cell. In some embodiments, the cancer cell is a solid cancer cell or a liquid cancer cell. In some embodiments, the cancer cell is ovarian cancer, fallopian tube cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer or pancreatic cancer.

[0034] Also disclosed herein, in various embodiments, is one or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding a system disclosed herein.

[0035] In various embodiments, one or more recombinant nucleic acids are also disclosed herein, comprising at least one nucleic acid fragment, wherein the at least one nucleic acid fragment comprises: a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen binding domain; a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain; and a nucleotide sequence encoding a cytokine.

[0036] In various embodiments, one or more recombinant nucleic acids are also disclosed herein, comprising at least one nucleic acid fragment, wherein the at least one nucleic acid fragment comprises: a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen binding domain; a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain; and a nucleotide sequence encoding a synthetic pathway activator.

[0037] In various embodiments, one or more recombinant nucleic acids are also disclosed herein, comprising at least one nucleic acid fragment, wherein the at least one nucleic acid fragment comprises: a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen binding domain; a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain; a nucleotide sequence encoding a synthetic pathway activator; and a nucleotide sequence encoding a cytokine.

[0038] In various embodiments, one or more recombinant nucleic acids are also disclosed herein, the recombinant nucleic acid comprising at least one nucleic acid fragment, the at least one nucleic acid fragment comprising: a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen binding domain; a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain; a nucleotide sequence of a gene expression repressor; and one or both of the following: a nucleotide sequence encoding a synthetic pathway activator and / or a nucleotide sequence encoding a cytokine. In some embodiments, the first extracellular antigen binding domain specifically binds to ALPG / P. In some embodiments, the second extracellular antigen binding domain specifically binds to MSLN. In some embodiments, the recombinant nucleic acid comprises two or more nucleic acid fragments.

[0039] In some embodiments, the recombinant nucleic acid also includes an inducible promoter operably connected to the nucleotide sequence encoding CAR. In some embodiments, the recombinant nucleic acid also includes a constitutive promoter operably connected to the nucleotide sequence encoding the start receptor. In some embodiments, the recombinant nucleic acid also includes a constitutive promoter operably connected to the nucleotide sequence encoding the synthetic pathway activator. In some embodiments, the start receptor and the synthetic pathway activator are under the control of the same constitutive promoter. In some embodiments, the recombinant nucleic acid also includes an inducible promoter operably connected to the nucleotide sequence encoding the chimeric antigen receptor and a constitutive promoter operably connected to the nucleotide sequence encoding the start receptor and the nucleotide sequence encoding the synthetic pathway activator.

[0040] In some embodiments, the nucleic acid comprises in the 5' to 3' direction: a constitutive promoter; a nucleotide sequence encoding a synthetic pathway activator; a nucleotide sequence encoding a priming receptor; an inducible promoter; and a nucleotide sequence encoding a chimeric antigen receptor. In some embodiments, the nucleic acid comprises in the 5' to 3' direction: an inducible promoter; a nucleotide sequence encoding a chimeric antigen receptor; a constitutive promoter; a nucleotide sequence encoding a priming receptor; and a nucleotide sequence encoding a synthetic pathway activator.

[0041] In some embodiments, the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the cytokine.

[0042] In some embodiments, the recombinant nucleic acid further comprises: (a) an inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor and the nucleotide sequence encoding the cytokine; and (b) a constitutive promoter operably linked to the nucleotide sequence encoding the activating receptor.

[0043] In some embodiments, the nucleic acid comprises in the 5' to 3' direction: (a) a constitutive promoter; (b) a nucleotide sequence encoding a promoter receptor; (c) an inducible promoter; d) a nucleotide sequence encoding a chimeric antigen receptor; and (e) a nucleic acid sequence encoding a cytokine.

[0044] In some embodiments, the nucleic acid comprises in the 5' to 3' direction: (a) a constitutive promoter; (b) a nucleotide sequence encoding a promoter receptor; (c) an inducible promoter; (d) a nucleotide sequence encoding a cytokine; and (e) a nucleic acid sequence encoding a chimeric antigen receptor.

[0045] In some embodiments, the nucleic acid comprises in the 5' to 3' direction: (a) an inducible promoter; (b) a nucleotide sequence encoding a chimeric antigen receptor; (c) a nucleic acid sequence encoding a cytokine; (d) a constitutive promoter; and (e) a nucleotide sequence encoding a promoter receptor.

[0046] In some embodiments, the nucleic acid comprises in the 5' to 3' direction: (a) an inducible promoter; (b) a nucleotide sequence encoding a cytokine; (c) a nucleic acid sequence encoding a chimeric antigen receptor; (d) a constitutive promoter; and (e) a nucleotide sequence encoding a promoter receptor.

[0047] In some embodiments, the recombinant nucleic acid further comprises: (a) a first inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor; (b) a second inducible promoter operably linked to the nucleotide sequence encoding the cytokine; and (c) a constitutive promoter operably linked to the nucleotide sequence encoding the activating receptor.

[0048] In some embodiments, the nucleic acid comprises in the 5' to 3' direction: (a) a constitutive promoter; (b) a nucleotide sequence encoding a promoter receptor; (c) a first inducible promoter; (d) a nucleotide sequence encoding a chimeric antigen receptor; (e) a second inducible promoter; and (f) a nucleic acid sequence encoding a cytokine.

[0049] In some embodiments, the nucleic acid comprises in the 5' to 3' direction: (a) a constitutive promoter; (b) a nucleotide sequence encoding a promoter receptor; (c) a second inducible promoter; (c) a nucleic acid sequence encoding a cytokine; (d) a first inducible promoter; and (e) a nucleotide sequence encoding a chimeric antigen receptor.

[0050] In some embodiments, the nucleic acid comprises in the 5' to 3' direction: (a) a first inducible promoter; (b) a nucleotide sequence encoding a chimeric antigen receptor; (c) a second inducible promoter; (d) a nucleic acid sequence encoding a cytokine; (e) a constitutive promoter; and (f) a nucleotide sequence encoding a promoter receptor.

[0051] In some embodiments, the nucleic acid comprises in the 5' to 3' direction: (a) a first inducible promoter; (b) a nucleotide sequence encoding a chimeric antigen receptor; (c) a constitutive promoter; (d) a nucleotide sequence encoding a promoter receptor; (e) a second inducible promoter; and (f) a nucleic acid sequence encoding a cytokine.

[0052] In some embodiments, the nucleic acid comprises in the 5' to 3' direction: (a) a second inducible promoter; (b) a nucleic acid sequence encoding a cytokine; (c) a first inducible promoter; (d) a nucleotide sequence encoding a chimeric antigen receptor; (e) a constitutive promoter; and (f) a nucleotide sequence encoding a promoter receptor.

[0053] In some embodiments, the nucleic acid comprises in the 5' to 3' direction: (a) a second inducible promoter; (b) a nucleic acid sequence encoding a cytokine; (c) a constitutive promoter; (d) a nucleotide sequence encoding a promoter receptor; (e) a first inducible promoter; and (f) a nucleotide sequence encoding a chimeric antigen receptor.

[0054] In some embodiments, the first inducible promoter and the second inducible promoter are the same.

[0055] In some embodiments, the nucleotide sequence encoding the initiator receptor comprises the sequence shown in SEQ ID NO: 35. In some embodiments, the nucleotide sequence encoding the chimeric antigen receptor comprises the sequence shown in SEQ ID NO: 36. In some embodiments, the nucleotide sequence encoding the synthetic pathway activator comprises the sequence shown in SEQ ID NO: 79, 80, 81, 82 or 83. In some embodiments, the nucleotide sequence encoding the cytokine comprises the sequence shown in SEQ ID NO: 87, 89, 91, 93, 95, 97 or 99. In some embodiments, the gene expression repressor comprises the nucleic acid sequence shown in any one of SEQ ID NO: 160-172.

[0056] In some embodiments, the nucleic acid In some embodiments, the recombinant nucleic acid further comprises a 5' homology directed repair arm and a 3' homology directed repair arm complementary to the insertion site in the host cell chromosome. In some embodiments, the recombinant nucleic acid further comprises a nucleotide sequence encoding a self-resecting 2A peptide (P2A). In some embodiments, P2A is at the 3' end of the nucleotide sequence encoding the chimeric antigen receptor. In some embodiments, P2A is at the 3' end of the nucleotide sequence encoding the activation receptor.

[0057] In some embodiments, the recombinant nucleic acid further comprises a woodchuck hepatitis virus post-translational regulatory element (WPRE). In some embodiments, the WPRE is at the 3' end of the nucleotide sequence encoding the chimeric antigen receptor and the 5' end of the nucleotide sequence encoding the activating receptor, or wherein the WPRE is at the 3' end of the nucleotide sequence encoding the activating receptor and the 5' end of the nucleotide sequence encoding the chimeric antigen receptor. In some embodiments, the recombinant nucleic acid further comprises an SV40 poly A element.

[0058] In some embodiments, the nucleic acid is incorporated into an expression cassette or expression vector. In some embodiments, the expression vector is a non-viral vector.

[0059] In various embodiments, expression vectors comprising the recombinant nucleic acids disclosed herein are also disclosed herein. In some embodiments, the 5' and 3' ends of the recombinant nucleic acids comprise nucleotide sequences homologous to the genomic sequences flanking the insertion site in the primary cell genome. In some embodiments, the insertion site is located at the T cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.

[0060] In various embodiments, an immune cell is also disclosed herein, comprising: a system disclosed herein; at least one recombinant nucleic acid disclosed herein; and / or a vector disclosed herein. In some embodiments, the immune cell is a primary human immune cell. In some embodiments, the immune cell is an allogeneic immune cell. In some embodiments, the immune cell is an autologous immune cell. In some embodiments, the primary immune cell is a natural killer (NK) cell, a T cell, a CD8+T cell, a CD4+T cell, a primary T cell, or a T cell progenitor cell. In some embodiments, the primary immune cell is a primary T cell. In some embodiments, the primary immune cell is a primary human T cell. In some embodiments, the primary immune cell is virus-free.

[0061] In various embodiments, a primary immune cell is also disclosed herein, comprising at least one recombinant nucleic acid, the recombinant nucleic acid comprising: a nucleic acid sequence encoding a priming receptor comprising a first extracellular antigen binding domain; a nucleic acid sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain; a nucleic acid sequence encoding a cytokine and / or a synthetic pathway activator; wherein the recombinant nucleic acid is inserted into a target region of the genome of the primary immune cell, wherein the primary immune cell does not comprise a viral vector for introducing the recombinant nucleic acid into the primary immune cell. In some embodiments, the first extracellular antigen binding domain specifically binds to ALPG / P. In some embodiments, the second extracellular antigen binding domain specifically binds to MSLN.

[0062] In various embodiments, live, virus-free primary cells comprising a ribonucleoprotein complex (RNP)-recombinant nucleic acid complex are also disclosed herein, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the recombinant nucleic acid comprises: a nucleic acid sequence encoding a priming receptor comprising a first extracellular antigen binding domain that specifically binds to ALPG / P; a nucleic acid sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain that specifically binds to MSL; a nucleic acid sequence encoding a cytokine and / or a synthetic pathway activator that constitutively activates cytokine signaling; wherein the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences homologous to the genomic sequences flanking the insertion site in the genome of the primary cell. In some embodiments, the first extracellular antigen binding domain specifically binds to ALPG / P. In some embodiments, the second extracellular antigen binding domain specifically binds to MSLN.

[0063] Also disclosed herein, in various embodiments, are cell populations comprising a plurality of the immune cells disclosed herein.

[0064] In various embodiments, also disclosed herein is a pharmaceutical composition comprising the immune cell disclosed herein or the cell population disclosed herein, and a pharmaceutically acceptable excipient.

[0065] In various embodiments, also disclosed herein is a pharmaceutical composition comprising the recombinant nucleic acid disclosed herein or the vector disclosed herein, and a pharmaceutically acceptable excipient.

[0066] In various embodiments, a method for editing an immune cell is also disclosed herein, the method comprising: providing a ribonucleoprotein (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the recombinant nucleic acid comprises a recombinant nucleic acid disclosed herein, and wherein the 5' end and the 3' end of the recombinant nucleic acid comprise nucleotide sequences homologous to the genomic sequence flanking the insertion site in the immune cell genome; introducing the RNP-recombinant nucleic acid complex into the immune cell in a non-viral manner, wherein the guide RNA specifically hybridizes to the target region of the primary immune cell genome, and wherein the nuclease domain cleaves the target region to generate an insertion site in the immune cell genome; and editing the immune cell by inserting the recombinant nucleic acid as disclosed herein into the insertion site in the immune cell genome. In some embodiments, introducing in a non-viral manner comprises electroporation.

[0067] In some embodiments, the nuclease domain comprises a CRISPR-associated nuclease (Cas), optionally a Cas9 nuclease. In some embodiments, the target region of the genome of the cell is a T cell receptor alpha constant (TRAC) locus or a genomic safe harbor (GSH) locus. In some embodiments, the recombinant nucleic acid is a double-stranded recombinant nucleic acid or a single-stranded recombinant nucleic acid. In some embodiments, the recombinant nucleic acid is a linear recombinant nucleic acid or a circular recombinant nucleic acid, optionally wherein the circular recombinant nucleic acid is a plasmid.

[0068] In some embodiments, the immune cell is a primary human immune cell. In some embodiments, the immune cell is an autologous immune cell. In some embodiments, the immune cell is an allogeneic immune cell. In some embodiments, the immune cell is a natural killer (NK) cell, a T cell, a CD8+T cell, a CD4+T cell, a primary T cell or a T cell progenitor cell. In some embodiments, the immune cell is a primary T cell. In some embodiments, the immune cell is a primary human T cell. In some embodiments, the immune cell is virus-free. In some embodiments, the method further comprises obtaining immune cells from a patient and introducing a recombinant nucleic acid in vitro.

[0069] In various embodiments, a method for treating a disease in a subject is also disclosed herein, the method comprising administering to the subject an immune cell disclosed herein or a primary cell disclosed herein or a pharmaceutical composition disclosed herein. In some embodiments, the disease is cancer. In some embodiments, the cancer is a solid cancer or a liquid cancer. In some embodiments, the cancer is ovarian cancer, fallopian tube cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, or pancreatic cancer.

[0070] In some embodiments, administering immune cells enhances the immune response of the subject. In some embodiments, the enhanced immune response is an adaptive immune response. In some embodiments, the enhanced immune response is an innate immune response. In some embodiments, the enhanced immune response is the expression of at least one increased cytokine or chemokine. In some embodiments, the at least one cytokine or chemokine is IL-2 or IFNγ. In some embodiments, the enhanced immune response is increased target cell lysis. In some embodiments, the method further comprises administering immunotherapy to the subject simultaneously with or after the immune cells.

[0071] In various embodiments, the present invention also discloses a method for regulating the activity of immune cells, the method comprising: obtaining an immune cell comprising the system disclosed herein, the recombinant nucleic acid disclosed herein, and / or the vector disclosed herein; and contacting the immune cell with a target cell expressing ALPG / P and MSLN, wherein binding of the priming receptor to ALPG / P on the target cell induces activation of the priming receptor and expression of a chimeric antigen receptor, wherein binding of the chimeric antigen receptor to MSLN on the target cell regulates the activity of the immune cell, and wherein cytokines and / or synthetic pathway activators also regulate the activity of the immune cell.

[0072] In some embodiments, the regulation of immune cell activity includes enhancing an immune response. In some embodiments, the enhanced immune response is an adaptive immune response. In some embodiments, the enhanced immune response is an innate immune response. In some embodiments, the immune cell activity is the expression of at least one increased cytokine or chemokine. In some embodiments, the at least one cytokine or chemokine is IL-2 or IFNγ. In some embodiments, the immune cell activity is target cell lysis.

[0073] In various embodiments, a system is also disclosed herein, comprising: (a) at least one of CAR, SPA and cytokines; (b) a suppressor of RASA2 expression. In some embodiments, SPA includes leucine zipper-gp130 (L-gp130). In some embodiments, SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the sequence shown in SEQ ID NO: 74. In some embodiments, SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the sequence shown in SEQ ID NO: 75. In some embodiments, SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the sequence shown in SEQ ID NO: 75.

[0074] In some embodiments, the cytokine is IL-2. In some embodiments, the cytokine comprises the amino acid sequence shown in SEQ ID NO:86. In some embodiments, the cytokine is IL-15. In some embodiments, the cytokine comprises the amino acid sequence shown in SEQ ID NO:96. In some embodiments, the suppressor of RASA2 expression is shRNA or sgRNA. In some embodiments, the suppressor of RASA2 expression is shRNA. In some embodiments, the shRNA comprises the nucleic acid sequence of SEQ ID NO:165. In some embodiments, the suppressor of RASA2 expression is sgRNA. In some embodiments, the sgRNA comprises the nucleic acid sequence of SEQ ID NO:161.

[0075] In some embodiments, the system further comprises an shRNA that suppresses the expression of TNFRSF6 (Fas). In some embodiments, the system further comprises an shRNA that suppresses the expression of TGFBR2. In some embodiments, the system further comprises an shRNA that suppresses the expression of PTPN2.

[0076] Also disclosed herein, in various embodiments, is one or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding a system disclosed herein.

[0077] In various embodiments, also disclosed herein are expression vectors comprising the recombinant nucleic acid sequences provided herein.

[0078] In various embodiments, disclosed herein is an engineered immune cell comprising: a system disclosed herein; a recombinant nucleic acid sequence disclosed herein; or an expression vector disclosed herein.

[0079] In multiple embodiments of engineered immune cells, an improved scheme is also disclosed herein, which comprises: (a) at least one of CAR, SPA and cytokines; (b) a suppressor of RASA2 expression. In some embodiments, SPA includes leucine zipper-gp130 (L-gp130). In some embodiments, SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the sequence shown in SEQ ID NO: 74. In some embodiments, SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the sequence shown in SEQ ID NO: 75. In some embodiments, SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the sequence shown in SEQ ID NO: 75.

[0080] In some embodiments, the cytokine is IL-2. In some embodiments, the cytokine comprises the amino acid sequence shown in SEQ ID NO: 86. In some embodiments, the inhibitor of RASA2 expression is shRNA or sgRNA. In some embodiments, the inhibitor of RASA2 expression is shRNA. In some embodiments, the shRNA comprises the nucleic acid sequence of SEQ ID NO: 165. In some embodiments, the inhibitor of RASA2 expression is sgRNA. In some embodiments, the sgRNA comprises the nucleic acid sequence of SEQ ID NO: 161.

[0081] In some embodiments, the engineered immune cells further comprise shRNAs that suppress expression of TNFRSF6 (Fas). In some embodiments, the engineered immune cells further comprise shRNAs that suppress expression of TGFBR2. In some embodiments, the engineered immune cells further comprise shRNAs that suppress expression of PTPN2.

[0082] In some embodiments, the engineered immune cells are primary human immune cells. In some embodiments, the engineered immune cells are allogeneic immune cells. In some embodiments, the engineered immune cells are autologous immune cells. In some embodiments, the primary immune cells are natural killer (NK) cells, T cells, CD8+T cells, CD4+T cells, primary T cells or T cell progenitor cells. In some embodiments, the primary immune cells are primary T cells. In some embodiments, wherein the primary immune cells are primary human T cells. In some embodiments, the primary immune cells are virus-free.

[0083] Also disclosed herein, in various embodiments, are cell populations comprising a plurality of the engineered immune cells disclosed herein.

[0084] In various embodiments, also disclosed herein is a pharmaceutical composition comprising the engineered immune cells disclosed herein or the population disclosed herein, and a pharmaceutically acceptable excipient.

[0085] In various embodiments, a method for treating a disease in a subject is also disclosed herein, the method comprising administering to the subject an engineered immune cell disclosed herein or a pharmaceutical composition disclosed herein. In some embodiments, the disease is cancer. In some embodiments, the cancer is solid cancer or liquid cancer. In some embodiments, the cancer is ovarian cancer, fallopian tube cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer or pancreatic cancer. In some embodiments, the engineered immune cell is administered to enhance the immune response of the subject. In some embodiments, the enhanced immune response is an adaptive immune response. In some embodiments, the enhanced immune response is an innate immune response. In some embodiments, the enhanced immune response is the expression of at least one increased cytokine or chemokine. In some embodiments, the at least one cytokine or chemokine is IL-2 or IFNγ. In some embodiments, the enhanced immune response is increased target cell lysis. In some embodiments, the method further comprises administering immunotherapy to the subject simultaneously with the engineered immune cell or after the engineered immune cell.

[0086] In various embodiments, the present invention also discloses a method of inhibiting a target cell in a subject, the method comprising administering to the subject an engineered immune cell disclosed herein or a pharmaceutical composition disclosed herein, wherein the engineered immune cell inhibits the target cell. In some embodiments, the target cell is a cancer cell. BRIEF DESCRIPTION OF THE DRAWINGS

[0087] These and other features, aspects and advantages of the present invention will be better understood with reference to the following description and accompanying drawings, in which:

[0088] Figure 1 A schematic diagram of an exemplary logic gate protein expression system employing a synthetic pathway activator (SPA) is shown.

[0089] Figure 2A Shown are the fold changes of T cells expressing various pro-survival receptors during 6 days of culture in cytokine-free medium.The percentage of logic-gated T cells (LG T cells) expressing in culture was defined by the number of cells expressing the Myc tag on primeR. Figure 2B Shows Figure 2AAbsolute cell counts of cells in were expressed as fold change relative to the first day of culture.

[0090] Figure 3 Shown is the phosphorylation of STAT1, STAT3 and STAT5 proteins in T cells expressing both types of synthetic pathway activators compared to T cells expressing an inert truncated EGFR molecule (EGFRt) on their surface under non-stimulated conditions.

[0091] Figure 4A Shown is a comparison of baseline pSTAT1 levels of LG T expressing various types of synthetic pathway activators or constitutively secreted cytokine molecules. Figure 4B Comparison of baseline pSTAT3 levels of LGT expressing various types of synthetic pathway activators or constitutively secreted cytokine molecules is shown. Figure 4C Comparison of baseline pSTAT5 levels of LG T expressing various types of synthetic pathway activators or constitutively secreted cytokine molecules is shown.

[0092] Figure 5A Shown is primeR surface expression in T cells expressing the indicated proteins cultured alone or with antigen-negative tumor cells. Figure 5B Shown is catalytic CAR surface expression in T cells expressing the indicated proteins cultured alone or with antigen-negative tumor cells.

[0093] Fig. 6A Shown is the cytotoxic activity of LG T expressing either the pro-survival module or the inert EGFRt molecule when co-cultured with antigen-positive cells. Figure 6B Shown is the cytotoxic activity of LG T expressing either the pro-survival module or the inert EGFRt molecule when co-cultured with antigen-negative cells.

[0094] Fig. 7A Serial analysis over a 72-hour period of tumor cell killing by LGT expressing pro-survival molecules at four different effector:target ratios is shown. Figure 7B Shown are sequential analyses over a 72-hour period of T cell expansion during co-culture with antigen-positive tumor cells at 4 different effector:target ratios.

[0095] Fig. 8A Shown are cell counts of logic-gated T cells expressing the indicated pro-survival receptors cultured with RPMI cells expressing ALPG / MSLN over a 10-day period. Figure 8B Representative well images of logic-gated T cells expressing truncated EGFR at day 10 are shown. Figure 8C Representative well images of logic-gated T cells expressing gp130-based SPA at day 10 are shown.

[0096] Fig. 9 Shown is the quantification of flow cytometric staining of various T cell phenotypic markers on pre-challenge LG T cells expressing various pro-survival molecules.

[0097] Fig.10 Cytotoxicity and T cell expansion are shown throughout a 15-day repeated stimulation assay in which LGT were challenged with K562 tumor cells every 2-3 days.

[0098] Fig.11A Summary indices depicting total tumor cell expansion throughout the 31-day repeated stimulation assay (in the presence or absence of IL-2-supplemented media) are shown, with data from two donors shown (left and right panels). Fig. 11B Summary indices depicting total T cell expansion throughout the 31-day repeated stimulation assay (in the presence or absence of IL-2-supplemented media) are shown, with data from two donors shown (left and right panels).

[0099] Fig.12 Shown are cell viability of T cells expressing the indicated pro-survival receptors cultured in cytokine-free medium over a 6-day period following 6 consecutive rounds of tumor challenge.

[0100] Fig.13A Shown are quantifications of flow cytometric staining of various T cell phenotypic markers on ICT after 6 rounds of tumor challenge in the absence of IL-2 supplemented medium. Fig. 13B Shown are quantifications of flow cytometric staining of various T cell phenotypic markers on ICT after 6 rounds of tumor challenge in the presence of IL-2 supplemented medium.

[0101] Fig.14A Shown is a comparison of cell phenotypes in ICT stimulated with tumor cells in the absence of IL-2. Fig. 14B Shown is a comparison of cell phenotypes in ICT stimulated with tumor cells in the presence of IL-2.

[0102] Fig.15A Shown is a comparison of changes in cell phenotype over time in T cells expressing truncated EGFR stimulated with tumor cells in the absence of IL-2. Fig. 15B Shown is a comparison of changes in cell phenotype over time in T cells expressing truncated EGFR stimulated with tumor cells in the presence of IL-2. Fig. 15C Shown is a comparison of changes in cell phenotype over time in T cells expressing gp130-based SPA stimulated with tumor cells in the absence of IL-2. Fig.15DShown is a comparison of changes in cell phenotype over time in T cells expressing gp130-based SPAs stimulated with tumor cells in the presence of IL-2.

[0103] FIG. 16A to FIG. 16B Figure 2 shows the expression of STAT3 in T cells expressing L-gp130 under non-stimulatory conditions with or without knockdown of FAS and PTPN2. Fig.16A ) and STAT1( Fig. 16B ) protein. T cells expressing EGFRt were used as a control.

[0104] Fig.17A Shown is the relative expansion of target cells after incubation with LG T cells expressing EGFRt or L-gp130 with or without knockdown of FAS / PTPN2. Fig. 17B Shown are the relative counts of SPA-expressing LG T cells expressing the indicated surface markers as measured by flow cytometry.

[0105] Fig.18A is a heat map of differential gene expression in SPA-expressing LG T cells before and after challenge with the repeated stimulation assay. Fig.18B is a heat map of the differential expression of selected T cell exhaustion markers in LG T cells before and after challenge with the repeated stimulation assay.

[0106] Fig.19 Depicted is the accessibility of the loci for selected T cell exhaustion markers (TIGIT and TOX) in LG T cells as measured by ATAC-seq before and after challenge in a repeated stimulation assay.

[0107] Fig. 20 Schematic diagram of the design of the SPA probing assay performed in mice using CAR / primeR logic-gated T cells expressing the indicated SPAs.

[0108] Fig.21 Schematic diagram of the design of the SPA probing assay performed in mice using CAR / primeR logic-gated T cells expressing the indicated SPAs.

[0109] Fig.22A Shown are tumor burdens of mice treated with CAR / primeR LG T cells expressing the indicated SPA. Fig. 22B Shown are LG T cell levels of mice treated with CAR / primeR logic gate T cells expressing the indicated SPA. Fig. 22C Cell counts of LG T cells expressing the indicated SPAs at the experimental endpoint are shown. Cell counts were normalized to EGFRt controls.

[0110] Fig.23AShown are tumor burdens of mice treated with CAR / primeR logic gate T cells expressing the indicated SPA. Fig. 23B Shown are the levels of primeR T cells in mice treated with CAR / primeR T cells expressing the indicated SPAs.

[0111] FIG. 24A to FIG. 24C Delineated the role of SPA-expressing LG T cells in a murine renal cell carcinoma xenograft model. Fig.24A The experimental design is illustrated. Fig. 24B Depicted are tumor burdens in mice transplanted with LG T cells expressing the indicated SPAs. Fig.24C Depicted are the total counts of SPA-expressing LG T cells in whole blood at the indicated time points after LG T cell transplantation.

[0112] Fig.25A An assay testing inducible cytokine secretion in response to logic gate activation is illustrated. Fig.25B Activation of inducible IL-2 secretion in response to logic gate activation is shown.

[0113] Fig.26A Diagram illustrating an assay to test CAR-T cell-mediated cytotoxicity in response to logic gate activation in the presence or absence of inducible cytokine expression. Fig.26B CAR-T cell-mediated cytotoxicity at indicated effector:target (E:T) ratios in the absence of antigen stimulation is shown. Fig.26C CAR-T cell-mediated cytotoxicity at certain E:T ratios in the presence of activating and cytolytic antigen stimulation is shown.

[0114] Fig.27A Flow cytometric analysis of the leakiness of logic gates in unstimulated LG T cells is shown. Fig.27B PrimeR and CAR expression in LG T cells in the absence of antigen stimulation is shown, where the nucleic acid encoding the cytokine "payload" is located upstream of the nucleic acid encoding the CAR. Fig.27C PrimeR and CAR expression in LG T cells in the absence of antigen stimulation is shown, where the nucleic acid encoding the cytokine "payload" is located downstream of the nucleic acid encoding the CAR.

[0115] Fig.28 Expansion of T cells expressing the logic gates in the presence of the indicated cytokines is shown.

[0116] Fig.29 Expansion of T cells expressing the logic gates in the presence of the indicated cytokines is shown.

[0117] Fig.30Shown are the secretion of the indicated induced cytokines compared to controls in Logic Gate T cells stimulated with PrimeR and CAR antigen.

[0118] Fig.31 Expansion of T cells expressing the logic gate plus the indicated inducible cytokines is shown.

[0119] Fig.32A The construction of inducible cytokines with non-native signal peptides to achieve regulated secretion is described in detail. Fig.32B Shown are IL-7 secretion levels in logic-gated T cells with the indicated signal peptides.

[0120] Fig.33A Shown are tumor volumes over time in mice treated with logic-gated T cells expressing the indicated helper molecules. Fig.33B Shown are the titers of logic-gated T cells expressing the indicated accessory molecules at the indicated time points after tumor injection. Fig.33C Shown are the titers of logic-gated T cells expressing the indicated accessory molecules 15 days after tumor injection.

[0121] FIG. 34A to FIG. 34C is a schematic diagram detailing the workflow for high-throughput screening of combinations of synthetic pathway activators (SPAs) and cytokines. Fig.34A The cell editing process used to generate LG T cells expressing SPA and a combination of cytokines is detailed. Fig.34B The process of normalizing edited cells for screening is detailed. Fig.34C A sequential stimulation assay for screening edited T cells for their effects on target cell killing and T cell proliferation is described in detail.

[0122] FIG. 35A to FIG. 35C Shown are the results of screening LG T cells expressing indicative SPA and cytokine combinations based on reduction in target cell counts (lower numbers indicate increased target cell killing). Fig.35A It is shown that the box colors are the results based on the various combinations of SPAs expressed. Fig.35B The box colors are shown as the results for each combination based on the cytokines expressed. Fig.35C Results for the top 20 combinations tested compared to the indicated positive controls are shown.

[0123] Fig.36A and Fig.36B Shown are graphs detailing combinations that outperformed single-module LG T cells. Fig.36A The combination was shown to outperform the single-module LG T cells based on reduced target cell counts. Fig.36B The combination was shown to outperform single-module LG T cells based on increased T cell expansion.

[0124] Fig.37A and Fig.37B Shown are graphs detailing combinations that showed no additive effect relative to single module LG T cells. Fig.37A Shown are graphs detailing the effect of L-gp130 in combination with sgRNA targeting PTPN2 on T cell expansion compared to the effect of L-gp130 or sgRNA alone. Fig.37B Shown are graphs detailing the effect of C7R in combination with sgRNA targeting CISH on target cell counts compared to the effect of C7R or sgRNA alone.

[0125] Fig.37C Shown is the ANOVA analysis of the combination of L-gp130 and IL-2 in LG T cells in different backgrounds. Fig.37D Shown is the ANOVA analysis of the combination of L-gp130 and IL-12 in LG T cells in different backgrounds.

[0126] Fig.38 is a graph showing the results of a sequential stimulation assay screening of LG T cells expressing the indicated cytokines and sgRNA / ribonucleoprotein cultured in the presence of the indicated cytokines.

[0127] FIG. 39A to FIG. 39C Detailed is a sequential stimulation assay screen of LG T cells expressing various shRNAs, inducible cytokine payloads, sgRNAs, and SPA cultured in the presence or absence of TGF-β. Fig.39A The combination of tests is detailed. Fig.39B Results are shown for the indicated combinations including inducible IL-2 expression. Fig.39C Results are shown for the indicated combinations including inducible IL-12 expression.

[0128] FIG. 40A to FIG. 40C A sequential stimulation assay screen of LG-T cells expressing various shRNAs, inducible cytokine payloads, sgRNAs, and SPA is described in detail. Fig.40A Shown are the results of screening of LG T cells in the absence of TGF-β (left panel) and selected results for the indicated combinations (right panel). Fig.40B Shown are the results of screening of LG T cells in the presence of TGF-β (left panel) and selected results for the indicated combinations (right panel). Fig.40C Shown are the best performing cytokine, SPA, and sgRNA combinations (left panel) or SPA and sgRNA combinations with a control inducible payload (right panel).

[0129] Fig.41A Shown are the mean tumor volumes of mice after treatment with the indicated ICT cells. Fig.41BTotal T cells 7, 14, 21 and 42 days after T cell injection are shown.

[0130] Fig.42 Shown are serum levels of IL2 and IFNγ at days 14, 21 and 42 after in vivo injection of the indicated ICT cells.

[0131] Fig.43A Shown are TCR expansion and percentage of tumor lysis following incubation of T cells with exogenous IL-2 or IL-15 or delayed addition of exogenous IL-2 or IL-15. Fig.43B Shown are the percentages of TCR target cell growth following incubation with the indicated cytokines.

[0132] Fig.44 It is shown that the addition of IL-15 expression to ICT cells expressing L-gpl30 (SPA.I) results in increased T cell killing. DETAILED DESCRIPTION

[0133] definition

[0134] Unless otherwise defined, terms used in the claims and specification are defined as set out below.

[0135] With respect to the binding of an antibody to a target molecule, the terms "bind", "specifically bind", "specifically bind to", "specifically bind to", "specific for", "selectively bind to", and "selectively for" a particular antigen (e.g., a polypeptide target) or an epitope on a particular antigen refer to binding that is measurably different from non-specific or non-selective interactions (e.g., with non-target molecules). For example, an antibody that "selectively binds" or "specifically binds" an antigen is an antigen binding portion that binds the antigen with high affinity and does not significantly bind to other unrelated antigens. For example, specific binding can be measured by measuring binding to a target molecule and comparing it to binding to a non-target molecule. Specific binding can also be determined by competition with a control molecule that simulates an epitope recognized on a target molecule. In this case, if the binding of the antibody to the target molecule is competitively inhibited by the control molecule, specific binding is indicated. In some embodiments, the extracellular antigen binding domain specifically binds to germ cell alkaline phosphatase (ALPG). In some embodiments, the extracellular domain includes an antigen binding portion that binds to placental alkaline phosphatase (ALPP).

[0136] "Affinity" refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen or epitope). Unless otherwise indicated, as used herein, "affinity" refers to the intrinsic binding affinity that reflects a 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen or epitope). The affinity of a molecule X for its partner Y can be represented by a dissociation equilibrium constant (KD). The kinetic components that contribute to the dissociation equilibrium constant are described in more detail below. Affinity can be measured by common methods known in the art, including, but not limited to, surface plasmon resonance (SPR) techniques (e.g., ) or biolayer interferometry (e.g. ).

[0137] The term "hypervariable region" or "HVR" as used herein refers to each of the regions of an antibody variable domain that are highly variable in sequence and / or form structurally defined loops ("hypervariable loops"). Typically, a natural four-chain antibody comprises six HVRs; three in VH (H1, H2, H3) and three in VL (L1, L2, L3). HVRs typically comprise amino acid residues from hypervariable loops and / or from complementary determining regions (CDRs) that have the highest sequence variability and / or are involved in antigen recognition. In addition to CDR1 in VH, CDRs typically comprise amino acid residues that form hypervariable loops. Hypervariable regions (HVRs) are also referred to as "complementarity determining regions" (CDRs), and these terms are used interchangeably herein with respect to portions of the variable regions that form antigen binding regions. This particular region has been described by Kabat et al., USDept. of Health and Human Services, Sequences of Proteins of Immunological Interest (1983) and by Chothia et al., J Mol Biol 196: 901-917 (1987), wherein the definitions include overlaps or subgroups of amino acid residues when compared relative to each other. However, the application of any definition to refer to the CDR of an antibody or its variants is intended to be within the scope of the term as defined and used herein. The exact number of residues covering a particular CDR will vary depending on the sequence and size of the CDR. In view of the variable region amino acid sequence of an antibody, those skilled in the art can determine in a conventional manner which residues constitute a particular CDR.

[0138] The amino acid sequence boundaries of the CDRs can be determined by one of skill in the art using any of a number of known numbering schemes, including those described by Kabat et al. (supra) ("Kabat" numbering scheme); Al-Lazikani et al., 1997, J. Mol. Biol., 273:927-948 ("Chothia" numbering scheme); MacCallum et al., 1996, J. Mol. Biol. 262:732-745 ("Contact" numbering scheme); Lefranc et al., Dev. Comp. Immunol., 2003, 27:55-77 ("IMGT" numbering scheme); and Honegge and Plückthun, J. Mol. Biol., 2001, 309:657-70 ("AHo" numbering scheme); each of which is incorporated herein by reference in its entirety.

[0139] Table A provides the positions of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2 and CDR-H3 as identified by the Kabat scheme and the Chothia scheme. For CDR-H1, residue numbers using both the Kabat numbering scheme and the Chothia numbering scheme are provided.

[0140] CDRs can be assigned, for example, using antibody numbering software such as Abnum available at bioinf.org.uk / abs / abnum / and described in Abhinandan and Martin, Immunology, 2008, 45:3832-3839, which is incorporated herein by reference in its entirety.

[0141] Table A. Residues in CDRs according to the Kabat and Chothia numbering schemes.

[0142] CDR Kabat Chothia L1 L24-L34 L24-L34 L2 L50-L56 L50-L56 L3 L89-L97 L89-L97 H1(Kabat number) H31-H35B H26-H32 or H34* H1 (Chothia number) H31-H35 H26-H32 H2 H50-H65 H52-H56 H3 H95-H102 H95-H102

[0143] *When numbered using the Kabat numbering convention, the C-terminus of CDR-H1 varies between H32 and H34, depending on the length of the CDR.

[0144] When referring to residues in the antibody heavy chain constant region, the "EU numbering scheme" is generally used (e.g. as reported in Kabat et al. (supra)). Unless otherwise stated, the EU numbering scheme is used to refer to residues in the antibody heavy chain constant region described herein.

[0145] As used herein, the term "single chain" refers to a molecule comprising amino acid monomers linearly linked by peptide bonds. In a specific described embodiment, in a single-chain Fab molecule, the C-terminus of the Fab light chain is connected to the N-terminus of the Fab heavy chain. As described in more detail herein, a scFv has the variable domain of the light chain (VL) connected from its C-terminus to the N-terminus of the variable domain of the heavy chain (VH) by a polypeptide chain. Alternatively, a scFv comprises a polypeptide chain in which the C-terminus of VH is connected to the N-terminus of VL by a polypeptide chain.

[0146] "Fab fragments" (also called antigen binding fragments) contain the constant domain (CL) of the light chain and the first constant domain (CH1) of the heavy chain and the variable domains VL and VH on the light chain and heavy chain, respectively. The variable domains contain the complementarity determining loops (CDRs, also called hypervariable regions) involved in antigen binding. Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxyl terminus of the heavy chain CH1 domain, including one or more cysteines from the antibody hinge region.

[0147] "F(ab')2" fragments contain two Fab' fragments joined by a disulfide bond near the hinge region. F(ab')2 fragments can be produced, for example, by recombinant methods or by pepsin digestion of intact antibodies. F(ab') fragments can be dissociated, for example, by treatment with β-mercaptoethanol.

[0148] An "Fv" fragment comprises a non-covalently linked dimer of one heavy-chain and one light-chain variable domain.

[0149] "Single-chain Fv" or "scFv" includes the VH domain and VL domain of an antibody, wherein these domains are present in a single polypeptide chain. In one embodiment, the Fv polypeptide also includes a polypeptide linker between the VH domain and the VL domain that enables the scFv to form a structure required for antigen binding. For a review of scFv, see Pluckthun, The Pharmacology of Monoclonal Antibodies, Vol. 113, Rosenburg and Moore, ed., Springer-Verlag, New York, pp. 269-315 (1994). HER2 antibody scFv fragments are described in WO93 / 16185; U.S. Pat. No. 5,571,894; and U.S. Pat. No. 5,587,458.

[0150] The term "single domain antibody" or "sdAb" refers to a molecule in which one variable domain of an antibody specifically binds to an antigen in the absence of another variable domain. Single domain antibodies and fragments thereof are described in Arabi Ghahroudi et al., FEBS Letters, 1998, 414: 521-526 and Muyldermans et al., Trends in Biochem. Sci., 2001, 26: 230-245, each of which is incorporated by reference in its entirety. Single domain antibodies are also referred to as sdAbs or nanobodies. SdAbs are very stable and are easily expressed as fusion partners with the Fc chain of an antibody (Harmsen MM, DeHaard HJ (2007). "Properties, production, and applications of camelid single-domain antibody fragments". Appl. Microbiol Biotechnol. 77 (1): 13-22).

[0151] As used herein, the term "gene" refers to the basic unit of heredity, consisting of a DNA segment arranged along a chromosome, which encodes a specific protein or protein segment. A gene generally includes a promoter, a 5' untranslated region, one or more coding sequences (exons), optional introns, and a 3' untranslated region. A gene may also include a terminator, an enhancer, and / or a silencer.

[0152] As used herein, the term "locus" refers to the specific, fixed physical location on a chromosome where a gene or genetic marker is located.

[0153] The term "safe harbor locus" refers to a locus into which a gene or genetic element can be incorporated without disrupting the expression or regulation of adjacent genes. These safe harbor loci are also referred to as safe harbor sites (SHS). As used herein, a safe harbor locus refers to an "integration site" or "knock-in site" at which a sequence encoding a transgenic as defined herein can be inserted. In some embodiments, insertion occurs with displacement of the sequence located at the integration site. In some embodiments, insertion occurs without displacement of the sequence located at the integration site. Examples of envisioned integration sites are provided in Table D.

[0154] As used herein, the term "insert" refers to a nucleotide sequence integrated (inserted) into a target locus or safe harbor site. An insert can be used to refer to a gene or genetic element that is incorporated into a target locus or safe harbor site using, for example, homology directed repair (HDR) CRISPR / Cas9 genome editing or other methods known to those of ordinary skill in the art for inserting nucleotide sequences into genomic regions.

[0155] The term "insertion" refers to the manipulation of a nucleotide sequence to introduce a non-native sequence. This is accomplished, for example, by using restriction enzymes and ligases, whereby a target DNA sequence that typically encodes a target gene can be incorporated into another nucleic acid molecule by digesting the two molecules with appropriate restriction enzymes to produce a compatible overlap, and then joining the molecules together using a ligase. Those skilled in the art are very familiar with such manipulations, examples of which can be found in Sambrook et al. (Sambrook, Fritsch and Maniatis, "Molecular Cloning: A Laboratory Manual", 2nd ed., Cold Spring Harbor Laboratory, 1989), which are hereby incorporated by reference in their entirety, including any drawings, figures and tables.

[0156] "CRISPR / Cas" system refers to a class of bacterial systems widely used to defend against foreign nucleic acids. CRISPR / Cas systems are widely present in eubacteria and archaebacterial organisms. CRISPR / Cas systems include type I, type II, and type III subtypes. The wild-type type II CRISPR / Cas system utilizes a complex of RNA-mediated nuclease Cas9 and guidance and activating RNA to recognize and cleave foreign nucleic acids. Guide RNAs with the activity of both guide RNA and activating RNA are also known in the art. In some cases, this dual-activity guide RNA is referred to as a small guide RNA (sgRNA).

[0157] Cas9 homologs exist in a variety of true bacteria, including but not limited to bacteria of the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydia-Verrucom icrobia, Chloroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and their homologs are described, for example, in Chylinksi et al., RNA Biol. 2013 May 1; 10(5):726-737; Nat. Rev. Microbiol. 2011 Jun; 9(6):467-477; Hou et al., Proc Natl Ac ad Sci US A. 2013 Sep 24; 110(39):15644-9; Sampson et al., Nature. 2013 May 9; 497(7448):254-7; and Jinek et al., Science. 2012 Aug 17; 337(6096):816-21. The Cas9 nuclease domain can be optimized to increase activity in host cells or enhance stability.

[0158] As used herein, the term "Cas9" refers to an RNA-mediated nuclease (e.g., of bacterial or archaeal origin, or derived therefrom). Exemplary RNA-mediated nucleases include the above-mentioned Cas9 proteins and homologs thereof, and include but are not limited to CPF1 (see, e.g., Zetsche et al., Cell, Vol. 163, No. 3, p759-771, October 22, 2015). Similarly, as used herein, the term "Cas9 ribonucleoprotein" complex, etc., refers to a complex between a Cas9 protein and crRNA (e.g., a guide RNA or a small guide RNA), a complex between a Cas9 protein and a trans-activating crRNA (tracrRNA), a complex between a Cas9 protein and a small guide RNA, or a combination thereof (e.g., a complex containing a Cas9 protein, a tracrRNA, and a crRNA guide RNA).

[0159] As used herein, the phrase "immune cell" includes all cell types that can produce immune cells, including hematopoietic cells, such as hematopoietic stem cells, pluripotent stem cells and induced pluripotent stem cells (iPSC). In some embodiments, the immune cell is a B cell, a macrophage, a natural killer (NK) cell, an induced pluripotent stem cell (iPSC), a human pluripotent stem cell (HSPC), a T cell or a T cell progenitor cell or a dendritic cell. In some embodiments, the cell is an innate immune cell.

[0160] As used herein, the term "primary" in the context of primary cells or primary stem cells refers to cells that have not yet been transformed or immortalized. Such primary cells can be cultured, subcultured or passed down a limited number of times (e.g., culture 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times). In some cases, primary cells adapt to in vitro culture conditions. In some cases, primary cells are separated from organisms, systems, organs or tissues, optionally sorted and utilized, such as directly used without culture or subculture. In some cases, primary cells are stimulated, activated or differentiated. For example, primary T cells can be activated by contacting (e.g., existing during culture) CD3, CD28 agonists, IL-2, IFN-γ or a combination thereof.

[0161] As used herein, the terms "T lymphocyte" and "T cell" are used interchangeably and refer to cells that have completed maturation in the thymus and recognize certain foreign antigens in the body. These terms also refer to the main types of white blood cells that have various roles in the immune system, including activation and inactivation of other immune cells. T cells can be any T cells, such as cultured T cells, for example primary T cells, or T cells derived from cultured T cell lines, such as Jurkat, SupT1, etc., or T cells obtained from mammals. T cells include, but are not limited to, naive T cells, stimulated T cells, primary T cells (e.g., uncultured), cultured T cells, immortalized T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, combinations thereof, or subsets thereof. T cells can be CD3+ cells. T cells can be CD4 + 、CD8 + or CD4 + and CD8 +. T cells can be any type of T cells, CD4+ / CD8+ double positive T cells, CD4+ helper T cells (e.g., Th1 and Th2 cells), CD8+ T cells (e.g., cytotoxic T cells), peripheral (including but not limited to) blood mononuclear cells (PBMC), peripheral blood leukocytes (PBL), tumor infiltrating lymphocytes (TIL), memory T cells, naive T cells, regulatory T cells, γδT cells, etc. It can be any T cell at any stage of development. Other types of helper T cells include Th3 (Treg) cells, Th17 cells, Th9 cells, or Tfh cells. Other types of memory T cells include cells such as central memory T cells (Tcm cells), effector memory T cells (Tem cells and TEMRA cells). T cells can also refer to genetically modified T cells, such as T cells modified to express T cell receptors (TCR) or chimeric antigen receptors (CAR). T cells can also be differentiated from stem cells or progenitor cells.

[0162] "CD4+T cells" refers to a T cell subset that expresses CD4 on its surface and is associated with a cellular immune response. CD4+T cells are characterized by secretory properties after stimulation, which may include secretion of cytokines such as IFN-γ, TNF-α, IL-2, IL-4, and IL-10. "CD4" is a 55kD glycoprotein that was originally defined as a differentiation antigen on T lymphocytes, but is also present on other cells including monocytes / macrophages. The CD4 antigen is a member of the immunoglobulin superfamily and is considered to be an associated recognition element in the MHC (major histocompatibility complex) class II restricted immune response. On T lymphocytes, the CD4 antigen defines a helper / inducer subset.

[0163] "CD8+ T cells" refers to a subpopulation of T cells that express CD8 on their surface, are restricted by MHC class I, and function as cytotoxic T cells. The "CD8" molecule is a differentiation antigen present on thymocytes and cytotoxic and suppressor T lymphocytes. The CD8 antigen is a member of the immunoglobulin superfamily and is a cognate recognition element in the major histocompatibility complex class I restricted interaction.

[0164] As used herein, the phrase "hematopoietic stem cell" refers to a stem cell that can produce blood cells. Hematopoietic stem cells can give rise to cells of the myeloid or lymphoid lineages, or a combination thereof. Hematopoietic stem cells are primarily found in the bone marrow, but they can be isolated from peripheral blood or a portion thereof. Various cell surface markers can be used to identify, sort, or purify hematopoietic stem cells. In some cases, a hematopoietic stem cell is identified as c-kit. + Helin - In some cases, human hematopoietic stem cells are identified as CD34 + 、CD59+ , Thy1 / CD90 + 、CD38 lo / - 、C-kit / CD117 + ,lin - In some cases, human hematopoietic stem cells are identified as CD34 - 、CD59 + , Thy1 / CD90 + 、CD38 lo / - 、C-kit / CD117 + ,lin - In some cases, human hematopoietic stem cells are identified as CD133 + 、CD59 + , Thy1 / CD90 + 、CD38 lo / - 、C-kit / CD117 + ,lin - In some cases, mouse hematopoietic stem cells were identified as CD34 lo / - 、SCA-1 + 、Thy1 + / lo 、CD38 + 、C-kit + ,lin - In some cases, the hematopoietic stem cell is CD150 + CD48 - CD244 - .

[0165] As used herein, the phrase "hematopoietic cell" refers to a cell derived from a hematopoietic stem cell. Hematopoietic cells can be obtained or provided by separation from an organism, system, organ or tissue (e.g., blood or a portion thereof). Alternatively, hematopoietic stem cells can be separated and obtained or provided by differentiation of stem cells. Hematopoietic cells include cells that are differentiated into other cell types with limited potential. Such hematopoietic cells include, but are not limited to, multipotent progenitor cells, lineage-restricted progenitor cells, common bone marrow progenitor cells, granulocyte-macrophage progenitor cells or megakaryocyte-erythroid progenitor cells. Hematopoietic cells include cells of lymphatic and bone marrow lineages, such as lymphocytes, erythrocytes, granulocytes, monocytes and platelets.

[0166] As used herein, the term "construct" refers to a complex of molecules, including macromolecules or polynucleotides.

[0167] As used herein, the term "integration" refers to the process of stably inserting one or more nucleotides of a construct into a cell genome, for example, covalently linking to a nucleic acid sequence in a cell chromosome DNA. It may also refer to a nucleotide deletion at the integration site. In the case of a deletion at the insertion site, "integration" may also include replacing the missing endogenous sequence or nucleotide with one or more inserted nucleotides.

[0168] As used herein, the term "exogenous" refers to a molecule or activity that has been introduced into a host cell and is not native to the cell. For example, the molecule can be introduced by introducing the encoding nucleic acid into the host genetic material, such as by integration into the host chromosome, or as non-chromosomal genetic material such as a plasmid. Therefore, when used in conjunction with the expression of the encoding nucleic acid, the term refers to the introduction of the encoding nucleic acid into the cell in an expressible form. The term "endogenous" refers to a molecule or activity that is present in the host cell under natural, unedited conditions. Similarly, when used in conjunction with the expression of the encoding nucleic acid, the term refers to an encoding nucleic acid that is contained within the cell rather than introduced exogenously.

[0169] The term "heterologous" refers to a nucleic acid or polypeptide sequence or domain that is not native to the flanking sequence, eg, wherein the heterologous sequence is not found naturally coupled to the nucleic acid or polypeptide sequence occurring at one or both termini.

[0170] The term "homologous" refers to a nucleic acid or polypeptide sequence or domain native to the flanking sequence, for example, where the homologous sequence is found naturally coupled to a nucleic acid or polypeptide sequence occurring at one or both termini.

[0171] As used herein, "polynucleotide donor construct" refers to a nucleotide sequence (e.g., DNA sequence) that is genetically inserted into a polynucleotide and is exogenous to the polynucleotide. The polynucleotide donor construct is transcribed into RNA and optionally translated into a polypeptide. The polynucleotide donor construct may include a prokaryotic sequence, a cDNA from a eukaryotic mRNA, a genomic DNA sequence from a eukaryotic (e.g., mammalian) DNA, and a synthetic DNA sequence. For example, the polynucleotide donor construct may be a miRNA, a shRNA, a natural polypeptide (e.g., a naturally occurring polypeptide) or a fragment thereof, or a variant polypeptide (e.g., a natural polypeptide having less than 100% sequence identity with a natural polypeptide) or a fragment thereof.

[0172] As used herein, the term "complementary" or "complementarity" refers to specific base pairing between nucleotides or nucleic acids. Complementary nucleotides are generally A and T (or A and U) and G and C. The guide RNA described herein can comprise a sequence, such as a DNA targeting sequence that is perfectly complementary or substantially complementary (e.g., with 1-4 mismatches) to a genomic sequence in a cell.

[0173] As used herein, the term "transgenic" refers to a polynucleotide that has been transferred from one organism to another organism naturally or by any of a variety of genetic engineering techniques. It is optionally translated into a polypeptide. It is optionally translated into a recombinant protein. A "recombinant protein" is a protein encoded by a gene - recombinant DNA - that has been cloned in a system that supports gene expression and messenger RNA translation (see expression system). The recombinant protein can be a therapeutic agent, such as a protein that treats a disease or condition disclosed herein. As used, a transgenic can refer to a polynucleotide encoding a polypeptide.

[0174] The terms "protein," "polypeptide," and "peptide" are used interchangeably herein.

[0175] As used herein, the term "operably linked" or "operably connected" refers to the combination of a nucleic acid sequence and a single nucleic acid fragment so that one function is affected by another function. For example, if a promoter is able to affect the expression of a coding sequence or functional RNA (e.g., the coding sequence or functional RNA is under the transcriptional control of the promoter), then the promoter is operably linked to it. The coding sequence can be operably linked to the control sequence in both the sense and antisense directions.

[0176] As used herein, the term "developmental cell state" refers to, for example, a state in which a cell is inactive, actively expressing, differentiated, aged, etc. A developmental cell state may also refer to a cell in a precursor state (eg, a T cell precursor).

[0177] As used, the term "encoding" refers to a nucleic acid sequence encoding a target protein or polypeptide. The nucleic acid sequence can be a DNA molecule or an RNA molecule. In a preferred embodiment, the molecule is a DNA molecule. In other preferred embodiments, the molecule is an RNA molecule. When present as an RNA molecule, it will contain a sequence (e.g., a start codon, ATG) that guides the ribosome of the host cell to start translation and a sequence (e.g., a stop codon) that guides the ribosome to end translation. Between the start codon and the stop codon is an open reading frame (ORF). Such terms are known to those of ordinary skill in the art.

[0178] As used herein, the term "subject" refers to a mammalian subject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cattle, horses, camels, goats, rabbits, pigs, and sheep. In certain embodiments, the subject is a human. In some embodiments, the subject suffers from a disease or illness that can be treated with the engineered cells provided herein or a colony thereof. In some aspects, the disease or illness is cancer.

[0179] As used herein, the term "promoter" refers to a nucleotide sequence (e.g., DNA sequence) that can control the expression of a coding sequence or functional RNA. The promoter sequence is composed of proximal and more distal upstream elements, the latter element being generally referred to as an enhancer. The promoter can be entirely derived from a natural gene, can be composed of different elements from naturally occurring different promoters, and / or can comprise a synthetic DNA segment. As contemplated herein, the promoter can be endogenous for the target cell or exogenous for the target cell. It will be appreciated by those skilled in the art that different promoters can be in different tissues or cell types, or at different developmental stages, or in response to different environmental conditions to induce gene expression. As known in the art, promoters can be selected according to the strength of the promoter and / or the conditions under which the promoter has activity, for example, constitutive promoters, strong promoters, weak promoters, inducible / repressible promoters, tissue-specific or developmentally regulated promoters, cell cycle-dependent promoters, etc.

[0180] The promoter may be an inducible promoter (e.g., a heat shock promoter, a tetracycline-regulated promoter, a steroid-regulated promoter, a metal-regulated promoter, an estrogen receptor-regulated promoter, etc.). The promoter may be a constitutive promoter (e.g., a CMV promoter, a UBC promoter). In some embodiments, the promoter may be a spatially restricted and / or temporally restricted promoter (e.g., a tissue-specific promoter, a cell type-specific promoter, etc.). See, e.g., U.S. Publication No. 20180127786, the disclosure of which is incorporated herein by reference in its entirety.

[0181] As contemplated herein, gene editing may involve gene (or nucleotide sequence) knock-in or knock-out. As used herein, the term "knock-in" refers to adding a DNA sequence or a fragment thereof to a genome. Such DNA sequences to be knocked in may include one or more complete genes, and may include regulatory sequences associated with any part or fragment of a gene or the aforementioned gene. For example, a polynucleotide donor construct encoding a recombinant protein may be inserted into the genome of a cell carrying a mutant gene. In some embodiments, the knock-in strategy involves replacing an existing sequence with a provided sequence, such as replacing a mutant allele with a wild-type copy. On the other hand, the term "knock-out" refers to the elimination of a gene or gene expression. For example, a gene can be knocked out by deleting or adding a nucleotide sequence that causes a reading frame to be destroyed. For another example, a gene can be knocked out by replacing a part of a gene with an unrelated (e.g., non-coding) sequence.

[0182] As used herein, the term "non-homologous end joining" or NHEJ refers to a cellular process in which the cut or nicked ends of a DNA strand are joined directly without the need for a homologous template nucleic acid. NHEJ can result in the addition, deletion, substitution, or combination thereof of one or more nucleotides at the repair site.

[0183] As used herein, the term "homologous directed repair" or HDR refers to a cellular process that repairs the cut or gap end of a DNA chain by polymerizing from a homologous template nucleic acid. Therefore, the original sequence is replaced by the sequence of the template. The homologous template nucleic acid can be provided by homologous sequences (sister chromatids, homologous chromosomes, or duplicate regions on the same or different chromosomes) at other locations in the genome. Alternatively, an exogenous template nucleic acid can be introduced to obtain a change in the sequence induced by a specific HDR at the target site. In this way, a specific mutation can be introduced at the cleavage site.

[0184] As used herein, a single-stranded DNA template or a double-stranded DNA template refers to a DNA oligonucleotide that can be used as a template for HDR by a cell. Generally speaking, the single-stranded DNA template or the double-stranded DNA template has at least one region homologous to the target site. In some cases, the single-stranded DNA template or the double-stranded DNA template has two homologous regions located on both sides of the region containing the heterologous sequence to be inserted at the target cleavage site.

[0185] The terms "vector" and "plasmid" are used interchangeably and as used herein refer to a polynucleotide vector that can be used to introduce genetic material into a cell. A vector can be linear or circular. A vector can be integrated into a target genome of a host cell or replicate independently in a host cell. A vector can include, for example, an origin of replication, a multiple cloning site, and / or a selective marker. An expression vector typically includes an expression cassette. Vectors and plasmids include, but are not limited to, integration vectors, prokaryotic plasmids, eukaryotic plasmids, plant synthetic chromosomes, episomes, cosmids, and artificial chromosomes.

[0186] As used herein, the phrase "introducing" in the context of introducing a nucleic acid or a complex comprising a nucleic acid, such as an RNP-DNA template complex, refers to a translocation of a nucleic acid sequence or RNP-DNA template complex from extracellular to intracellular. In some cases, introducing refers to a translocation of a nucleic acid or complex from extracellular to intranuclear. The various methods of this translocation are contemplated, including but not limited to electroporation, contact with nanowires or nanotubes, receptor-mediated internalization, translocation by cell-penetrating peptides, liposome-mediated translocation, etc.

[0187] As used herein, the term "expression cassette" is a polynucleotide construct produced in a recombinant or synthetic manner that includes a regulatory sequence that is operably linked to a selected polynucleotide to promote expression of the selected polynucleotide in a host cell. For example, the regulatory sequence can promote transcription of the selected polynucleotide in a host cell, or transcription and translation of the selected polynucleotide in a host cell. The expression cassette can, for example, be integrated into the genome of the host cell or present in an expression vector.

[0188] As used herein, the phrase "a subject in need thereof" refers to a subject exhibiting and / or diagnosed with one or more symptoms or signs of a disease or disorder as described herein.

[0189] "Chemotherapeutic agents" refer to chemical compounds that can be used to treat cancer. Chemotherapeutic agents include "anti-hormonal agents" or "endocrine therapeutic agents" that are used to modulate, reduce, block, or inhibit the effects of hormones that can promote cancer growth.

[0190] The term "composition" refers to a mixture containing, for example, engineered cells or proteins contemplated herein. In some embodiments, the composition may contain additional components, such as adjuvants, stabilizers, excipients, etc. The term "composition" or "pharmaceutical composition" refers to a preparation in a form that permits the biological activity of the active ingredients contained therein to be effective in treating a subject, and which does not contain other components that are unacceptably toxic to a subject in the amounts provided in the pharmaceutical composition.

[0191] The term "in situ" refers to a process occurring in a living cell that is grown separately from a living organism, for example, grown in tissue culture.

[0192] The term "in vivo" refers to processes that occur in a living organism.

[0193] As used herein, the term "ex vivo" generally includes experiments or measurements performed in or on living tissue, preferably in an artificial environment outside of an organism, preferably with minimal differences from natural conditions.

[0194] As used herein, the term "mammal" includes humans and non-humans, and includes, but is not limited to, humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.

[0195] In the context of two or more nucleic acids or polypeptide sequences, the term "identity" percentage refers to two or more sequences or subsequences that have a specified percentage of identical nucleotides or amino acid residues when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to the skilled person) or by visual inspection. Depending on the application, the "identity" percentage can be present in a region of the sequence being compared, e.g., in a functional domain, or alternatively in the full length of the two sequences to be compared.

[0196] For sequence comparison, usually a sequence serves as a reference sequence for comparison with a test sequence. When using a sequence comparison algorithm, the test sequence and the reference sequence are input into a computer, subsequence coordinates are specified (if necessary), and sequence algorithm program parameters are specified. The sequence comparison algorithm then calculates the sequence identity percentages of one or more test sequences relative to the reference sequence based on the specified program parameters.

[0197] It can be performed, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981); by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970); by the similarity search method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988); by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.); or by visual inspection (see generally Ausubel et al., below).

[0198] An example of an algorithm suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ).

[0199] The term "sufficient amount" means an amount sufficient to produce a desired effect, such as an amount sufficient to modulate protein aggregation in a cell.

[0200] The term "therapeutically effective amount" is an amount effective to ameliorate symptoms of a disease.

[0201] The term "amelioration" refers to any therapeutically beneficial result in the treatment of a disease state (eg, a cancer disease state), a decrease in the severity or progression of the disease state, amelioration, remission, or cure.

[0202] As used herein, the term "effective amount" refers to an amount of a compound (e.g., a composition described herein, a cell described herein) sufficient to achieve a beneficial or desired result. An effective amount can be administered in one or more administrations, applications or dosages, and is not intended to be limited to a specific formulation or route of administration.

[0203] As used herein, the term "treat," "treat," "treat," and "treating" include any action that results in improvement of, or ameliorates, symptoms of, a disorder, disease, condition, and the like, such as alleviating, reducing, modulating, improving, or eliminating.

[0204] The terms "modulate" and "modulation" refer to the decrease or inhibition, or alternatively, the activation or increase of the recited variable.

[0205] The terms "increase" and "activate" refer to an increase of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold or more of the recited variable.

[0206] The terms "reduce" and "inhibit" refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or more reduction in the recited variable.

[0207] It must be noted that, as used in the specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0208] Logic Gate System

[0209] As used herein, "logic gate", "loop", "loop receptor", "system" or "system receptor" refers to a two-part protein expression system comprising a trigger receptor and a chimeric antigen receptor. The system can be encoded on at least one nucleic acid inserted into a cell, where the trigger receptor is expressed in the cell. When the trigger receptor binds to its target antigen, the intracellular domain of the trigger receptor is cleaved from the transmembrane domain. The intracellular domain can then be translocated into the nucleus, inducing expression of the chimeric antigen receptor in the nucleus. Synthetic pathway activators can also be used to enhance the expansion and activity of T cells expressing logic gates (LG T cells).

[0210] An overview of an exemplary logic gate system employing synthetic pathway activators is shown in Figure 1 In various embodiments, the system includes four steps leading to T cell activation: (1) synthetic pathway activator (SPA) and priming receptor (primeR) are constitutively expressed; (2) primeR is triggered, resulting in cleavage of the intracellular domain; (3) the cleaved primeR intracellular domain induces the expression of CAR; (4) CAR is activated, resulting in T cell activation.

[0211] On the one hand, provided herein is a system comprising a priming receptor bound to ALPG / P, a chimeric antigen receptor bound to MSLN, and a cytokine and / or a synthetic pathway activator that activates cytokine signaling, wherein the transcription factor of the intracellular domain of the priming receptor is capable of inducing the expression of CAR. Such systems may alternatively be referred to as "logic gates" or "loops". In some aspects, the system is encoded by a nucleic acid transgene inserted into an immune cell. The system may be encoded on a single nucleic acid insert or fragment comprising two transgenes, or may be encoded on two nucleic acids encoding the system transgene separately. The priming receptor, SPA, and CAR of the system may be placed on a single nucleic acid in any order. For example, the priming receptor may be at the 5' end, the SPA may be immediately after the SPA of the priming receptor, and the CAR may be at the 3' end; or the SPA may be at the 5' end, the priming receptor may be immediately after the SPA, and the CAR may be at the 3' end; or the CAR may be at the 5' end, and the SPA may be after the CAR and the priming receptor may be at the 3' end; or the CAR may be at the 5' end, and the SPA may be after the CAR and the priming receptor may be at the 3' end; or the CAR may be at the 5' end, and the priming receptor may be after the CAR and the SPA may be at the 3' end.

[0212] A constitutive promoter may be operably linked to a nucleotide sequence encoding a start receptor and / or SPA. Nucleic acids encoding SPA and start receptors may be under the control of a single promoter. An inducible promoter may also be operably linked to a nucleotide sequence encoding a CAR. Nucleic acids encoding CAR and SPA may be under the control of a separate inducible promoter (e.g., a first inducible promoter and a second inducible promoter). The first inducible promoter and the second inducible promoter may be the same or different. In some embodiments, when the system is encoded on a single nucleic acid insert or fragment comprising two transgenes, the nucleic acid may include in the 5' to 3' direction: a constitutive promoter; a nucleotide sequence encoding a start receptor; an inducible promoter; and a nucleotide sequence encoding a chimeric antigen receptor. Alternatively, the nucleic acid may include in the 5' to 3' direction: an inducible promoter; a nucleotide sequence encoding a chimeric antigen receptor; a constitutive promoter; and a nucleotide sequence encoding a start receptor. SPA may be present in the upstream or downstream of the start receptor and / or CAR.

[0213] Activate receptor

[0214] Provided herein is a priming receptor comprising an extracellular antigen binding domain that specifically binds to placental / germ cell alkaline phosphatase (ALPG / P); ALPP: NCBI Entrez gene: 250, UniProtKB / Swiss-Prot: P05187, SEQ ID NO: 176; ALPG: NCBI Entrez gene: 251, UniProtKB / Swiss-Prot: P10696, SEQ ID NO: 177). In some embodiments, the priming receptor comprises an extracellular antigen binding domain that specifically binds to placental alkaline phosphatase (ALPP). In some embodiments, the priming receptor comprises an extracellular antigen binding domain that specifically binds to germ cell alkaline phosphatase (ALPG). As used herein, "placental / germ cell alkaline phosphatase (ALPG / P)" refers to both placental alkaline phosphatase (ALPP) and germ cell alkaline phosphatase (ALPG). The antigen binding domain that specifically binds to ALPG / P can specifically bind to ALPG and / or ALPP.

[0215] In some embodiments, the priming receptor comprises the sequence set forth in SEQ ID NO: 24. In some embodiments, the priming receptor comprises the sequence set forth in SEQ ID NO: 25.

[0216] In certain aspects of the present disclosure, the initiating receptor is a synthetic receptor based on Notch protein. The binding of natural Notch receptors to cognate ligands (such as ligands from the Delta protein family) can lead to intramembrane proteolysis, thereby cleaving the intracellular fragment of Notch protein. The intracellular fragment is a transcriptional regulator that only works after being cleaved from Notch. Cleavage can occur by sequential proteolysis of ADAM metalloproteinases and γ-secretase complexes. The intracellular fragment enters the nucleus and activates cell-cell signaling genes. Compared with natural Notch protein, synthetic Notch initiating receptors replace natural Notch intracellular fragments with fragments that cause genes encoding selected proteins (such as CAR) to be transcribed when the intracellular fragments are released from the initiating receptor.

[0217] Notch receptors have modular domain organization. The extracellular domain of Notch receptors consists of a series of N-terminal epidermal growth factor (EGF)-like repeats responsible for ligand binding. In synthetic Notch receptors or initiating receptors, the Notch ligand binding domain is replaced by a ligand binding domain that binds a selected target ligand or antigen. The EGF repeats are followed by three LIN-12 / Notch repeats (LNR) modules, which are unique to Notch receptors and are widely reported to be involved in preventing premature receptor activation. The heterodimerization (HD) domain of Notchl is separated by furin cleavage, so that its N-terminal portion terminates the extracellular subunit, and its C-terminal half constitutes the starting point of the transmembrane subunit. After the extracellular region, the receptor has a transmembrane segment and an intracellular domain (ICD), which includes transcriptional regulators.

[0218] Various forms of trigger receptors can be used in the methods, cells and nucleic acids described herein. It is contemplated that a class of trigger receptors for use in the methods and cells herein comprises a heterologous extracellular ligand binding domain, a connecting polypeptide having substantial sequence identity with a Notch receptor including an NRR, a TMD and an ICD. The "Fn Notch" receptor comprises a heterologous extracellular ligand binding domain, a connecting polypeptide having substantial sequence identity with a Robo receptor (such as mammalian Robol, Robo2, Robo3 or Robo4), followed by 1, 2 or 3 fibronectin repeats ("Fn"), a TMD and an ICD. The "Mini Notch" receptor comprises a heterologous extracellular ligand binding domain, a connecting polypeptide having substantial sequence identity with a Notch receptor (lacking an NRR), a TMD and an ICD. The "Minimal Linker Notch" receptor comprises a heterologous extracellular ligand binding domain, a connecting polypeptide having substantial sequence identity with a Notch receptor (e.g., a synthetic (GGS) n "Hinge Notch" receptors include a heterologous extracellular ligand binding domain, a hinge sequence including an oligomerization domain (e.g., a domain that promotes dimerization, trimerization, or higher multimerization with a synthetic receptor and / or an existing host receptor), a TMD, and an ICD. All of these receptor classes are synthetic, recombinant, and do not exist naturally. In some embodiments, the non-naturally occurring receptors disclosed herein bind to ligands displayed on the surface of target cells, which trigger proteolytic cleavage of the receptor and the release of transcriptional regulators that regulate the customized transcriptional program in the cell. In some embodiments, the initiating receptor does not include the LIN-12-Notch repeat sequence (LNR) and / or the heterologous dimerization domain (HD) of the Notch receptor.

[0219] Trigger receptor extracellular domain

[0220] The activation receptor disclosed herein comprises an extracellular domain that specifically binds to placental / germ cell alkaline phosphatase (ALPG / P). In some embodiments, the extracellular domain comprises a ligand binding portion of the receptor. In some embodiments, the extracellular domain comprises an antigen binding portion that binds to one or more target antigens. In some embodiments, the antigen binding portion comprises one or more antigen binding determinants of an antibody or its functional antigen binding fragment. In some embodiments, the antigen binding portion is selected from antibodies, nanobodies, double antibodies, three antibodies or mini antibodies, F(ab')2 fragments, Fab fragments, single-chain variable fragments (scFv) and single domain antibodies (sdAb) or their functional fragments. In some embodiments, the antigen binding portion comprises scFv. The antigen binding portion may include a naturally occurring amino acid sequence or may be engineered, designed or modified to provide desired and / or improved properties, such as increased binding affinity.

[0221] Trigger receptor CDR, VH, VL domains

[0222] In some aspects, the triggering receptor extracellular antigen binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, wherein the variable heavy (VH) chain sequence comprises three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, and the variable light (VL) chain sequence comprises three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence shown in SEQ ID NO: 1, 39, 40, 41 or 42, CDR-H2 comprises the sequence shown in SEQ ID NO: 2, 43, 44, 45 or 46, CDR-H3 comprises the sequence shown in SEQ ID NO: 3, 47 or 48, CDR-L1 comprises the sequence shown in SEQ ID NO: 4, 49 or 50, CDR-L2 comprises the sequence shown in SEQ ID NO: 5 or 51, and CDR-L3 comprises the sequence shown in SEQ ID NO: 6 or 53. In some embodiments, the VH chain sequence comprises the sequence shown in SEQ ID NO: 7. In some embodiments, VL comprises the sequence set forth in SEQ ID NO: 8. In some embodiments, the extracellular domain comprises the sequence set forth in SEQ ID NO:9.

[0223] In some embodiments, the CDR-H3 of the triggering receptor extracellular antigen binding domain is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-H3 of SEQ ID NO: 3, 47 or 48, the CDR-H2 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-H2 of SEQ ID NO: 2, 43, 44, 45 or 46, the CDR-H1 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-H1 of SEQ ID NO: 1, 39, 40, 41 or 42, the CDR-L3 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-L3 of SEQ ID NO: 6 or 53, and the CDR-L2 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-L3 of SEQ ID NO: 6 or 53. The CDR-L2 of NO:5 or 51 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical, and the CDR-L1 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-L1 of SEQ ID NO:4. In some embodiments, CDR-H3 is CDR-H3 of SEQ ID NO: 3, 47 or 48 having up to 1, 2, 3, 4, 5, 6, 7 or 8 amino acid substitutions; CDR-H2 is CDR-H2 of SEQ ID NO: 2, 43, 44, 45 or 46 having up to 1, 2, 3, 4 or 5 amino acid substitutions; CDR-H1 is CDR-H1 of SEQ ID NO: 1, 39, 40, 41 or 42 having up to 1, 2, 3, 4 or 5 amino acid substitutions; CDR-L3 is CDR-L3 of SEQ ID NO: 6 or 53 having up to 1, 2, 3, 4 or 5 amino acid substitutions; CDR-L2 is CDR-L3 of SEQ ID NO: 6 or 53 having up to 1, 2, 3 or 4 amino acid substitutions. NO:5 or 51; and CDR-L1 is CDR-L1 of SEQ ID NO:4 having up to 1, 2, 3, 4, 5 or 6 amino acid substitutions.

[0224] In some embodiments, the trigger receptor extracellular antigen binding domain provided herein comprises one to three CDRs of the VH domain as shown in SEQ ID NO: 7. In some embodiments, the antigen binding domain provided herein comprises two to three CDRs of the VH domain as shown in SEQ ID NO: 7. In some embodiments, the antigen binding domain provided herein comprises three CDRs of the VH domain as shown in SEQ ID NO: 7. In some aspects, the CDRs are Kabat CDRs. In some aspects, the CDRs are Chothia CDRs. In some aspects, the CDRs are AbM CDRs. In some aspects, the CDRs are Contact CDRs. In some aspects, the CDRs are IMGT CDRs.

[0225] In some embodiments, the trigger receptor extracellular antigen binding domain provided herein comprises a VH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95% or 99% identity with the VH sequence shown in SEQ ID NO: 7. In some embodiments, the antigen binding domain provided herein comprises a VH sequence provided by SEQ ID NO: 7 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen binding domains described in this paragraph are referred to herein as "variants". In some embodiments, such variants are obtained from the sequences provided herein, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not obtained from the sequences provided herein, and can be isolated de novo, for example, according to the methods provided herein for obtaining antibodies or antigen binding domains.

[0226] In some embodiments, the trigger receptor extracellular antigen binding domain provided herein comprises one to three CDRs of the VL domain as shown in SEQ ID NO:8. In some embodiments, the antigen binding domain provided herein comprises two to three CDRs of the VL domain as shown in SEQ ID NO:8. In some embodiments, the antigen binding domain provided herein comprises three CDRs of the VL domain as shown in SEQ ID NO:8. In some aspects, the CDR is a Kabat CDR. In some aspects, the Kabat VH CDR is provided with the sequence shown in SEQ ID NO:40, 44 and 3, and the Kabat VL CDR is provided with the sequence shown in SEQ ID NO:4, 5 and 6. In some aspects, the CDR is a Chothia CDR. In some aspects, the ChothiaVH CDR is provided with the sequence shown in SEQ ID NO:1, 2, and the Chothia VL CDR is provided with the sequence shown in SEQ ID NO:4, 5 and 6. In some aspects, the CDR is an AbM CDR. In some aspects, the AbM VH CDRs are provided as shown in SEQ ID NOs: 39, 43 and 3, and the AbM VL CDRs are provided as shown in SEQ ID NOs: 4, 5 and 6. In some aspects, the CDRs are Contact CDRs. In some aspects, the Contact VH CDRs are provided as shown in SEQ ID NOs: 41, 45 and 47, and the Contact VL CDRs are provided as shown in SEQ ID NOs: 49, 51 and 53. In some aspects, the CDRs are IMGT CDRs. In some aspects, the IMGT VH CDRs are provided as shown in SEQ ID NOs: 42, 46 and 48, and the IMGT VL CDRs are provided as shown in SEQ ID NOs: 50, 52 and 6.

[0227] In some embodiments, the extracellular antigen binding domain of the activating receptor provided herein comprises a VL sequence having at least about 50%, 60%, 70%, 80%, 90%, 95% or 99% identity with the VL sequence shown in SEQ ID NO: 8. In some embodiments, the antigen binding domain provided herein comprises a VL sequence provided by SEQ ID NO: 8 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to herein as "variants". In some embodiments, such variants are obtained from the sequences provided herein, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not obtained from the sequences provided herein, and can be isolated de novo, for example, according to the methods provided herein for obtaining antibodies or antigen binding domains.

[0228] Table B provides the CDR sequences of the VH and VL of exemplary ALPG / P antigen binding domains according to the indicated numbering scheme.

[0229]

[0230]

[0231] Transmembrane domain

[0232] As described above, the trigger receptor includes a transmembrane domain (TMD) that contains one or more ligand-inducible proteolytic cleavage sites.

[0233] In some embodiments, the TMD comprises a Notch1 transmembrane domain. In some embodiments, the transmembrane domain comprises the sequence shown in SEQ ID NO:19.

[0234] In general, the TMD suitable for the chimeric receptor disclosed herein can be any transmembrane domain of a type 1 transmembrane receptor including at least one γ-secretase cleavage site. A detailed description of the structure and function of the γ-secretase complex and its substrate proteins (including amyloid precursor protein (APP) and Notch) can be found, for example, in a review recently published by Zhang et al. in Frontiers Cell Neurosci (2014). Non-limiting suitable TMDs from type 1 transmembrane receptors include TMDs from CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HLA-A and IFNAR2, wherein the TMD includes at least one γ-secretase cleavage site. Additional TMDs suitable for use in the compositions and methods described herein include, but are not limited to, transmembrane domains from the type 1 transmembrane receptor IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCNE3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DCT, YASN, FLT1, CDH5, PKHD1, NECTIN1, PCDHGC3, NRG1, LRP1B, CDH2, NRG2, PTPRK, SCN2B, Nradd, and PTPRM. In some embodiments, the TMD of the chimeric polypeptide or Notch receptor of the present disclosure is a TMD derived from a TMD of a member of the calsyntenin family (such as alcadein α and alcadein γ). In some embodiments, the TMD of the chimeric polypeptide or Notch receptor of the present invention is a TMD known for Notch receptors. In some embodiments, the TMD of the chimeric polypeptide or Notch receptor of the present invention is a TMD derived from a different Notch receptor. For example, in Mini Notch based on human Notchl, Notchl TMD can be replaced with Notch2 TMD, Notch3 TMD, Notch4 TMD or Notch TMD from non-human animals (such as zebrafish, Drosophila melanogaster, Xenopus or Gallus gallus domesticus).

[0235] In some embodiments, the initiating receptor comprises a Notch cleavage site, such as S2 or S3. Additional proteolytic cleavage sites suitable for the compositions and methods disclosed herein include, but are not limited to, ADAM10, metalloproteinase cleavage sites of the following MMPs: collagenase 1, 2 and 3 (MMP-1, -8 and -13), gelatinase A and B (MMP-2 and -9), stromelysin 1, 2 and 3 (MMP-3, -10 and -11), matrix lysin (MMP-7) and membrane metalloproteinases (MT1-MMP and MT2-MMP). Another example of a suitable protease cleavage site is a plasminogen activator cleavage site, such as a urokinase plasminogen activator (uPA) or a tissue plasminogen activator (tPA) cleavage site. Another example of a suitable protease cleavage site is a prolactin cleavage site. Specific examples of cleavage sequences of uPA and tPA include sequences comprising Yal-Gly-Arg. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is a tobacco etch virus (TEV) protease cleavage site, such as Glu-Asn-Leu-Tyr-Thr-Gln-Ser (SEQ ID NO: 182), wherein the protease cleaves between glutamine and serine. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is an enterokinase cleavage site, such as Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 183), wherein cleavage occurs after a lysine residue. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is a thrombin cleavage site, such as Leu-Val-Pro-Arg (SEQ ID NO: 184). Other suitable linkers that include a protease cleavage site include sequences that can be cleaved by the following proteases: PreScission TMProtease (comprising a fusion protein of human rhinovirus 3C protease and glutathione-S-transferase), thrombin, cathepsin B, Epstein-Barr virus protease, MMP-3 (stromelysin), MMP-7 (matrilysin), MMP-9; thermolysin-like MMP, matrix metalloproteinase 2 (MMP-2), cathepsin L; cathepsin D, matrix metalloproteinase 1 (MMP-1), urokinase-type plasminogen activator, membrane type 1 matrix metalloproteinase (MT-MMP), stromelysin 3 (or MMP-11), thermolysin, fibroblast collagenase and stromelysin 1, matrix metalloproteinase 13 (collagenase 3), tissue-type plasminogen activator (tPA), human prostate-specific antigen, kallikrein (hK3), neutrophil elastase, and calpain (calcium-activated neutral protease). Proteases native to host cells that do not express the receptor (e.g., TEV) can be used as a further regulatory mechanism, where activation of the receptor is reduced until the protease is expressed or otherwise provided. In addition, proteases may be tumor-associated or disease-associated (expressed at levels significantly higher than in normal tissues) and serve as independent regulatory mechanisms. For example, some matrix metalloproteinases are highly expressed in certain cancer types.

[0236] In some embodiments, amino acid substitutions within the TMD include one or more substitutions within the "GV" motif of the TMD. In some embodiments, at least one of such substitutions includes substitutions to alanine. Additional sequences and substitutions are described in WO2021061872, which is hereby incorporated by reference in its entirety.

[0237] Intracellular domain

[0238] In some embodiments, the initiator receptor comprises one or more intracellular domains from or derived from a transcriptional regulator and / or a DNA binding domain. In some embodiments, the intracellular domain comprises a Gal4 / VP64 domain. In some embodiments, the intracellular domain comprises a sequence shown in SEQ ID NO: 23.

[0239] Transcriptional regulators activate or inhibit the transcription of homologous promoters. Transcriptional activators usually bind to transcriptional promoters near them and recruit RNA polymerase to directly initiate transcription. Transcriptional repressors bind to transcriptional promoters and spatially hinder the transcriptional initiation of RNA polymerase. Other transcriptional regulators act as activators or repressors according to their binding positions and cell conditions. Therefore, as used herein, "transcriptional activation domain" refers to the domain of a transcriptional factor that interacts with a transcriptional control element and / or a transcriptional regulatory protein (e.g., a transcription factor, RNA polymerase, etc.) to increase and / or activate the transcription of one or more genes. Non-limiting examples of transcriptional activation domains include: herpes simplex virus VP16 activation domain, VP64 (which is a tetrameric derivative of VP16), HIV TAT, NFkB p65 activation domain, p53 activation domains 1 and 2, CREB (cAMP response element binding protein) activation domain, E2A activation domain, NFAT (nuclear factor of activated T cells) activation domain, yeast Gal4, yeast GCN4, yeast HAP1, MLL, RTG3, GLN3, OAF1, PIP2, PDR1, PDR3, PHO4, LEU3 glucocorticoid receptor transcriptional activation domain, B cell POU homeodomain protein Oct2, plant Ap2, or any other domain known to those skilled in the art or ordinary technicians. In some embodiments, the transcriptional regulator is selected from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-YP64, Gal4-KRAB and HAP1-VP16. In some embodiments, the transcriptional regulator is Gal4-VP64. The transcriptional activation domain may comprise a wild-type or naturally occurring sequence, or it may be a modified, mutated or derived form of the original transcriptional activation domain, with the desired ability to increase and / or activate transcription of one or more genes. In some embodiments, the transcriptional regulator may also include a nuclear localization signal.

[0240] In some embodiments, the initiating receptor comprises one or more intracellular "DNA binding domains" (or "DB domains"). Such "DNA binding domains" refer to sequence-specific DNA binding domains that bind to specific DNA sequence elements. Therefore, as used herein, "sequence-specific DNA binding domains" refer to protein domain portions that have the ability to selectively bind to DNA having a specific predetermined sequence. The sequence-specific DNA binding domain may comprise a wild-type or naturally occurring sequence, or it may be a modified, mutated, or derived form of the original domain that has the desired ability to bind to a desired sequence. In some embodiments, the sequence-specific DNA binding domain is engineered to bind to a desired sequence. Non-limiting examples of proteins with sequence-specific DNA binding domains that can be used in the synthetic proteins described herein include HNF1a, Gal4, GCN4, reverse tetracycline receptor, THY1, SYN1, NSE / RU5′, AGRP, CALB2, CAMK2A, CCK, CHAT, DLX6A, EMX1, zinc finger proteins or domains thereof, CRISPR / Cas proteins such as Cas9, Cas3, Cas4, Cas5, Cas5e (or CasD), Cash, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu196, and TALES.

[0241] In those embodiments using CRISPR / Cas-like proteins, the CRISPR / Cas-like proteins can be wild-type CRISPR / Cas proteins, modified CRISPR / Cas proteins, or fragments of wild-type or modified CRISPR / Cas proteins. CRISPR / Cas-like proteins can be modified to increase nucleic acid binding affinity and / or specificity, change enzyme activity, and / or change another property of the protein. For example, the nuclease (e.g., DNase, RNase) domain of the CRISPR / Cas-like protein can be modified, deleted, or inactivated. Alternatively, the CRISPR / Cas-like protein can be truncated to remove domains that are not essential for the function of the system described herein. For example, a CRISPR enzyme used as a DNA binding protein or its domain can be mutated relative to the corresponding wild-type enzyme so that the mutated CRISPR or its domain lacks the ability to cleave a nucleic acid sequence containing a DNA binding domain target site. For example, the D10A mutation can be combined with one or more of the H840A, N854A, or N863A mutations to produce a Cas9 enzyme that is substantially lacking all DNA cleavage activity.

[0242] Juxtamembrane domain

[0243] The ECD and TMD, or the TMD and ICD, may be connected to each other with a connecting polypeptide such as a juxtamembrane domain. A "SynNotch" or synthetic Notch receptor comprises a heterologous extracellular ligand binding domain, a connecting polypeptide having substantial sequence identity to a Notch receptor JMD (including NRR), a TMD, and an ICD. A "Fn Notch" receptor comprises a heterologous extracellular ligand binding domain, a connecting polypeptide having substantial sequence identity to a Robo receptor (such as mammalian Robol, Robo2, Robo3, or Robo4), followed by 1, 2, or 3 fibronectin repeats ("Fn"), a TMD, and an ICD. A "Mini Notch" receptor comprises a heterologous extracellular ligand binding domain, a connecting polypeptide having substantial sequence identity to a Notch receptor JMD (but lacking an NRR (LIN-12-Notch repeat (LNR) module), a TMD, and an ICD. A "Minimal Linker Notch" receptor comprises a heterologous extracellular ligand binding domain, a connecting polypeptide having substantial sequence identity to a Notch receptor (for example, but not limited to, a synthetic (GGS) n The "Hinge Notch" receptor comprises a connecting polypeptide, a TMD and an ICD that lack substantial sequence identity to a polypeptide sequence. The "Hinge Notch" receptor comprises a heterologous extracellular ligand binding domain, a hinge sequence comprising an oligomerization domain (e.g., a domain that promotes dimerization, trimerization or higher multimerization with synthetic receptors and / or existing host receptors), a TMD and an ICD.

[0244] In some embodiments, the start receptor comprises a juxtamembrane domain (JMD) peptide between the extracellular domain and the transmembrane domain. In some embodiments, the start receptor comprises a juxtamembrane domain (JMD) peptide between the transmembrane domain and the intracellular domain. In some embodiments, the JMD peptide comprises an LWF motif. The use of the LWF motif in the receptor construct is described in U.S. Patent No. 10,858,443, which is hereby incorporated by reference in its entirety. In some embodiments, the JMD peptide has substantial sequence identity with the JMD of Notchl, Notch2, Notch3 and / or Notch4. In some embodiments, the JMD peptide has substantial sequence identity with Notchl, Notch2, Notch3 and / or Notch4 JMD, but does not include the LIN-12-Notch repeats (LNR) and / or heterodimerization domains (HD) of the Notch receptor. In some embodiments, the JMD peptide does not have substantial sequence identity with Notchl, Notch2, Notch3 and / or Notch4 JMD. In some embodiments, the JMD peptide includes an oligomerization domain that promotes the formation of dimers, trimers, or higher order combinations of the receptor. Such JMD peptides are described in WO2021061872, which is hereby incorporated by reference in its entirety.

[0245] In the Mini Notch receptor, the connecting polypeptide is derived from the Notch JMD sequence after the NRR and HD domains are deleted. The Notch JMD sequence can be a sequence from Notchl, Notch2, Notch3 or Notch4, and can be derived from non-human homologs, such as those from Drosophila, Gallus gallus, Danio spp., etc. The remaining 4 to 50 amino acid residues of the Notch sequence can be used as a polypeptide linker. In some embodiments, the length and amino acid composition of the linker polypeptide sequence are changed to change the direction and / or proximity of the ECD and TMD relative to each other, thereby achieving the desired activity of the chimeric polypeptide, such as inducing the level of signal transduction in the presence or absence of a ligand.

[0246] In the Minimal Linker Notch receptor, the connecting polypeptide has no substantial sequence identity with the Notch JMD sequence (including Notch JMD sequences from Notchl, Notch2, Notch3 or Notch4, or non-human homologs thereof). 4 to 50 amino acid residues can be used as polypeptide linkers. In some embodiments, the length and amino acid composition of the linker polypeptide sequence are changed to change the direction and / or proximity of the ECD and TMD relative to each other, thereby achieving the desired activity of the chimeric polypeptide of the present disclosure. The Minimal Linker sequence can be designed to include or omit a protease cleavage site, and can include or omit a glycosylation site or a site for other types of post-translational modifications. In some embodiments, the Minimal Linker does not contain a protease cleavage site or a glycosylation site.

[0247] In some embodiments, the start receptor also includes a hinge. The hinge joint that can be used to start the receptor can include an oligomerization domain (e.g., a hinge domain) containing one or more polypeptide motifs that promote the formation of oligomers of chimeric polypeptides by intermolecular disulfide bonds. In these cases, in the chimeric receptor disclosed herein, the hinge domain generally includes a flexible polypeptide connection region disposed between ECD and TMD. Therefore, the hinge domain provides flexibility between ECD and TMD, and also provides a site for intermolecular disulfide bonds between two or more chimeric polypeptide monomers to form an oligomeric complex. In some embodiments, the hinge domain includes a motif that promotes dimer formation of chimeric polypeptides disclosed herein. In some embodiments, the hinge domain includes a motif that promotes trimer formation of chimeric polypeptides disclosed herein (e.g., a hinge domain derived from OX40). Hinge polypeptide sequences suitable for the compositions and methods of the present disclosure may be naturally occurring hinge polypeptide sequences (e.g., those sequences from naturally occurring immunoglobulins) or may be engineered, designed or modified to provide desired and / or improved properties, e.g., regulating transcription. Suitable hinge polypeptide sequences include, but are not limited to, those derived from IgA, IgD, and IgG subclasses, such as IgG1 hinge domains, IgG2 hinge domains, IgG3 hinge domains, and IgG4 hinge domains, or functional variants thereof. In some embodiments, the hinge polypeptide sequence contains one or more CXXC motifs. In some embodiments, the hinge polypeptide sequence contains one or more CPPC motifs (SEQ ID NO: 185).

[0248] Hinge polypeptide sequences may also be derived from CD8α hinge domains, CD28 hinge domains, CD152 hinge domains, PD-1 hinge domains, CTLA4 hinge domains, OX40 hinge domains, and functional variants thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from a CD8α hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from a CD28 hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from an OX40 hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from an IgG4 hinge domain or a functional variant thereof.

[0249] Fn Notch connecting polypeptide is derived from Robol JMD, which contains fibronectin repeat sequence (Fn) domain, and there is a short polypeptide sequence between Fn repeat sequence and TMD. Fn Notch connecting polypeptide does not contain Notch negative regulatory region (NRR) or Notch HD domain. Fn connecting polypeptide can contain 1, 2, 3, 4 or 5 Fn repeat sequences. In some embodiments, the chimeric receptor comprises an Fn connecting polypeptide having about 1 to about 5 Fn repeat sequences, about 1 to about 3 Fn repeat sequences or about 2 to about 3 Fn repeat sequences. The short polypeptide sequence between Fn repeat sequence and TMD can be about 2 to about 30 amino acid residues. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 amino acids of any sequence. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 naturally occurring amino acids of any sequence. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 amino acids of any sequence but does not have more than one proline. In some embodiments, the short polypeptide sequence may be between about 5 and about 20 amino acids, and about 50% or more of the amino acids are glycine. In some embodiments, the short polypeptide sequence may be between about 5 and about 20 amino acids, wherein the amino acids are selected from glycine, serine, threonine, and alanine. In some embodiments, the length and amino acid composition of the Fn linker polypeptide sequence may be altered to change the orientation and / or proximity of the ECD and TMD relative to each other, thereby achieving the desired activity of the chimeric polypeptide of the present disclosure.

[0250] Termination transfer sequence

[0251] In some embodiments, the trigger receptor further comprises a termination transfer sequence (STS) between the transmembrane domain and the intracellular domain. STS comprises a charged lipophobic sequence. Without being bound by any theory, STS is used as a membrane anchor and is believed to prevent the intracellular domain from entering the plasma membrane. The use of the STS domain in the trigger receptor is described in WO2021061872, which is hereby incorporated by reference in its entirety. Non-limiting exemplary STS sequences include APLP1, APLP2, APP, TGBR3, CSF1R, CXCL16, CX3CL1, DAG1, DCC, DNER, DSG2, CDH1, GHR, HLA-A, IFNAR2, IGF1R, IL1R1, ERN2, KCNE1, KCNE2, CHL1, LRP1, LRP2, LRP18, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SDC1, SD C2, SPN, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKTFD1, NECTIN1, KL, IL6R, EFNB1, CD44, CLSTN1, LRP8, PCDHGC3, NRG1, LRP1B, JAG2, EFNB2, DLL1, CLSTN2, EPCAM, ErbB4, KCNE3, CDH2, NRG2, PTPRK, BTC, EPHA4, IL1R2, KCNE4, SCN2B, Nradd, PTPRM, Notch1, Notch2, Notch3 and Notch4 STS sequences. In some embodiments, the STS is heterologous to the transmembrane domain. In some embodiments, the STS is homologous to the transmembrane domain. The STS sequence is described in WO2021061872, which is hereby incorporated by reference in its entirety.

[0252] In some embodiments, the stop transfer sequence comprises the sequence shown as SEQ ID NO:20.

[0253] Chimeric Antigen Receptor

[0254] On the other hand, provided herein is a chimeric antigen receptor comprising an extracellular antigen binding domain that specifically binds to mesothelin (MSLN; NCBI Entrez gene: 10232; UniProtKB / Swiss-Prot: Q13421, SEQ ID NO: 178). The CAR can be a human CAR comprising a fully human sequence (e.g., a native human sequence).

[0255] In some embodiments, the chimeric antigen receptor includes an extracellular portion comprising an antigen binding domain. The antigen recognition domain of a receptor (such as CAR) can be connected to one or more intracellular signaling components, such as simulating a signaling component activated by an antigen receptor complex (such as a TCR complex) in the case of CAR, and / or signaling by another cell surface receptor. Therefore, in some embodiments, the extracellular binding component (e.g., ligand binding or antigen binding domain) is connected to one or more transmembrane and intracellular signaling domains. In some embodiments, the transmembrane domain is fused with the extracellular domain. In one embodiment, a transmembrane domain that is naturally associated with one of the domains in a receptor (e.g., CAR) is used. In some cases, the transmembrane domain is selected or modified by amino acid substitution to avoid such domains from binding to the transmembrane domain of the same or different surface membrane proteins, thereby minimizing the interaction with other members of the receptor complex.

[0256] In some aspects, the chimeric antigen receptor comprises an extracellular portion comprising an antigen binding domain as described herein and an intracellular signaling domain. In some embodiments, the antibody or fragment comprises an scFv, a VH or a single domain VH antibody and the intracellular domain contains an ITAM. In some aspects, the intracellular signaling domain comprises the signaling domain of the ζ chain of the CD3 ζ (CD3) chain. In some embodiments, the chimeric antigen receptor comprises a transmembrane domain connecting the extracellular domain and the intracellular signaling domain.

[0257] In some aspects, the transmembrane domain contains the transmembrane portion of CD8a or CD28. The extracellular domain and the transmembrane can be directly or indirectly connected. In some embodiments, the extracellular domain and the transmembrane are connected by a spacer, such as any spacer described herein. In some embodiments, the chimeric antigen receptor contains the intracellular domain of the T cell costimulatory molecule, such as between the transmembrane domain and the intracellular signaling domain. In some aspects, the T cell costimulatory molecule is CD28 or 41BB.

[0258] Chimeric antigen receptor CDR, VH, VL domains

[0259] In some aspects, the extracellular antigen binding domain of the promoter receptor comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, wherein the variable heavy (VH) chain sequence comprises three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, and the variable light (VL) chain sequence comprises three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence shown in SEQ ID NO: 10, 54, 56, 57 or 71, CDR-H2 comprises the sequence shown in SEQ ID NO: 11, 58, 59, 60, 61 or 308, CDR-H3 comprises the sequence shown in SEQ ID NO: 12, 62 or 63, CDR-L1 comprises the sequence shown in SEQ ID NO: 14, 64, 65, 66 or 67, CDR-L2 comprises the sequence shown in SEQ ID NO: 15, and CDR-L3 comprises the sequence shown in SEQ ID NO: 16 or 72. In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO: 13. In some embodiments, the VL comprises the sequence set forth in SEQ ID NO: 17. In some embodiments, the antigen binding domain comprises the sequence set forth in SEQ ID NO: 30.

[0260] In some embodiments, the CDR-H3 of the triggering receptor extracellular antigen binding domain is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-H3 of SEQ ID NO: 12, 62, or 63, the CDR-H2 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-H2 of SEQ ID NO: 11, 58, 59, 60, 61 or 308, the CDR-H1 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-H1 of SEQ ID NO: 10, 54, 56, 57 or 71, the CDR-L3 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-L3 of SEQ ID NO: 16 or 72, and the CDR-L2 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-L3 of SEQ ID NO: 16 or 72. The CDR-L2 of SEQ ID NO:15, 68, 69 or 70 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical, and the CDR-L1 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-L1 of SEQ ID NO:14, 65, 66 or 67. In some embodiments, CDR-H3 is CDR-H3 of SEQ ID NO: 12, 62 or 63 with up to 1, 2, 3, 4, 5, 6, 7 or 8 amino acid substitutions; CDR-H2 is CDR-H2 of SEQ ID NO: 11, 58, 59, 60, 61 or 308 with up to 1, 2, 3, 4, 5, 6, 7 or 8 amino acid substitutions; CDR-H1 is CDR-H1 of SEQ ID NO: 10, 54, 56, 57 or 71 with up to 1, 2, 3, 4 or 5 amino acid substitutions; CDR-L3 is CDR-L3 of SEQ ID NO: 16 or 72 with up to 1, 2, 3, 4 or 5 amino acid substitutions; CDR-L2 is CDR-L3 of SEQ ID NO: 16 or 72 with up to 1, 2, 3 or 4 amino acid substitutions. NO:15, 68, 69 or 70; and CDR-L1 is CDR-L1 of SEQ ID NO:14, 65, 66 or 67 having up to 1, 2, 3, 4, 5 or 6 amino acid substitutions.

[0261] In some embodiments, the trigger receptor extracellular antigen binding domain provided herein comprises one to three CDRs of the VH domain as shown in SEQ ID NO: 13. In some embodiments, the antigen binding domain provided herein comprises two to three CDRs of the VH domain as shown in SEQ ID NO: 13. In some embodiments, the antigen binding domain provided herein comprises three CDRs of the VH domain as shown in SEQ ID NO: 13. In some aspects, the CDRs are Kabat CDRs. In some aspects, the CDRs are Chothia CDRs. In some aspects, the CDRs are AbM CDRs. In some aspects, the CDRs are Contact CDRs. In some aspects, the CDRs are IMGT CDRs.

[0262] In some embodiments, the trigger receptor extracellular antigen binding domain provided herein comprises a VH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95% or 99% identity with the VH sequence shown in SEQ ID NO: 13. In some embodiments, the antigen binding domain provided herein comprises a VH sequence provided by SEQ ID NO: 13 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen binding domains described in this paragraph are referred to herein as "variants". In some embodiments, such variants are obtained from the sequences provided herein, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not obtained from the sequences provided herein, and can be isolated de novo, for example, according to the methods provided herein for obtaining antibodies or antigen binding domains.

[0263] In some embodiments, the trigger receptor extracellular antigen binding domain provided herein comprises one to three CDRs of the VL domain as shown in SEQ ID NO: 17. In some embodiments, the antigen binding domain provided herein comprises two to three CDRs of the VL domain as shown in SEQ ID NO: 17. In some embodiments, the antigen binding domain provided herein comprises three CDRs of the VL domain as shown in SEQ ID NO: 17. In some aspects, the CDR is a Kabat CDR. In some aspects, the Kabat VH CDR is provided with the sequence shown in SEQ ID NO: 10, 11 and 12, and the Kabat VLCDR is provided with the sequence shown in SEQ ID NO: 14, 69 and 16. In some aspects, the CDR is a Chothia CDR. In some aspects, the Chothia VH CDR is provided with the sequence shown in SEQ ID NO: 71, 308 and 12, and the Chothia VL CDR is provided with the sequence shown in SEQ ID NO: 14, 15 and 16. In some aspects, the CDR is an AbM CDR. In some aspects, the AbM VH CDRs are provided with the sequences shown in SEQ ID NOs: 54, 58 and 12, and the AbM VL CDRs are provided with the sequences shown in SEQ ID NOs: 14, 68 and 16. In some aspects, the CDRs are Contact CDRs. In some aspects, the Contact VH CDRs are provided with the sequences shown in SEQ ID NOs: 56, 60 and 62, and the Contact VL CDRs are provided with the sequences shown in SEQ ID NOs: 66, 70 and 72. In some aspects, the CDRs are IMGT CDRs. In some aspects, the IMGT VH CDRs are provided with the sequences shown in SEQ ID NOs: 57, 61 and 63, and the IMGT VL CDRs are provided with the sequences shown in SEQ ID NOs: 67, DT and 16.

[0264] In some embodiments, the trigger receptor extracellular antigen binding domain provided herein comprises a VL sequence having at least about 50%, 60%, 70%, 80%, 90%, 95% or 99% identity with the VL sequence shown in SEQ ID NO: 17. In some embodiments, the antigen binding domain provided herein comprises a VL sequence provided by SEQ ID NO: 17 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to herein as "variants". In some embodiments, such variants are obtained from the sequences provided herein, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not obtained from the sequences provided herein, and can be isolated de novo, for example, according to the methods provided herein for obtaining antibodies or antigen binding domains.

[0265] Table C provides exemplary MSLN antigen binding domain CDR sequences of the VH of SEQ ID NO: 13 and the VL of SEQ ID NO: 17 according to the indicated numbering scheme.

[0266]

[0267] CAR transmembrane domain

[0268] In some embodiments, the membrane-spanning domain is derived from natural or synthetic sources. In the case where the source is natural, in some aspects the domain is derived from any membrane-bound protein or membrane-spanning protein. The membrane-spanning region includes α, β or ζ chains derived from (for example, at least comprising the following membrane-spanning region) T cell receptors, CD28, CD3ε, CD45, CD4, CD5, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD 134, the membrane-spanning region of CD137 and / or CD154. Or, in some embodiments, the membrane-spanning domain is synthetic. In some aspects, the synthetic membrane-spanning domain mainly comprises hydrophobic residues, such as leucine and valine. In some aspects, the triplet of phenylalanine, tryptophan and valine will be present at each end of the synthetic membrane-spanning domain. In some embodiments, connection is completed by a joint, a spacer and / or a membrane-spanning domain.

[0269] In some embodiments, the transmembrane domain of the receptor (e.g., CAR) is the transmembrane domain of human CD28 or a variant thereof, such as the 27 amino acid transmembrane domain of human CD28 (Accession No.: P10747.1).

[0270] In some embodiments, the CAR comprises a CD8a TMD. In some embodiments, the CD8a TMD comprises a sequence shown in SEQ ID NO: 27.

[0271] CAR hinge

[0272] In some embodiments, CAR also includes a spacer, which may be or include at least a portion of an immunoglobulin constant region or a variant or modified version thereof, such as a hinge region (e.g., CD8a hinge, IgG4 hinge region), and / or CH1 / CL and / or Fc region. In some embodiments, the constant region or portion belongs to human IgG, such as IgG4 or IgG1. In some aspects, a portion of the constant region is used as a spacer between an antigen recognition component (e.g., scFv) and a transmembrane domain. Compared to the absence of a spacer, the length of the spacer can increase the responsiveness of the cell after antigen binding. In some examples, the length of the spacer is or is about 12 amino acids, or the length does not exceed 12 amino acids. Exemplary spacers include those having at least about 10 to 229 amino acids, about 10 to 200 amino acids, about 10 to 175 amino acids, about 10 to 150 amino acids, about 10 to 125 amino acids, about 10 to 100 amino acids, about 10 to 75 amino acids, about 10 to 50 amino acids, about 10 to 40 amino acids, about 10 to 30 amino acids, about 10 to 20 amino acids, or about 10 to 15 amino acids (and including any integer between the endpoints of any listed ranges). In some embodiments, the spacer has about 12 or fewer amino acids, about 119 or fewer amino acids, or about 229 or fewer amino acids. Exemplary spacers include a CD8a hinge, a separate IgG4 hinge, an IgG4 hinge connected to a CH2 and CH3 domain, or an IgG4 hinge connected to a CH3 domain. Exemplary spacers include, but are not limited to, those described in Hudecek et al. (2013) Clin. Cancer Res., 19:3153 or International Patent Application Publication No. WO2014031687. In some embodiments, the CAR hinge comprises a CD8a hinge. In some embodiments, the CD8a hinge comprises a sequence shown in SEQ ID NO: 26.

[0273] Among the intracellular signaling domains are those that mimic or approximate signals through native antigen receptors, through combinations of such receptors with co-stimulatory receptors, and / or through co-stimulatory receptors alone. In some embodiments, there is a short oligo- or polypeptide linker, e.g., a linker of between 2 and 10 amino acids in length, such as a linker containing glycine and serine, e.g., a glycine-serine doublet, and the linker forms a connection between the transmembrane domain of the receptor and the cytoplasmic signaling domain.

[0274] CAR intracellular domain

[0275] In some embodiments, after linking CAR, the cytoplasmic domain or intracellular signaling domain of the receptor activates at least one normal effector function or response of an immune cell (e.g., a T cell engineered to express a receptor). For example, in some cases, the receptor induces the function of a T cell, such as cytolytic activity or T helper cell activity, such as secretion of cytokines or other factors. In some embodiments, for example, if a truncated portion of an intracellular signaling domain of an antigen receptor component or a co-stimulatory molecule transduces an effector function signal, it is used to replace a complete immunostimulatory chain. In some embodiments, one or more intracellular signaling domains include a cytoplasmic sequence of a T cell receptor (TCR), and in some aspects also include a cytoplasmic sequence of a co-receptor that synergizes with the receptor in a natural environment to initiate signal transduction after antigen receptor engagement, and / or any derivatives or variants of such molecules, and / or any synthetic sequence with the same functional capabilities.

[0276] In some aspects, the receptor includes a primary cytoplasmic signaling sequence that regulates the primary activation of the TCR complex. The primary cytoplasmic signaling sequence that acts in a stimulatory manner may contain a signaling motif, which is called an activation motif or ITAM based on immunoreceptor tyrosine. Examples of ITAMs containing primary cytoplasmic signaling sequences include those derived from TCR or CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CDS, CD22, CD79a, CD79b, and CD66d. In some embodiments, the cytoplasmic signaling molecule in CAR contains a cytoplasmic signaling domain, a portion thereof, or a sequence derived from CD3ζ.

[0277] In some embodiments, the intracellular signaling domain comprises a human CD3 zeta stimulatory signaling domain or a functional variant thereof, such as the 112AA cytoplasmic domain of isoform 3 of human CD3 zeta (Accession No.: P20963.2) or a CD3 zeta signaling domain as described in U.S. Pat. No. 7,446,190 or U.S. Pat. No. 8,911,993.

[0278] Receptors, such as CAR, may include at least one intracellular signaling component. In some embodiments, the receptor includes an intracellular component of the TCR complex, such as a TCR CD3 chain that mediates T cell activation and cytotoxicity, such as a CD3 ζ chain. Therefore, in some aspects, the extracellular domain is connected to one or more cell signaling modules. In some embodiments, the cell signaling module includes a CD3 transmembrane domain, a CD3 intracellular signaling domain, and / or other CD transmembrane domains. In some embodiments, a receptor, such as CAR, also includes a portion of one or more additional molecules (such as Fc receptor γ, CD8, CD4, CD25, or CD16). For example, in some aspects, CAR includes a chimeric molecule between CD3 ζ or Fc receptor γ and CD8, CD4, CD25, or CD16. In some embodiments, CAR includes a CD3 ζ activation domain, and the CD3 ζ activation domain includes a sequence shown in SEQ ID NO: 29.

[0279] In some embodiments, the intracellular domain comprises an intracellular co-stimulatory signaling domain of 41BB or a functional variant or portion thereof, such as a 42 amino acid cytoplasmic domain of human 4-1BB (Accession No. Q07011.1) or a functional variant or portion thereof.

[0280] In some embodiments, the receptor comprises one or more, such as two or more co-stimulatory domains and activation domains, such as primary activation domains, in the cytoplasmic portion. Exemplary receptors include intracellular components of CD3ζ, CD28 and 4-1BB. In some embodiments, the chimeric antigen receptor contains the intracellular domain of a T cell co-stimulatory molecule. In some aspects, the T cell co-stimulatory molecule is 4-1BB.

[0281] In some embodiments, the receptor includes a signaling domain and / or a transmembrane portion of a co-stimulatory receptor (such as CD28, 4-1BB, OX40, DAP10, and ICOS). In some aspects, the same receptor includes both an activating component and a co-stimulatory component.

[0282] In certain embodiments, the intracellular signaling domain comprises a CD8a transmembrane and signaling domain connected to a CD3 (e.g., CD3ζ) intracellular domain. In some embodiments, the intracellular signaling domain comprises a 4-1BB (CD137, TNFRSF9) co-stimulatory domain connected to a CD3ζ intracellular domain. In some embodiments, CAR comprises a 4-1BB co-stimulatory domain. In some embodiments, the 4-1BB co-stimulatory domain comprises a sequence shown in SEQ ID NO:28.

[0283] In some embodiments, the CAR comprises the sequence shown in SEQ ID NO: 30, 31 or 32. In some embodiments, the CAR comprises the sequence shown in SEQ ID NO: 31.

[0284] In some embodiments, CAR or other antigen receptors also include markers, such as cell surface markers, which can be used to confirm the transduction or engineering of cells to express receptors, such as truncated forms of cell surface receptors, such as truncated EGFR (tEGFR). In some aspects, markers include all or part (e.g., truncated forms) of CD34, nerve growth factor receptor (NGFR) or epidermal growth factor receptor (e.g., tEGFR). In some embodiments, the nucleic acid encoding the marker is operably connected to a polynucleotide encoding a joint sequence (such as a cleavable joint sequence or a ribosome skipping sequence such as T2A). See WO2014031687. In some embodiments, the constructs encoding CAR and EGFRt separated by T2A ribosomal switches are introduced to express two proteins from the same construct, so that EGFRt can be used as a marker for detecting cells expressing such a construct. In some embodiments, markers and optional joint sequences can be any markers and joint sequences disclosed in the patent publication No. WO2014031687 as published. For example, the marker can be a truncated EGFR (tEGFR), optionally linked to a linker sequence, such as a T2A ribosomal skipping sequence.

[0285] In some embodiments, a marker is a molecule, such as a cell surface protein, that does not naturally occur on a T cell or does not naturally occur on the surface of a T cell, or a portion thereof.

[0286] In some embodiments, the molecule is a non-self molecule, such as a non-self protein, ie, a molecule that is not recognized as "self" by the immune system of the host into which the cell is adoptively transferred.

[0287] In some embodiments, the marker does not provide a therapeutic function and / or does not produce other effects, except for being used as a marker for genetic engineering, for example, for selecting successfully engineered cells. In other embodiments, the marker can be a therapeutic molecule or a molecule that otherwise exerts some desired effect, such as a ligand of a cell encountered in vivo, such as a co-stimulatory or immune checkpoint molecule that enhances and / or suppresses the response of the cell after adoptive transfer and encountering a ligand.

[0288] CAR may comprise one or modified synthetic amino acids to replace one or more naturally occurring amino acids. Exemplary modified amino acids include, but are not limited to, aminocyclohexanecarboxylic acid, norleucine, α-aminodecanoic acid, homoserine, S-acetylaminomethylcysteine, trans-3-hydroxyproline and trans-4-hydroxyproline, 4-aminophenylalanine, 4-nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, (3-phenylserine (3-hydroxyphenylalanine, phenylglycine, α-naphthylalanine, cyclohexylalanine, cyclohexylglycine, dihydroindole-2-yl)-1-hydroxy ... 4-nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, 4-nitrophenylalanine, 4-nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, 4-nitrophenylalanine, -carboxylic acid, 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N'-benzyl-N'-methyl-lysine, N',N'-dibenzyl-lysine, 6-hydroxylysine, ornithine, α-aminocyclopentanecarboxylic acid, α-aminocyclohexanecarboxylic acid, α-aminocycloheptanecarboxylic acid, α-(2-amino-2-norbornane)-carboxylic acid, α,γ-diaminobutyric acid, α,γ-diaminopropionic acid, homophenylalanine and α-tert-butylglycine.

[0289] For example, in some embodiments, CAR includes an antibody or fragment thereof, including a single-chain antibody (sdAb, e.g., containing only a VH region), a VH domain, and a scFv as described herein; a spacer, such as a CD8a hinge; a CD8a transmembrane domain; a 4-1BB intracellular signaling domain; and a CD3 ζ signaling domain. In some embodiments, CAR includes an antibody or fragment, including an sdAb and a scFv as described herein; a spacer, such as a CD8a hinge; a CD8a transmembrane domain; a 4-1BB intracellular signaling domain; and a CD3 ζ signaling domain.

[0290] For example, site-specific techniques can be used to introduce transgenics expressing activation receptors and CAR systems into cells (such as T cells). By site-specific integration of transgenics (such as activation receptors and CARs), transgenics can target safe harbor loci or TRACs. Examples of site-specific techniques for integration into safe harbor loci include, but are not limited to, homology-dependent engineering using nucleases and homology-independent targeted insertion using Cas9.

[0291] Engineered cells can be applied to immuno-oncology. For example, the activation receptor and CAR can be selected to target different specific tumor antigens. Examples of cancers that can be effectively targeted using such cells are blood cancers or solid cancers. In some embodiments, immune cell therapy can be used to treat solid tumors.

[0292] Synthetic pathway activator

[0293] In various aspects, the system disclosed herein employs one or more "synthetic pathway activators" (SPAs). Immune cells expressing CARs may be limited by the necessity of in vivo expansion after infusion. In order to achieve strong expansion, T cells require three signals: antigen stimulation, co-stimulation, and cytokine-induced stimulation. CAR activation is sufficient to induce the first two signals, but cytokine signaling cannot be reproduced. In addition, the tumor microenvironment is typically immunosuppressive and lacks proinflammatory cytokines. SPA can therefore be used to stimulate the strong in vivo expansion of T cells expressing activation receptors and / or CARs as described herein and enhance their desired properties (e.g., increased survival, persistence, and efficacy).

[0294] SPA Structure

[0295] In various embodiments, SPA simulates the activation of interleukin signaling. Interleukin receptors are cytokine receptors that conduct signals through signal transducers and activators of transcription (STAT) transcription factors (e.g., STAT3 and STAT5). Interleukin receptors generally dimerize in response to ligand binding to exert their effects. Once dimerized, the receptors can bind to janus-associated kinases (JAKs), inducing JAK cross-phosphorylation and downstream "JAK / STAT" signaling. Therefore, induced receptor agonism or ligand-independent dimerization of receptors can be used to induce constitutive receptor activity, and thus induce constitutive cytokine signaling.

[0296] In various embodiments, the SPA comprises an interleukin receptor or a functional fragment thereof. In some embodiments, the SPA comprises or is derived from an interleukin receptor intracellular signaling domain or a functional fragment thereof. In some embodiments, the SPA comprises or is derived from an interleukin 6 signal transducer (IL6ST) polypeptide or a functional fragment thereof. In some embodiments, the SPA comprises or is derived from an interleukin 7 receptor (IL-7R) polypeptide or a functional fragment thereof. In some embodiments, the SPA comprises or is derived from an interleukin 15 (IL-15) polypeptide or a functional fragment thereof.

[0297] In various embodiments, one or more structural changes may be made to confer constitutive activity to SPA or its functional fragments. In some embodiments, structures or mutations may be added to induce SPA multimerization. In some embodiments, one or more amino acids may be mutated to cysteine ​​to allow, for example, one or more disulfide bonds to form between two receptor monomers. In some embodiments, one or more amino acids may be inserted into a wild-type receptor polypeptide to promote dimerization, for example, by forming one or more disulfide bonds.

[0298] In some embodiments, the exogenous polypeptide is operably linked to a cytokine receptor or a functional fragment thereof to cause their multimerization. In some embodiments, the leucine zipper polypeptide is operably linked to a cytokine receptor or a functional fragment thereof. In some embodiments, the leucine zipper polypeptide is a c-Jun leucine zipper. In some embodiments, the exogenous scaffold is operably linked to a cytokine receptor or a functional fragment thereof. In some embodiments, the exogenous scaffold is a CD34 extracellular domain.

[0299] In some embodiments, the SPA may comprise a ligand agonist (e.g., a cytokine, such as an interleukin) that allows constitutive activation of the SPA. In some embodiments, a cytokine receptor and a soluble agonist are expressed simultaneously. In some embodiments, a cytokine receptor and a membrane-bound agonist are expressed simultaneously.

[0300] In various embodiments, the SPA is anchored to the cell membrane. In some embodiments, the SPA comprises an extracellular domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the SPA comprises a transmembrane domain of an interleukin receptor.

[0301] Example SPA

[0302] In some embodiments, the SPA includes a leucine zipper-gp130 (interchangeably referred to herein as "L-gp130" or "gp130") or an L-gp130 intracellular signaling domain. L-gp130 comprises a homodimer, each monomer comprising (a) an extracellular domain comprising an inserted cysteine ​​residue and a c-Jun leucine zipper that forms a disulfide bond with another monomer; and (b) an IL6ST transmembrane domain and an intracellular signaling domain. The cysteine ​​residues and leucine zipper on each polypeptide can induce the formation of stable homodimers that mimic constitutive IL-6R activation. Additional details on the construction of L-gp130 are described in Stuhlmann-Laeisz et al. Mol Biol Cell. 2006 Jul; 17(7): 2986-95 and WO2020200325, which are hereby incorporated by reference in their entirety.

[0303] In some embodiments, the L-gp130 intracellular signaling domain comprises an amino acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 74. In some embodiments, the L-gp130 intracellular signaling domain comprises the amino acid sequence set forth in SEQ ID NO: 74. In some embodiments, L-gp130 comprises an amino acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 75. In some embodiments, L-gp130 comprises the amino acid sequence set forth in SEQ ID NO: 75.

[0304] In some embodiments, the L-gp130 intracellular signaling domain is encoded by a nucleic acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 79. In some embodiments, the L-gp130 intracellular signaling domain is encoded by the nucleic acid sequence set forth in SEQ ID NO: 79. In some embodiments, L-gp130 is encoded by a nucleic acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 80. In some embodiments, L-gp130 is encoded by the nucleic acid sequence set forth in SEQ ID NO: 80.

[0305] In some embodiments, the leucine zipper domain comprises a sequence as shown in Seq ID NO: 179. In some embodiments, the leucine zipper domain comprises an amino acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence shown in SEQ ID NO: 179.

[0306] In some embodiments, the L-gp130 transmembrane domain comprises a gp130 transmembrane domain. In some embodiments, the L-gp130 transmembrane domain comprises a sequence as shown in Seq ID NO: 180. In some embodiments, the L-gp130 transmembrane domain comprises an amino acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the sequence shown in SEQ ID NO: 180.

[0307] In some embodiments, the SPA includes membrane-bound interleukin 15 (mbIL-15). mbIL-15 comprises an IL-15 polypeptide linked to the IL15 receptor alpha (IL15Rα), thereby allowing constitutive receptor activation. See also, e.g., U.S. Pat. No. 9,629,877, which is hereby incorporated by reference in its entirety.

[0308] In some embodiments, mbIL-15 comprises an amino acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 76. In some embodiments, mbIL-15 comprises the amino acid sequence set forth in SEQ ID NO: 76. In some embodiments, mbIL-15 is encoded by a nucleic acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 81. In some embodiments, mbIL-15 is encoded by a nucleic acid sequence set forth in SEQ ID NO: 81.

[0309] In some embodiments, SPA includes CD34-interleukin 7 receptor (C7R). C7R comprises a homodimer, each monomer comprising (a) an extracellular domain comprising a CD34 extracellular domain, (b) a transmembrane domain comprising an inserted cysteine ​​residue that forms a disulfide bond with another monomer, and (c) an IL-7R intracellular signaling domain. The CD34 extracellular domain and the inserted cysteine ​​residues on each polypeptide allow the formation of a stable homodimer that mimics constitutive IL-7R activation. Additional details on C7R construction are described in Shum et al. Cancer Discov. 2017 November; 7(11): 1238–1247 and U.S. Publication No. 20190183939, which are hereby incorporated by reference in their entirety.

[0310] In some embodiments, the C7R intracellular signaling domain comprises an amino acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 77. In some embodiments, the C7R intracellular signaling domain comprises the amino acid sequence set forth in SEQ ID NO: 77. In some embodiments, C7R comprises an amino acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 78. In some embodiments, C7R comprises the amino acid sequence set forth in SEQ ID NO: 78. In some embodiments, the C7R extracellular domain and the transmembrane domain comprise an amino acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence shown in SEQ ID NO: 181. In some embodiments, the C7R extracellular domain and the transmembrane domain comprise the amino acid sequence shown in SEQ ID NO: 181.

[0311] In some embodiments, the C7R intracellular signaling domain is encoded by a nucleic acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 82. In some embodiments, the C7R intracellular signaling domain is encoded by the nucleic acid sequence set forth in SEQ ID NO: 82. In some embodiments, C7R is encoded by a nucleic acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 83. In some embodiments, C7R is encoded by the nucleic acid sequence set forth in SEQ ID NO: 83.

[0312] Cytokines

[0313] In various embodiments, the system disclosed herein uses one or more cytokines.Immune cells expressing CAR may be limited by the necessity of in vivo expansion after infusion.In order to achieve strong expansion, T cells require three signals: antigen stimulation, costimulation, and cytokine-induced stimulation.The activation of CAR is sufficient to induce the first two signals, but cytokine signaling cannot be reproduced.In addition, the tumor microenvironment is usually immunosuppressive and lacks proinflammatory cytokines.Cytokines can therefore be used to stimulate the strong in vivo expansion of T cells expressing the activation receptors and / or CARs as described herein and enhance their desired properties (e.g., increased survival, persistence, and efficacy).

[0314] In various embodiments, the cytokine used in the system disclosed herein can be a member of the interleukin (IL) cytokine family. Interleukins activate receptors that conduct signals through signal transducers and activators of transcription (STAT) transcription factors (e.g., STAT1, STAT3, and STAT5). Once activated, interleukin receptors can dimerize and bind to janus-associated kinases (JAKs), inducing JAK cross-phosphorylation and downstream "JAK / STAT" signaling. Therefore, induced cytokine expression can be used to induce receptor activity and thus induce cytokine signaling.

[0315] In some embodiments, the cytokines used in the systems disclosed herein are secreted into the extracellular environment after expression. In some embodiments, the cytokines used in the systems disclosed herein are membrane-bound. Membrane-bound ("mb") cytokines may include non-natural polypeptides that link the cytokines to the cell membrane after expression. Membrane-bound cytokines can improve the activation of cytokine signaling, for example, by increasing the proximity of the cytokine to its receptor.

[0316] Exemplary cytokines

[0317] Any cytokine that gives favorable effects to immune cells expressing CAR can be used in the system disclosed herein. In various embodiments, the cytokines used in the system disclosed herein can promote memory T cell persistence and / or proliferation (e.g., IL-7, IL-15 and IL-23). ​​In various embodiments, the cytokines used in the system disclosed herein can promote effector cell function (e.g., IL-2 and IL-12). In various embodiments, the cytokines used in the system disclosed herein can reduce immune cell exhaustion (e.g., IL-21 and IL-23). ​​In various embodiments, the cytokines used in the system disclosed herein can promote the activation of endogenous immunity (e.g., IL-18). In various embodiments, the cytokines used in the system disclosed herein can reduce inflammatory responses (e.g., IL-10 and TGF-β). In various embodiments, the cytokines used in the system disclosed herein are selected from IL-2, Super-2, IL-7, IL-21, IL-12, IL-12 / 23p40, IL-15, IL-18, IL-10 and TGF-β.

[0318] In some embodiments, the cytokine used in the system disclosed herein is IL-2. In some embodiments, the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the amino acid sequence shown in SEQ ID NO: 86. In some embodiments, the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the nucleic acid sequence shown in SEQ ID NO: 87.

[0319] In some embodiments, the cytokine used in the system disclosed herein is IL-7. In some embodiments, the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the amino acid sequence shown in SEQ ID NO: 88. In some embodiments, the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the nucleic acid sequence shown in SEQ ID NO: 89.

[0320] In some embodiments, the cytokine used in the system disclosed herein is IL-21. In some embodiments, the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the amino acid sequence shown in SEQ ID NO: 90. In some embodiments, the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the nucleic acid sequence shown in SEQ ID NO: 91.

[0321] In some embodiments, the cytokine used in the system disclosed herein is IL-12. In some embodiments, the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the amino acid sequence shown in SEQ ID NO: 92. In some embodiments, the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the nucleic acid sequence shown in SEQ ID NO: 93.

[0322] In some embodiments, the cytokine used in the system disclosed herein is IL-12 / 23p40. In some embodiments, the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the amino acid sequence shown in SEQ ID NO: 94. In some embodiments, the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the nucleic acid sequence shown in SEQ ID NO: 95.

[0323] In some embodiments, the cytokine used in the system disclosed herein is IL-15. In some embodiments, the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the amino acid sequence shown in SEQ ID NO: 96. In some embodiments, the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the nucleic acid sequence shown in SEQ ID NO: 97.

[0324] In some embodiments, the cytokine used in the system disclosed herein is IL-18. In some embodiments, the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the amino acid sequence shown in SEQ ID NO: 98. In some embodiments, the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the nucleic acid sequence shown in SEQ ID NO: 99.

[0325] In some embodiments, the cytokine used in the system disclosed herein is Super-2. Further details about Super-2 are given in U.S. Patent No. 10,150,802, which is hereby incorporated by reference in its entirety. In some embodiments, the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the amino acid sequence shown in SEQ ID NO: 132. In some embodiments, the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the nucleic acid sequence shown in SEQ ID NO: 133.

[0326] In some embodiments, the cytokine used in the system disclosed herein is IL-10. In some embodiments, the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the amino acid sequence shown in SEQ ID NO: 134. In some embodiments, the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the nucleic acid sequence shown in SEQ ID NO: 135.

[0327] In some embodiments, the cytokine used in the system disclosed herein is TGF-β. In some embodiments, the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the amino acid sequence shown in SEQ ID NO: 136. In some embodiments, the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the nucleic acid sequence shown in SEQ ID NO: 137.

[0328] In some embodiments, one or more than one cytokine is expressed in a system disclosed herein. In some embodiments, two or more cytokines are expressed in a system disclosed herein. In some embodiments, three or more cytokines are expressed in a system disclosed herein. In some embodiments, four or more cytokines are expressed in a system disclosed herein. In some embodiments, five or more cytokines are expressed in a system disclosed herein. In some embodiments, six or more cytokines are expressed in a system disclosed herein. In some embodiments, seven or more cytokines are expressed in a system disclosed herein.

[0329] Signal peptide

[0330] In various embodiments, the cytokine used in the system disclosed herein is operably connected to a non-natural signal peptide. Different signal peptides can lead to different secretion levels of expressed proteins (e.g., cytokines). Further details about signal peptides and their effects on protein secretion can be found in Lumangtad LA, Bell TW. The signal peptide as a new target for drug design. Bioorg Med Chem Lett. May 15, 2020; 30 (10): 127115, which is hereby incorporated by reference as a whole. Therefore, selecting a specific signal peptide can allow for rheostat tuning of cytokine secretion according to the desired downstream signal transduction level. For example, for cytokines expressed with low efficiency, signal peptides that produce efficient secretion can be selected to improve the overall activation of cytokine signal transduction. In another example, for cytokines that are toxic at high levels, signal peptides that produce reduced secretion efficiency can be selected to reduce the toxic effects of cytokines.

[0331] In some embodiments, the non-natural signal peptide includes a signal peptide from at least one of: CD44, CD3E, CD5, IGTAL, IL-2, GMCSF, chymotrypsinogen, trypsinogen, IgK, IgKVIII, IgE, OSM, IgG2H, BM40, secrecon, and tPA.

[0332] In some embodiments, the cytokine used in the system disclosed herein is linked to a CD44 signal peptide. In some embodiments, the non-natural signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the amino acid sequence shown in SEQ ID NO: 100. In some embodiments, the nucleic acid encoding the non-natural signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the nucleic acid sequence shown in SEQ ID NO: 101.

[0333] In some embodiments, the cytokine used in the system disclosed herein is linked to a CD3E signal peptide. In some embodiments, the non-natural signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the amino acid sequence shown in SEQ ID NO: 102. In some embodiments, the nucleic acid encoding the non-natural signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the nucleic acid sequence shown in SEQ ID NO: 103.

[0334] In some embodiments, the cytokine used in the system disclosed herein is linked to a CD5 signal peptide. In some embodiments, the non-natural signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the amino acid sequence shown in SEQ ID NO: 104. In some embodiments, the nucleic acid encoding the non-natural signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the nucleic acid sequence shown in SEQ ID NO: 105.

[0335] In some embodiments, the cytokine used in the system disclosed herein is linked to an IGTAL signal peptide. In some embodiments, the non-natural signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the amino acid sequence shown in SEQ ID NO: 106. In some embodiments, the nucleic acid encoding the non-natural signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the nucleic acid sequence shown in SEQ ID NO: 107.

[0336] In some embodiments, the cytokine used in the system disclosed herein is linked to an IL-2 signal peptide. In some embodiments, the non-natural signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the amino acid sequence shown in SEQ ID NO: 108. In some embodiments, the nucleic acid encoding the non-natural signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the nucleic acid sequence shown in SEQ ID NO: 109.

[0337] In some embodiments, the cytokine used in the system disclosed herein is linked to a GMCSF signal peptide. In some embodiments, the non-natural signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the amino acid sequence shown in SEQ ID NO: 110. In some embodiments, the nucleic acid encoding the non-natural signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the nucleic acid sequence shown in SEQ ID NO: 111.

[0338] In some embodiments, the cytokine used in the system disclosed herein is linked to a chymotrypsinogen signal peptide. In some embodiments, the non-natural signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the amino acid sequence shown in SEQ ID NO: 112. In some embodiments, the nucleic acid encoding the non-natural signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the nucleic acid sequence shown in SEQ ID NO: 113.

[0339] In some embodiments, the cytokine used in the system disclosed herein is linked to a trypsinogen signal peptide. In some embodiments, the non-natural signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the amino acid sequence shown in SEQ ID NO: 114. In some embodiments, the nucleic acid encoding the non-natural signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the nucleic acid sequence shown in SEQ ID NO: 115.

[0340] In some embodiments, the cytokine used in the system disclosed herein is linked to an IgK signal peptide. In some embodiments, the non-natural signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the amino acid sequence shown in SEQ ID NO: 116. In some embodiments, the nucleic acid encoding the non-natural signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the nucleic acid sequence shown in SEQ ID NO: 117.

[0341] In some embodiments, the cytokine used in the system disclosed herein is linked to an IgKVIII signal peptide. In some embodiments, the non-natural signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the amino acid sequence shown in SEQ ID NO: 118. In some embodiments, the nucleic acid encoding the non-natural signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the nucleic acid sequence shown in SEQ ID NO: 119.

[0342] In some embodiments, the cytokine used in the system disclosed herein is linked to an IgE signal peptide. In some embodiments, the non-natural signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the amino acid sequence shown in SEQ ID NO: 120. In some embodiments, the nucleic acid encoding the non-natural signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the nucleic acid sequence shown in SEQ ID NO: 121.

[0343] In some embodiments, the cytokine used in the system disclosed herein is linked to an OSM signal peptide. In some embodiments, the non-natural signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the amino acid sequence shown in SEQ ID NO: 122. In some embodiments, the nucleic acid encoding the non-natural signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the nucleic acid sequence shown in SEQ ID NO: 123.

[0344] In some embodiments, the cytokine used in the system disclosed herein is linked to an IgG2H signal peptide. In some embodiments, the non-natural signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the amino acid sequence shown in SEQ ID NO: 124. In some embodiments, the nucleic acid encoding the non-natural signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the nucleic acid sequence shown in SEQ ID NO: 125.

[0345] In some embodiments, the cytokine used in the system disclosed herein is linked to the BM40 signal peptide. In some embodiments, the non-natural signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the amino acid sequence shown in SEQ ID NO: 126. In some embodiments, the nucleic acid encoding the non-natural signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity with the nucleic acid sequence shown in SEQ ID NO: 127.

[0346] In some embodiments, the cytokine used in the system disclosed herein is linked to a Secrecon signal peptide. In some embodiments, the non-natural signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the amino acid sequence shown in SEQ ID NO: 128. In some embodiments, the nucleic acid encoding the non-natural signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the nucleic acid sequence shown in SEQ ID NO: 129.

[0347] In some embodiments, the cytokine used in the system disclosed herein is linked to a tPA signal peptide. In some embodiments, the non-natural signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the amino acid sequence shown in SEQ ID NO: 130. In some embodiments, the nucleic acid encoding the non-natural signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100% identity to the nucleic acid sequence shown in SEQ ID NO: 131.

[0348] Gene expression repressor

[0349] In various embodiments, one or more gene expression repressors can be used in the system described herein to produce the desired effect on the T cells expressing the logic gate.Gene expression repressors can be used, for example, to repress the activity of genes that have an inhibitory effect on T cell characteristics (such as amplification or target cell killing).Gene expression repressors can play a role by any mechanism known in the art.Gene expression repressors can play a role by, for example, knocking out of genomic sequences, repression of gene transcription, or repression of protein translation ("knockdown").Examples of gene expression repressors include, but are not limited to, sgRNA, shRNA, siRNA, TALEN, and zinc finger nucleases (ZFNs).

[0350] In some embodiments, the gene expression repressor used in the system disclosed herein is sgRNA or shRNA. In some embodiments, the gene expression repressor is sgRNA. In some embodiments, the sgRNA represses the expression of genes selected from the following: PTPN2, RASA2, SOCS1, ZC3H12A and CISH. In some embodiments, the sgRNA represses the expression of PTPN2. In some embodiments, the sgRNA represses the expression of RASA2. In some embodiments, the sgRNA represses the expression of SOCS1. In some embodiments, the sgRNA represses the expression of ZC3H12A. In some embodiments, the sgRNA represses the expression of CISH.

[0351] In some embodiments, the sgRNA comprises a nucleic acid sequence as set forth in any one of SEQ ID NOs: 160-164. In some embodiments, the sgRNA comprises a nucleic acid sequence as set forth in SEQ ID NO: 160. In some embodiments, the sgRNA comprises a nucleic acid sequence as set forth in SEQ ID NO: 161. In some embodiments, the sgRNA comprises a nucleic acid sequence as set forth in SEQ ID NO: 162. In some embodiments, the sgRNA comprises a nucleic acid sequence as set forth in SEQ ID NO: 163. In some embodiments, the sgRNA comprises a nucleic acid sequence as set forth in SEQ ID NO: 164.

[0352] In some embodiments, the gene expression repressor is shRNA. In some embodiments, shRNA represses the expression of genes selected from the group consisting of RASA2, PTPN2, SOCS 1, ZC3H12A, CISH, TNFRSF6 (Fas), TGFBR1, and TGFBR2. In some embodiments, shRNA represses the expression of RASA2. In some embodiments, shRNA represses the expression of PTPN2. In some embodiments, shRNA represses the expression of SOCS1. In some embodiments, shRNA represses the expression of ZC3H12A. In some embodiments, shRNA represses the expression of CISH. In some embodiments, shRNA represses the expression of TNFRSF6 (Fas). In some embodiments, shRNA represses the expression of TGFBR1. In some embodiments, shRNA represses the expression of TGFBR1. In some embodiments, shRNA comprises the nucleic acid sequence shown in any one of SEQ ID NO: 165-172. In some embodiments, shRNA comprises the nucleic acid sequence shown in SEQ ID NO: 165. In some embodiments, the shRNA comprises the nucleic acid sequence shown in SEQ ID NO: 166. In some embodiments, the shRNA comprises the nucleic acid sequence shown in SEQ ID NO: 167. In some embodiments, the shRNA comprises the nucleic acid sequence shown in SEQ ID NO: 168. In some embodiments, the shRNA comprises the nucleic acid sequence shown in SEQ ID NO: 169. In some embodiments, the shRNA comprises the nucleic acid sequence shown in SEQ ID NO: 170. In some embodiments, the shRNA comprises the nucleic acid sequence shown in SEQ ID NO: 171. In some embodiments, the shRNA comprises the nucleic acid sequence shown in SEQ ID NO: 172.

[0353] Exemplary combinations

[0354] A combination of a gene expression repressor and a SPA and / or a cytokine can be used in the systems described herein to support activation of T cells expressing logic gates. In some embodiments, the SPA is L-gp130 and the cytokine is IL-2. In some embodiments, the SPA is L-gp130 and the cytokine is mbIL-15. In some embodiments, the SPA is C7R and the cytokine is IL-2. In some embodiments, the SPA is C7R and the cytokine is mbIL-15. In some embodiments, the system comprises an sgRNA that suppresses CISH expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses PTPN2 expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses RASA2 expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses SOCS1 expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses ZC3H12A expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses PTPN2 expression and a cytokine that is IL-21. In some embodiments, the system comprises an sgRNA that suppresses ZC3H12A expression and a cytokine that is IL-21. In some embodiments, the system comprises an sgRNA that suppresses RASA2 expression and a cytokine that is IL-15. In some embodiments, the system comprises an shRNA that suppresses RASA2 expression and a cytokine that is IL-2. In some embodiments, the system comprises an shRNA that suppresses RASA2 expression and a cytokine that is IL-15. In some embodiments, the system comprises an sgRNA that suppresses CISH expression and a SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses PTPN2 expression and a SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses RASA2 expression and a SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses SOCS1 expression and a SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses expression of ZC3H12A and a SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses expression of CISH and a SPA that is L-gp130. In some embodiments, the system comprises an sgRNA that suppresses expression of RASA2 and a SPA that is L-gp130. In some embodiments, the system comprises an sgRNA that suppresses expression of ZC3H12A and a SPA that is L-gp130.

[0355] In some embodiments, the system comprises an shRNA that suppresses the expression of TNFRSF6 (Fas) and an additional gene expression suppressor. In some embodiments, the system comprises an shRNA that suppresses the expression of TNFRSF6 (Fas), an shRNA that suppresses the expression of TGFBR2, and an additional gene expression suppressor. In some embodiments, the system comprises an shRNA that suppresses the expression of TNFRSF6 (Fas), an shRNA that suppresses the expression of PTPN2, and an additional gene expression suppressor.

[0356] Recombinant nucleic acids and vectors

[0357] In some embodiments, the present disclosure contemplates a recombinant nucleic acid insert comprising one or more transgenics encoding a start receptor, CAR, cytokine, or SPA as described herein. In some embodiments, the nucleic acid is a recombinant nucleic acid. In some embodiments, the insert encodes a start receptor transgene. In some embodiments, the insert encodes a chimeric antigen receptor transgene. In some embodiments, the insert comprises a start receptor transgene and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a start receptor transgene and a cytokine transgene. In some embodiments, the insert comprises a cytokine transgene and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a start receptor transgene, a cytokine transgene, and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a start receptor transgene and a SPA transgene. In some embodiments, the insert comprises a SPA transgene and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a start receptor transgene, a SPA transgene, and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a start receptor transgene, a SPA transgene, and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a SPA transgene, a cytokine transgene, and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a SPA, a start receptor transgene, a cytokine transgene, and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a SPA, a start receptor transgene, a cytokine transgene, and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a SPA, a start receptor transgene, a cytokine transgene, and a chimeric antigen receptor transgene.

[0358] The insert may also contain a self-cleaving peptide. Examples of self-cleaving peptides include, but are not limited to, self-cleaving viral 2A peptides, such as porcine Teschovirus 1 (P2A) peptides, T. leucoderma virus (T2A) peptides, equine rhinitis virus A (E2A) peptides, or foot-and-mouth disease virus (F2A) peptides. Self-cleaving 2A peptides allow expression of multiple gene products from a single construct. (See, e.g., Chang et al. "Cleavage efficient 2A peptides for high level monoclonal antibody expression in CHO cells," MAbs 7(2): 403-412 (2015)).

[0359] The insert may also comprise a WPRE element. WPRE elements are generally described in Higashimoto, T. et al., Gene Ther 14, 1298-1304 (2007); and Zufferey, R. et al., J Virol. 1999 Apr; 73(4): 2886-92., both of which are hereby incorporated by reference.

[0360] Recombinant cells

[0361] Also provided herein is a recombinant immune cell, the recombinant immune cell comprises at least one DNA template inserted into the target region of the genome of the cell in a non-viral manner, wherein the DNA template encodes a start-up receptor and a CAR system as described herein, optionally also encodes a cytokine, optionally also encodes SPA, and optionally also encodes a gene expression repressor molecule. Also provided herein is a recombinant immune cell, the recombinant immune cell comprises a start-up receptor specifically binding to placenta / germ cell alkaline phosphatase (ALPG / P), a chimeric antigen receptor specifically binding to MSLN, and a cytokine, and / or a synthetic pathway activator for activating cytokine signaling. Also provided herein is an engineered immune cell, the engineered immune cell comprises a start-up receptor specifically binding to placenta / germ cell alkaline phosphatase (ALPG / P), a chimeric antigen receptor specifically binding to MSLN, and a cytokine. Cells may also include gene expression repressors, such as RNAi molecules (e.g., shRNA) or sgRNA for knocking out a target gene based on CRISPR.

[0362] Cells comprising DNA template inserts at target loci or safe harbor sites as described in the present disclosure may be referred to as engineered cells. In some embodiments, immune cells are any cells that can produce pluripotent immune cells. In some embodiments, immune cells are primary immune cells. In some embodiments, immune cells may be induced pluripotent stem cells (iPSC) or human pluripotent stem cells (HSPC). In some embodiments, immune cells include primary hematopoietic cells or primary hematopoietic stem cells. In some embodiments, engineered cells are stem cells, human cells, primary cells, hematopoietic cells, adaptive immune cells, innate immune cells, natural killer (NK) cells, T cells, CD8+ cells, CD4+ cells or T cell progenitors. In some embodiments, immune cells are T cells. In some embodiments, T cells are regulatory T cells, effector T cells or naive T cells. In some embodiments, T cells are CD8 + In some embodiments, the T cells are CD4 + In some embodiments, the T cells are CD4 + CD8 + T cells.

[0363] In some embodiments, the engineered cell is a stem cell, a human cell, a primary cell, a hematopoietic cell, a hematopoietic stem cell, an adaptive immune cell, an innate immune cell, a T cell or a T cell progenitor cell. The non-limiting examples of the immune cells contemplated in the present disclosure include T cells, B cells, natural killer (NK) cells, NKT / iNKT cells, macrophages, bone marrow cells and dendritic cells. The non-limiting examples of the stem cells contemplated in the present disclosure include pluripotent stem cells (PSC), embryonic stem cells (ESC), induced pluripotent stem cells (iPSC), embryonic stem cells (ntES obtained by nuclear transplantation; nuclear transplantation ES), male germline stem cells (GS cells), embryonic germ cells (EG cells), hematopoietic stem cells / progenitor stem cells (HSPC), somatic stem cells (adult stem cells), hemangioblasts, neural stem cells, mesenchymal stem cells and other cells (including osteocytes, chondrocytes, muscle cells, cardiomyocytes, neurons, tendon cells, adipocytes, pancreatic cells, hepatocytes, kidney cells, follicular cells, etc.) stem cells. In some embodiments, the engineered cells are T cells, NK cells, iPSCs and HSPCs. In some embodiments, the engineered cells used in the present disclosure are human cell lines grown in vitro (e.g., intentionally immortalized cell lines, cancer cell lines, etc.).

[0364] Also provided herein is a cell colony comprising a plurality of immune cells. In some embodiments, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more of the genome of the cell comprises a priming receptor and a CAR system as described herein and optional cytokines, SPA and / or gene repressors.

[0365] Methods for treating cancer

[0366] On the other hand, the present invention provides a method for treating an immune-related disorder (e.g., cancer) in an individual, the method comprising administering to the individual an effective amount of a composition comprising a system, the system comprising a priming receptor specifically binding to ALPG / P, a chimeric antigen receptor specifically binding to MSLN, and optional cytokines and / or synthetic pathway activators that activate cytokine signaling. The system may also include gene expression repressors, such as RNAi molecules (e.g., shRNA) or sgRNA for CRISPR-based target gene knockout. On the other hand, the present invention provides a method for enhancing an individual's immune response, the method comprising administering to the individual an effective amount of a composition comprising a system, the system comprising a priming receptor specifically binding to ALPG / P, a chimeric antigen receptor specifically binding to MSLN, and cytokines and / or synthetic pathway activators that activate cytokine signaling.

[0367] In some embodiments, the methods provided herein can be used to treat an immune-related disorder in a subject. In one embodiment, the subject is a human.

[0368] In some embodiments, the methods provided herein (such as methods of enhancing immune responses) can be used to treat cancer, so the individual receiving the system described herein suffers from cancer. In some embodiments, the cancer is a solid cancer. In some embodiments, the cancer is a liquid cancer. In some embodiments, the cancer is immune evasive. In some embodiments, the cancer is immune responsive. In specific embodiments, the cancer is ovarian cancer, fallopian tube cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, or pancreatic cancer. In specific embodiments, the cancer is ovarian cancer.

[0369] In some embodiments, treatment results in a decrease in the volume or size of the cancer. In some embodiments, treatment is effective to reduce the volume of the cancer compared to the volume of the cancer before the administration of the antibody. In some embodiments, treatment results in a decrease in the growth rate of the cancer. In some embodiments, treatment is effective to reduce the growth rate of the cancer compared to the growth rate of the cancer before the administration of the antibody. In some embodiments, treatment is effective to eliminate the cancer.

[0370] In some embodiments, MSLN and ALPG or ALPP are expressed at higher levels in cancer compared to non-cancerous cells. The levels of MSLN, ALPG and ALPP can be assessed by any technique known in the art, including but not limited to protein assay or nucleic acid assay, such as FACS, Western blot, ELISA, immunoprecipitation, immunohistochemistry, immunofluorescence, radioimmunoassay, dot blot, immunodetection method, HPLC, surface plasmon resonance, spectroscopy, mass spectrometry, HPLC, qPCR, RT-qPCR, multiplex qPCR or RT-qPCR, RNA-seq, microarray analysis, SAGE, MassARRAY technology and FISH and combinations thereof.

[0371] Approaches to Regulating Autoimmune Diseases

[0372] On the other hand, provided herein is a method for treating an immune-related disorder (e.g., graft-versus-host disease) in an individual, the method comprising administering to the individual an effective amount of a composition comprising a system comprising a priming receptor, a chimeric antigen receptor, and a cytokine. On the other hand, provided herein is a method for suppressing an immune response in an individual, the method comprising administering to the individual an effective amount of a composition comprising a system comprising a priming receptor, a chimeric antigen receptor, and a cytokine. The cytokine can be a suppressive cytokine, such as IL-10.

[0373] In some embodiments, the methods provided herein can be used to treat an immune-related disorder in a subject. In one embodiment, the subject is a human.

[0374] In some embodiments, the methods provided herein (such as methods of suppressing immune responses) can be used to treat autoimmune diseases. In some embodiments, the autoimmune disease is graft-versus-host disease. In some embodiments, the autoimmune disease is transplant rejection. In some embodiments, the autoimmune disease is rheumatoid arthritis. In some embodiments, the autoimmune disease is inflammatory bowel disease. In some embodiments, the autoimmune disease is type I diabetes.

[0375] Immunomodulatory methods

[0376] Methods of administering cells comprising a system as described herein, comprising a priming receptor that specifically binds to ALPG / P, a chimeric antigen receptor that specifically binds to MSLN, and a cytokine and / or a synthetic pathway activator that activates cytokine signaling, can result in modulation of an immune response. Modulation can be an increase or decrease in an immune response. In some embodiments, modulation is an increase in an immune response.

[0377] In one aspect, administration of cells comprising a system as described herein, comprising a priming receptor specifically binding to ALPG / P, a chimeric antigen receptor specifically binding to MSLN, and cytokines and / or synthetic pathway activators that activate cytokine signaling, can result in the induction of proinflammatory molecules (such as cytokines or chemokines). In general, the presence level of the induced proinflammatory molecules is higher than the level achieved by the isotype control. Such proinflammatory molecules, in turn, lead to the activation of anti-tumor immunity, including but not limited to T cell activation, T cell proliferation, T cell differentiation, M1-like macrophage activation, and NK cell activation. Therefore, administration of a system comprising a priming receptor specifically binding to ALPG / P, a chimeric antigen receptor specifically binding to MSLN, and cytokines and / or synthetic pathway activators that activate cytokine signaling can induce a variety of anti-tumor immune mechanisms that lead to tumor destruction.

[0378] On the other hand, provided herein is a method of increasing an immune response in an individual, the method comprising administering to the individual an effective amount of cells comprising a system comprising a priming receptor that specifically binds to ALPG / P, a chimeric antigen receptor that specifically binds to MSLN, and cytokines and / or synthetic pathway activators that activate cytokine signaling. In some embodiments, the method of increasing an immune response in a subject comprises administering to the subject a cell comprising a system comprising a priming receptor that specifically binds to ALPG / P, a chimeric antigen receptor that specifically binds to MSLN, and cytokines and / or synthetic pathway activators that activate cytokine signaling.

[0379] In some embodiments, the cells are present in a pharmaceutical composition that further comprises a pharmaceutically acceptable excipient.

[0380] In any and all aspects of increasing an immune response as described herein, any increase or decrease or change in a characteristic or function is compared to a cell that does not comprise a composition of a system comprising an initiating receptor that specifically binds to ALPG / P, a chimeric antigen receptor that specifically binds to MSLN, and a cytokine and / or an activator of a synthetic pathway that activates cytokine signaling.

[0381] Increasing an immune response can be enhancing an immune response or inducing an immune response. For example, increasing an immune response includes the beginning or initiation of an immune response, or improving or amplifying an ongoing or existing immune response. In some embodiments, treatment induces an immune response. In some embodiments, the induced immune response is an adaptive immune response. In some embodiments, the induced immune response is an innate immune response. In some embodiments, treatment enhances an immune response. In some embodiments, the enhanced immune response is an adaptive immune response. In some embodiments, the enhanced immune response is an innate immune response. In some embodiments, treatment increases an immune response. In some embodiments, the increased immune response is an adaptive immune response. In some embodiments, the increased immune response is an innate immune response. In some embodiments, an immune response is initiated or started by administering a cell comprising a system comprising a priming receptor specifically bound to ALPG / P, a chimeric antigen receptor specifically bound to MSLN, and a cytokine and / or a synthetic pathway activator that activates cytokine signaling. In some embodiments, the immune response is enhanced by administering cells comprising a system comprising a priming receptor that specifically binds to ALPG / P, a chimeric antigen receptor that specifically binds to MSLN, and a cytokine and / or a synthetic pathway activator that activates cytokine signaling.

[0382] On the other hand, the present application provides a method for gene editing of cells using a system comprising a priming receptor specifically binding to ALPG / P, a chimeric antigen receptor specifically binding to MSLN, and a cytokine and / or a synthetic pathway activator that activates cytokine signaling, thereby regulating the immune function of the cell. The regulation can increase the immune response. In some embodiments, the regulation is an increase in immune function. In some embodiments, the regulation of function leads to the expression of MSLN CAR. In some embodiments, the regulation of function leads to the activation of cells comprising the system.

[0383] In some embodiments, the cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell progenitor cell.

[0384] In some embodiments, the regulation of the function of cells comprising a activating receptor and a CAR system as described herein results in an increase in the ability of cells to stimulate natural and activated T cells, for example, by increasing the secretion of cytokines or chemokines of cells expressing activating receptors and CAR systems. In some embodiments, the regulation of function enhances or increases the ability of cells to produce cytokines, chemokines, CARs or costimulatory or activating receptors. In some embodiments, the regulation increases the T cell stimulation function of cells expressing activating receptors and CAR systems, including, for example, the ability of cells to trigger T cell receptor (TCR) signaling, T cell proliferation, or T cell cytokine production.

[0385] In some embodiments, the increased immune response is the secretion of cytokines and chemokines. In some embodiments, compared with isotype control cells, the expression of at least one cytokine or chemokine in the activation receptor and CAR system induction cell is increased. In some embodiments, the at least one cytokine or chemokine is selected from the group consisting of: IL-2 and IFNg. In some embodiments, the cytokine or chemokine is IL-2. In some embodiments, the cytokine or chemokine is IFNg. In some embodiments, cytokine or chemokine secretion is increased by about 1-100 fold, 1 fold, 5 fold, 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 1-10 fold, 10-20 fold, 20-30 fold, 30-40 fold, 40-50 fold, 50-60 fold, 60-70 fold, 70-80 fold, 80-90 fold, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody. In some embodiments, the chemokine is IL-2, and secretion is increased by about 1-100 fold, 1 fold, 5 fold, 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 1-10 fold, 10-20 fold, 20-30 fold, 30-40 fold, 40-50 fold, 50-60 fold, 60-70 fold, 70-80 fold, 80-90 fold, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody. In some embodiments, the cytokine is IFNg, and secretion is increased by about 1-100 fold, 1 fold, 5 fold, 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 1-10 fold, 10-20 fold, 20-30 fold, 30-40 fold, 40-50 fold, 50-60 fold, 60-70 fold, 70-80 fold, 80-90 fold, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody.

[0386] In some embodiments, the increased immune response is anti-tumor immune cell recruitment and activation.

[0387] In some embodiments, cells expressing the activation receptor and CAR system induce a memory immune response compared to isotype control cells. In general, a memory immune response is a protective immune response produced by the immune system after subsequent exposure to a previously encountered pathogen or antigen. Exemplary memory immune responses include immune responses after infection or vaccination with an antigen. In general, memory immune responses are mediated by lymphocytes such as T cells or B cells. In some embodiments, a memory immune response is a protective immune response against cancer, including cancer cell growth, proliferation, or metastasis. In some embodiments, a memory immune response inhibits, prevents, or reduces cancer cell growth, proliferation, or metastasis.

[0388] Methods for editing cells

[0389] As used herein, the term "gene editing" or "genome editing" refers to a type of genetic manipulation that uses artificially manipulated nucleases or "molecular scissors" to insert, replace or remove DNA from the genome. It is a useful tool for elucidating the function and role of sequence-specific genes or proteins or for altering cell behavior (e.g., for therapeutic purposes).

[0390] Currently available genome editing tools include zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) to insert genes at safe harbor loci, such as the adeno-associated virus integration site 1 (AAVS1) safe harbor locus. The DICE (double integrase cassette exchange) system using phiC31 integrase and Bxb1 integrase is a tool for targeted integration. In addition, clustered regularly interspaced short palindromic repeats / Cas9 (CRISPR / Cas9) technology can be used for targeted gene insertion.

[0391] Site-specific gene editing methods can include homology-dependent mechanisms or homology-independent mechanisms.

[0392] All methods known in the art for targeted insertion of gene sequences are contemplated in the methods described herein to insert a construct at a gene target or safe harbor locus.

[0393] Provided herein are methods for inserting a nucleotide sequence greater than about 5 kilobases in length into a cell genome in the absence of a viral vector. In some embodiments, a nucleotide sequence greater than about 5 kilobases in length can be inserted into the genome of a primary immune cell in the absence of a viral vector.

[0394] Integration of large nucleic acids (e.g., nucleic acids greater than 5 kilobases in size) into cells may be limited by low integration efficiency, off-target effects, and / or cell viability loss. Methods and compositions for achieving integration of nucleotide sequences (e.g., nucleotide sequences greater than about 5 kilobases in size) into the genome of cells are described herein. In some methods, integration efficiency is increased, off-target effects are reduced, and / or cell viability loss is reduced.

[0395] Plasmids can be introduced into immune cells using nucleases, such as CRISPR-associated systems (Cas). Nucleases can be introduced in the form of ribonucleoproteins together with guide RNAs (gRNAs) targeting specific sites on the immune cell genome. Nucleases cut genomic DNA at this specific site. This specific site can be part of the genome encoding an endogenous immune cell receptor. Therefore, cutting the genome at this site will cause immune cells to no longer express endogenous immune cell receptors.

[0396] The plasmid may include 5' and 3' homology-directed repair arms that are complementary to sequences at specific sites on the immune cell genome. The complementary sequences are located on both sides of the site cut by the nuclease, which allows the plasmid to be incorporated into the specific insertion site on the immune cell genome. Once incorporated into the plasmid, the cell will express the activation receptor. However, as explained, the design of the transgenic box ensures that the loop system receptor delivered virally does not express CAR before the activation receptor binds to its cognate ligand and releases the cleavable transcription factor.

[0397] Initially, T cells are activated. T cells can be obtained from patients. Therefore, the present disclosure provides a method for harvesting immune cells such as T cells from patients. Plasmids encoding CAR and activating receptors are then introduced into T cells. Advantageously, electroporation can be used to introduce the plasmids of the present disclosure. When plasmids are introduced by electroporation, nucleases can also be introduced. By using electroporation, the method of the present disclosure avoids the use of viral vectors to introduce transgenes, which is a known bottleneck in immune cell engineering. T cells are then expanded and co-cultured to produce a sufficient number of engineered immune cells for use as therapeutic treatment.

[0398] A method for editing the genome of a cell may include: a) providing a Cas9 ribonucleoprotein complex (RNP)-DNA template complex, the RNP-DNA template complex comprising: (i) RNP, wherein the RNP comprises a Cas9 nuclease domain and a guide RNA, wherein the guide RNA specifically hybridizes to a target region of the genome of the cell, and wherein the Cas9 nuclease domain cleaves the target region to generate an insertion site in the genome of the cell; and (ii) a double-stranded or single-stranded DNA template, wherein the size of the DNA template is greater than about 200 nucleotides, wherein the 5' end and the 3' end of the DNA template comprise nucleotide sequences homologous to genomic sequences flanking the insertion site, and wherein the molar ratio of RNP to DNA template in the complex is about 3:1 to about 100:1; and b) introducing the RNP-DNA template complex into a cell.

[0399] In some embodiments, the methods described herein provide at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99% or higher RNP-DNA template complex delivery efficiency. In some cases, efficiency is determined relative to the cells that survive after the RNP-DNA template is introduced into the cell. In some cases, efficiency is determined relative to the total number of cells (living cells or non-living cells) introduced into the cell by the RNP-DNA template.

[0400] As another example, the delivery efficiency can be determined by the number of genome-edited cells in the quantitative cell population (compared with the total number of cells or total viable cells obtained after the introduction step). Various methods of quantitative genome editing can be used. These methods include, but are not limited to, the use of mismatch-specific nucleases, such as T7 endonuclease I; sequencing of one or more target loci (e.g., by Sanger sequencing of cloned target loci amplified fragments); and high-throughput deep sequencing.

[0401] In some embodiments, compared with the loss of cell viability after naked DNA is introduced into cells or DNA is introduced into cells using viral vectors, the loss of cell viability is reduced. Reduction can be a reduction of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or any percentage between these percentages. In some embodiments, compared with the integration of missing the target after naked DNA is introduced into cells or DNA is introduced into cells using viral vectors, the integration effect of missing the target is reduced. Reduction can be a reduction of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or any percentage between these percentages.

[0402] In some cases, the methods described herein provide high cell viability of cells into which RNP-DNA templates have been introduced. In some cases, the viability of cells into which RNP-DNA templates have been introduced is at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99% or higher. In some cases, the viability of cells into which the RNP-DNA template has been introduced is about 20% to about 99%, about 30% to about 90%, about 35% to about 85% or 90% or more, about 40% to about 85% or 90% or more, about 50% to about 85% or 90% or more, about 50% to about 85% or 90% or more, about 60% to about 85% or 90% or more, or about 70% to about 85% or 90% or more.

[0403] In the methods provided herein, the molar ratio of RNP to DNA template can be about 3: 1 to about 100: 1. For example, the molar ratio can be about 5: 1 to 10: 1, about 5: 1 to about 15: 1, 5: 1 to about 20: 1, 5: 1 to about 25: 1; about 8: 1 to about 12: 1, about 8: 1 to about 15: 1, about 8: 1 to about 20: 1, or about 8: 1 to about 25: 1.

[0404] In some embodiments, the concentration of the DNA template is about 2.5 pM to about 25 pM. For example, the concentration of the DNA template can be about 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25 pM or any concentration between these concentrations.

[0405] In some embodiments, the size or length of the DNA template is greater than about 4.5 kb, 5.0 kb, 5.1 kb, 5.2 kb, 5.3 kb, 5.4 kb, 5.5 kb, 5.6 kb, 5.7 kb, 5.8 kb, 5.9 kb, 6.0 kb, 6.1 kb, 6.2 kb, 6.3 kb, 6.4 kb, 6.5 kb, 6.6 kb, 6.7 kb, 6.8 kb, 6.9 kb, 7.0 kb, 7.1 kb, 7.2 kb, 7.3 kb, 7.4 kb, 9.4 kb, 9.5 kb, 9.6 kb, 9.7 kb, 9.8 kb, 9.9 kb or 10 kb or any DNA template size between these sizes. For example, the size of the DNA template can be about 4.5 kb to about 10 kb, about 5 kb to about 10 kb, about 5 kb to about 9 kb, about 5 kb to about 8 kb, about 5 kb to about 7 kb, about 5 kb to about 6 kb, about kb 6 to about 10 kb, about 6 kb to about 9 kb, about 6 kb to about 8 kb, about 6 kb to about 7 kb, about 7 kb to about 10 kb, about 7 kb to about 9 kb, about 7 kb to about 8 kb, about 8 kb to about 10 kb, about 8 kb to about 9 kb, or about 9 kb to about 10 kb.

[0406] In some embodiments, the amount of the DNA template is about 1 μg to about 10 μg. For example, the amount of the DNA template may be about 1 μg to about 2 μg, about 1 μg to about 3 μg, about 1 μg to about 4 μg, about 1 μg to about 5 μg, about 1 μg to about 6 μg, about 1 μg to about 7 μg, about 1 μg to about 8 μg, about 1 μg to about 9 μg, about 1 μg to about 10 μg. In some embodiments, the amount of the DNA template is about 2 μg to about 3 μg, about 2 μg to about 4 μg, about 2 μg to about 5 μg, about 2 μg to about 6 μg, about 2 μg to about 7 μg, about 2 μg to about 8 μg, about 2 μg to about 9 μg, or 2 μg to about 10 μg. In some embodiments, the amount of the DNA template is about 3 μg to about 4 μg, about 3 μg to about 5 μg, about 3 μg to about 6 μg, about 3 μg to about 7 μg, about 3 μg to about 8 μg, about 3 μg to about 9 μg, or about 3 μg to about 10 μg. In some embodiments, the amount of the DNA template is about 4 μg to about 5 μg, about 4 μg to about 6 μg, about 4 μg to about 7 μg, about 4 μg to about 8 μg, about 4 μg to about 9 μg, or about 4 μg to about 10 μg. In some embodiments, the amount of the DNA template is about 5 μg to about 6 μg, about 5 μg to about 7 μg, about 5 μg to about 8 μg, about 5 μg to about 9 μg, or about 5 μg to about 10 μg. In some embodiments, the amount of the DNA template is about 6 μg to about 7 μg, about 6 μg to about 8 μg, about 6 μg to about 9 μg, or about 6 μg to about 10 μg. In some embodiments, the amount of DNA template is about 7 μg to about 8 μg, about 7 μg to about 9 μg, or about 7 μg to about 10 μg. In some embodiments, the amount of DNA template is about 8 μg to about 9 μg, or about 8 μg to about 10 μg. In some embodiments, the amount of DNA template is about 9 μg to about 10 μg.

[0407] In some cases, the size and number of the DNA templates are large enough to be lethal as naked DNA. In some embodiments, the DNA template encodes a heterologous protein or a fragment thereof. In some embodiments, the DNA template encodes at least one gene. In some embodiments, the DNA template encodes at least two genes. In some embodiments, the DNA template encodes one, two, three, four, five, six, seven, eight, nine, ten or more genes.

[0408] In some embodiments, the DNA template includes regulatory sequences, such as promoter sequences and / or enhancer sequences, to regulate the expression of the heterologous protein or fragment thereof after insertion into the genome of the cell.

[0409] In some cases, the DNA template is a linear DNA template. In some cases, the DNA template is a single-stranded DNA template. In some cases, the single-stranded DNA template is a pure single-stranded DNA template. As used herein, "pure single-stranded DNA" refers to a single-stranded DNA that substantially lacks another or opposite DNA strand. "Substantially lacking" means that one strand in the pure single-stranded DNA lacks at least 100 times more than the other DNA strand.

[0410] In some cases, the RNP-DNA template complex is formed by incubating the RNP with the DNA template for less than about one minute to about thirty minutes at a temperature of about 20° C. to about 25° C. For example, the RNP can be incubated with the DNA template at a temperature of about 20° C., 21° C., 22° C., 23° C., 24° C., or 25° C. for about 5 seconds, 10 seconds, 15 seconds, 20 seconds, 25 seconds, 30 seconds, 35 seconds, 40 seconds, 45 seconds, 50 seconds, 55 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, or 30 minutes, or any amount of time therebetween, at about 20° C., 21° C., 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, or 30 minutes, or any amount of time therebetween. In another example, the RNPs can be incubated with the DNA template for less than about one minute to about one minute, less than about one minute to about 5 minutes, less than about 1 minute to about 10 minutes, about 5 minutes to 10 minutes, about 5 minutes to 15 minutes, about 10 to about 15 minutes, about 10 minutes to about 20 minutes, or about 10 minutes to about 30 minutes at a temperature of about 20° C. to about 25° C. In some embodiments, the RNP-DNA template complex and the cells are mixed before the RNP-DNA template complex is introduced into the cells.

[0411] In some embodiments, the introduction of RNP-DNA template complexes includes electroporation. The methods, compositions and devices for electroporating cells to introduce RNP-DNA template complexes may include those described in the embodiments herein. The additional or alternative methods, compositions and devices for electroporating cells to introduce RNP-DNA template complexes may include those described in WO / 2006 / 001614 or Kim, JA et al. Biosens.Bioelectron.23,1353-1360 (2008). The additional or alternative methods, compositions and devices for electroporating cells to introduce RNP-DNA template complexes may include U.S. Patent Application Publication No. 2006 / 0094095; No. 2005 / 0064596; or No. 2006 / 0087522. Additional or alternative methods, compositions, and devices for electroporating cells to introduce RNP-DNA template complexes may include those described in Li, LH et al. Cancer Res. Treat. 1, 341–350 (2002); U.S. Pat. Nos. 6,773,669; 7,186,559; 7,771,984; 7,991,559; 6485961; 7029916; and U.S. Patent Application Publication Nos. 2014 / 0017213; and 2012 / 0088842, all of which are hereby incorporated by reference. Additional or alternative methods, compositions, and devices for electroporating cells to introduce RNP-DNA template complexes may include those described in Geng, T. et al. J. Control Release 144, 91-100 (2010); and Wang, J. et al. Lab. Chip 10, 2057-2061 (2010), all of which are hereby incorporated by reference.

[0412] In some embodiments, the Cas9 protein can be in the form of an active endonuclease, so that when combined with a target nucleic acid as part of a complex with a guide RNA or as part of a complex with a DNA template, a double-strand break is introduced into the target nucleic acid. Double-strand breaks can be repaired by NHEJ to introduce random mutations, or repaired by HDR to introduce specific mutations. A variety of Cas9 nucleases can be used in the methods described herein. For example, a Cas9 nuclease can be used that requires an NGG protospacer adjacent motif (PAM) at 3' of the region targeted by the adjacent guide RNA. Such Cas9 nucleases can target any region of the genome containing an NGG sequence. As another example, a Cas9 protein with an orthogonal PAM motif requirement can be used to target a sequence without an adjacent NGG PAM sequence. Exemplary Cas9 proteins with orthogonal PAM sequence specificity include, but are not limited to, CFP1; those described in Nature Methods 10, 1116-1121 (2013); and those described in Zetsche et al., Cell, Vol. 163, No. 3, p759-771, Oct. 22, 2015, both of which are hereby incorporated by reference.

[0413] In some cases, the Cas9 protein is a nickase, so that when combined with the target nucleic acid as part of a complex with a guide RNA, a single-strand break or nick is introduced into the target nucleic acid. A pair of Cas9 nickases (each nickase is combined with a structurally different guide RNA) can target two proximal sites in the target genomic region, thereby introducing a pair of proximal single-strand breaks into the target genomic region. The nickase pair can provide enhanced specificity because off-target effects may cause a single nick, which is generally repaired by a base excision repair mechanism without damage. Exemplary Cas9 nickases include Cas9 nucleases with D10A or H840A mutations.

[0414] In some embodiments, the RNP comprises a Cas9 nuclease. In some embodiments, the RNP comprises a Cas9 nickase. In some embodiments, the RNP-DNA template complex comprises at least two structurally different RNP complexes. In some embodiments, the at least two structurally different RNP complexes contain structurally different Cas9 nuclease domains. In some embodiments, the at least two structurally different RNP complexes contain structurally different guide RNAs. In some embodiments, wherein the at least two structurally different RNP complexes contain structurally different guide RNAs, each structurally different RNP complex comprises a Cas9 nickase, and the structurally different guide RNAs hybridize to the opposite strands of the target region.

[0415] In some cases, multiple RNP-DNA templates containing structurally different ribonucleoprotein complexes are introduced into cells. For example, the Cas9 protein can be compounded with multiple (e.g., 2, 3, 4, 5 or more, e.g., 2-10, 5-100, 20-100) structurally different guide RNAs to target and insert DNA templates at multiple structurally different target genomic regions.

[0416] In the methods and compositions provided herein, cells include but are not limited to eukaryotic cells, prokaryotic cells, animal cells, plant cells, fungal cells, etc. Optionally, the cell is a mammalian cell, such as a human cell. The cell can be in vitro, ex vivo or in vivo. The cell can also be a primary cell, a germ cell, a stem cell or a precursor cell. The precursor cell can be, for example, a pluripotent stem cell or a hematopoietic stem cell. In some embodiments, the cell is a primary hematopoietic cell or a primary hematopoietic stem cell. In some embodiments, the primary hematopoietic cell is an immune cell. In some embodiments, the immune cell is a T cell. In some embodiments, the T cell is a regulatory T cell, an effector T cell or a naive T cell. In some embodiments, the T cell is a CD4+T cell. In some embodiments, the T cell is a CD8+T cell. In some embodiments, the T cell is a CD4+CD8+T cell. In some embodiments, the T cell is a CD4-CD8-T cell. A colony of any cell modified by any method described herein is also provided. In some embodiments, the method further comprises expanding the colony of the modified cell.

[0417] In some cases, the cell is removed from the subject, modified using any of the methods described herein and administered to the patient. In other cases, any construct described herein is delivered to the patient. See, e.g., U.S. Patent No. 9,737,604 and Zhang et al. "Lipid nanoparticle-mediated efficient delivery of CRISPR / Cas9 for tumor therapy," NPG Asia Materials, No. 9, p. e441 (2017), both of which are hereby incorporated by reference.

[0418] In some embodiments, the RNP-DNA template complex is introduced into about 1 x 10 5 About 2x 10 6 For example, the RNP-DNA template complex can be introduced into approximately 1x10 5 About 5x 10 5 cells, about 1x 10 5 About 1x 10 6 cells, 1x 10 5About 1.5 x 10 6 cells, 1x 10 5 About 2x 10 6 cells, about 1x 10 6 About 1.5 x 10 6 cells or about 1x 10 6 About 2x 10 6 in a cell.

[0419] In some cases, the methods and compositions described herein can be used to produce, modify, use or control recombinant T cells, such as chimeric antigen receptor T cells (CAR T cells). Such CAR T cells can be used to treat or prevent cancer, infectious diseases or autoimmune diseases in subjects. For example, in some embodiments, one or more gene products are inserted or knocked into T cells to express heterologous proteins (e.g., chimeric antigen receptors (CAR) or activating receptors).

[0420] Insertion site

[0421] Methods for editing T cell genomes, specifically including methods for editing human T cell genomes, include inserting a nucleic acid sequence or construct into a target region of exon 1 of a TCR-α subunit (TRAC) gene in a human T cell. In some embodiments, the target region is located in exon 1 of the constant domain of the TRAC gene. In other embodiments, the target region is located in exon 1, exon 2, or exon 3, before the start of the sequence encoding the TCR-α transmembrane domain.

[0422] Methods for editing T cell genomes also include methods for editing human T cell genomes, comprising inserting a nucleic acid sequence or construct into a target region of exon 1 of a TCR-β subunit (TRBC) gene in a human T cell. In some embodiments, the target region is located in exon 1 of a TRBC1 or TRBC2 gene.

[0423] Methods for editing T cell genomes, particularly including methods for editing human T cell genomes, comprise inserting a nucleic acid sequence or construct into a target region of a genomic safe harbor (GSH).

[0424] Gene editing therapy includes, for example, vector integration and site-specific integration. Site-specific integration is a promising alternative to random integration of viral vectors because it reduces the risk of insertional mutagenesis or insertional tumor formation (Kolb et al. Trends Biotechnol. 2005 23: 399-406; Porteus et al. Nat Biotechnol. 2005 23: 967-973; Paques et al. Curr Gen Ther. 2007 7: 49-66). However, site-specific integration is still faced with challenges such as low knock-in efficiency, risk of insertional tumor formation, instability and / or abnormal expression of adjacent genes or transgenes, low accessibility (e.g., within 20kB of adjacent genes). These challenges can be partially solved by determining and using safe harbor loci or safe harbor sites (SHS), which are sites where genes or genetic elements can be integrated without disrupting the expression or regulation of adjacent genes.

[0425] The most widely used putative human safe harbor site is the AAVS1 site on chromosome 19q, which was originally identified as a site for recurrent adeno-associated virus insertion. Other potential SHSs have been identified on the basis of homology, first identified in other species (e.g., the human homolog of the permissive mouse Rosa26 locus) or in a growing number of human genes that appear to be non-essential in some cases. A putative SHS of this type is the CCR5 chemokine receptor gene, which, when disrupted, confers resistance to human immunodeficiency virus infection. Other potential genomic SHSs have been identified in humans and other cell types on the basis of viral integration site mapping or gene trap analysis, just like the original mouse Rosa26 locus. The three top SHSs, AAVS1, CCR5, and Rosa26, are in close proximity to many protein-coding genes and regulatory elements. (See Sadelain, M. et al. (2012). Safe harbors for the integration of new DNA in the human genome. Nature reviews Cancer, 12(1), 51-58, the relevant disclosure of which is incorporated herein by reference in its entirety).

[0426] AAVS1 (also known as the PPP1R12C locus) on human chromosome 19 is a known SHS for carrying a transgene (e.g., a DNA transgene) with the intended function. It is located at position 19q13.42. It has an open chromatin structure and is transcriptionally competent. The canonical SHS locus of AAVS1 is chr19: 55,625,241-55,629,351. See Pellenz et al. "New Human Chromosomal Sites with "Safe Harbor" Potential for Targeted Transgene Insertion." Human gene therapy vol. 30, 7 (2019): 814-828, the relevant disclosures of which are incorporated herein by reference. Exemplary AAVS1 target gRNA and target sequences are provided below:

[0427] ·AAVS1-gRNA sequence: ggggccactagggacaggatGTTTTAGAGCTAG AAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAA AGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO: 186)

[0428] AAVS1 target sequence: ggggccactagggacaggat (SEQ ID NO: 187)

[0429] CCR5 is located at position 3p21.31 on chromosome 3 and encodes the main co-receptor of HIV-1. Disruption of this site in the CCR5 gene is beneficial for HIV / AIDS therapy and has promoted the development of zinc finger nucleases targeting its third exon. The canonical SHS locus of CCR5 is chr3: 46,414,443-46,414,942. See Pellenz et al. "New Human Chromosomal Sites with "Safe Harbor" Potential for Targeted Transgene Insertion." Human gene therapy vol. 30, 7 (2019): 814-828, the relevant disclosure of which is incorporated herein by reference.

[0430] The mouse Rosa26 locus is particularly useful for genetic modification because it can be efficiently targeted and expressed in most tested cell types. Irion et al. 2007 ("Identification and targeting of the ROSA26 locus in human embryonic stem cells." Nature biotechnology 25.12 (2007): 1477-1482, the relevant disclosure of which is incorporated herein by reference) identified the human homolog, human ROSA26, in chromosome 3 (position 3p25.3). The canonical SHS locus of human Rosa26 (hRosa26) is chr3: 9,415,082-9,414,043. See Pellenz et al. "New Human Chromosomal Sites with "Safe Harbor" Potential for Targeted Transgene Insertion." Human gene therapy vol. 30, 7 (2019): 814-828, the relevant disclosure of which is incorporated herein by reference.

[0431] Additional examples of safe harbor sites are provided in Pellenz et al. "New Human Chromosomal Sites with "Safe Harbor" Potential for Targeted Transgene Insertion." Human gene therapy vol. 30, 7 (2019): 814-828, the relevant disclosure of which is incorporated herein by reference. Examples of additional integration sites are provided in Table D.

[0432] In some embodiments, the safe harbor site allows high expression of the transgene (sufficient to achieve transgene functionality or treatment of the target disease) and stable expression of the transgene over days, weeks or months. In some embodiments, the knockout of the gene at the safe harbor locus confers a functional benefit to the cell, or the gene at the safe harbor locus has no known function in the cell. In some embodiments, the safe harbor locus allows: the transgene is stably expressed in vitro with or without CD3 / CD28 stimulation, the off-target cleavage as detected by iGuide-Seq or CRISPR-Seq is negligible, the off-target cleavage relative to other loci as detected by iGuide-Seq or CRISPR-Seq is reduced, the transgene-independent cytotoxicity is negligible, the transgene-independent cytokine expression is negligible, the transgene-independent chimeric antigen receptor expression is negligible, the deregulation or silencing of nearby genes is negligible, and it is located outside the cancer-related gene.

[0433] As used, "nearby genes" can refer to genes within about 100 kB, about 125 kB, about 150 kB, about 175 kB, about 200 kB, about 225 kB, about 250 kB, about 275 kB, about 300 kB, about 325 kB, about 350 kB, about 375 kB, about 400 kB, about 425 kB, about 450 kB, about 475 kB, about 500 kB, about 525 kB, or about 550 kB from the safe harbor locus (integration site).

[0434] In some embodiments, the present disclosure contemplates inserts comprising one or more transgenes. The transgene may encode a therapeutic protein, antibody, peptide, or any other target gene. Transgenic integration may result in, for example, enhanced therapeutic properties. As used herein, these enhanced therapeutic properties refer to the enhanced therapeutic properties of cells compared to typical immune cells of the same normal cell type. For example, T cells with "enhanced therapeutic properties" have enhanced, improved, and / or increased therapeutic outcomes compared to typical, unmodified, and / or naturally occurring T cells. The therapeutic properties of immune cells may include, but are not limited to, cell transplantation, transport, homing, vitality, self-renewal, persistence, immune response control and regulation, survival, and cytotoxicity. The therapeutic properties of immune cells are also manifested as: antigen-targeted receptor expression; HLA presentation or lack thereof; tolerance to the intratumoral microenvironment; induction and immunomodulation of bystander immune cells; target specificity improvement under reduced doses; resistance to treatments such as chemotherapy.

[0435] As used herein, the term "insert size" refers to the length of the nucleotide sequence that is integrated (inserted) into the target locus or safe harbor site. In some embodiments, the insert size includes at least about 4.5 kilobase pairs (kb) to about 10 kilobase pairs (kb). In some embodiments, the insert size includes about 5000 nucleotides or more base pairs. In some embodiments, the insert size includes up to 4.5, 4.8, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20kbp (kilobase pairs) or a size therebetween. In some embodiments, the insert size is greater than 4.5, 4.8, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20kbp or a size therebetween. In some embodiments, the insert size is in the range of 4.5-15kbp or any number within the range. In some embodiments, the insert size is in the range of 4.8-8.3kbp or any number in this range. In some embodiments, the insert size is in the range of 5-8.3kbp or any number in this range. In some embodiments, the insert size is in the range of 5-15kbp or any number in this range. In some embodiments, the insert size is in the range of 4.5-20kbp or any number in this range. In some embodiments, the insert size is 5-10kbp. In some embodiments, the insert size is 4.5-10, 5-10, 6-10, 7-10, 8-10, 9-10kbp. In some embodiments, the insert size is 4.5-11, 6-11, 7-11, 8-11, 9-11 or 10-11kbp. In some embodiments, the insert size is 4.5-12, 6-12, 7-12, 8-12, 9-12, 10-12 or 11-12kbp. In some embodiments, the insert size is 4.5-13, 6-13, 7-13, 8-13, 9-13, 10-13, 11-13, or 12-13 kbp. In some embodiments, the insert size is 4.5-14, 6-14, 7-14, 8-14, 9-14, 10-14, 11-14, 12-14, or 13-14 kbp. In some embodiments, the insert size is 4.5-15, 6-15, 7-15, 8-15, 9-15, 10-15, 11-15, 12-15, 13-15, or 14-15 kbp. In some embodiments, the insert size is 4.5-16, 6-16, 7-16, 8-16, 9-16, 10-16, 11-16, 12-16, 13-16, 14-16, or 15-16 kbp.In some embodiments, the insert size is 4.5-17, 6-17, 7-17, 8-17, 9-17, 10-17, 11-17, 12-17, 13-17, or 14-17, 15-17, or 16-17 kbp. In some embodiments, the insert size is 4.5-18, 6-18, 7-18, 8-18, 9-18, 10-18, 11-18, 12-18, 13-18, 14-18, 15-18, 16-18, or 17-18 kbp. In some embodiments, the insert size is 4.5-19, 6-19, 7-19, 8-19, 9-19, 10-19, 11-19, 12-19, 13-19, 14-19, 15-19, 16-19, 17-19, or 18-19 kbp. In some embodiments, the insert size is 4.5-20, 6-20, 7-20, 8-20, 9-20, 10-20, 11-20, 12-20, 13-20, 14-20, 15-20, 16-20, 17-20, 18-20, or 19-20 kbp.

[0436] The insert of the present disclosure refers to a nucleic acid molecule or polynucleotide inserted into a target locus or a safe harbor site. In some embodiments, the nucleotide sequence is a DNA molecule such as genomic DNA, or comprises deoxyribonucleotides. In some embodiments, the insert comprises a smaller DNA fragment, such as plasmid DNA, mitochondrial DNA, or DNA isolated in the form of any other subgenomic segment of a plasmid, a Fox plasmid, a cosmid, a bacterial artificial chromosome (BAC), a yeast artificial chromosome (YAC) and / or DNA. In some embodiments, the insert is an RNA molecule or comprises ribonucleotides. The nucleotides in the insert are considered to be naturally occurring nucleotides, non-naturally occurring nucleotides and modified nucleotides. As will be readily understood by those skilled in the art, nucleotides may be chemically or biochemically modified, or may contain non-natural or derivatized nucleotide bases. Such modifications include, for example, labeling, methylation, substitution of one or more naturally occurring nucleotides with analogs, and internucleotide modifications. Polynucleotides may be in any topological conformation, including single-stranded conformation, double-stranded conformation, partially double-stranded conformation, triple-stranded conformation, hairpin conformation, circular conformation, and other three-dimensional conformations envisioned in the art.

[0437] The insert may have coding and / or non-coding regions. The insert may include non-coding sequences (e.g., control elements, such as promoter sequences). In some embodiments, the insert encodes a transcription factor. In some embodiments, the insert encodes an antigen binding receptor, such as a single receptor, a T cell receptor (TCR), a priming receptor, a CAR, a mAb, etc. In some embodiments, the insert is a human sequence. In some embodiments, the insert is a mimetic. In some embodiments, the insert is a multi-gene / multi-module therapeutic box. The multi-gene / multi-module therapeutic box refers to an insert or box having one or more than one receptor (e.g., a synthetic receptor), other exogenous protein coding sequences, non-coding RNA, transcriptional regulatory elements, and / or insulator sequences, etc.

[0438] In some embodiments, the nucleic acid sequence is inserted into the genome of the T cell by non-viral delivery. In the non-viral delivery method, the nucleic acid can be naked DNA, or in a non-viral plasmid or vector. As described herein or known to those of ordinary skill in the art, the non-viral delivery technology can be a site-specific integration technology. Examples of site-specific technologies for integration into the safe harbor locus include, but are not limited to, homology-dependent engineering using nucleases and homology-independent targeted insertion using Cas9 or other CRISPR endonucleases.

[0439] In some embodiments, the insert is integrated into the safe harbor site by introducing into the engineered cell: (a) a targeted nuclease that cleaves a target region in the safe harbor site to generate an insertion site; and (b) a nucleic acid sequence (insert), wherein the insert is incorporated into the insertion site by, for example, HDR. Examples of non-viral delivery technologies that can be used in the methods of the present disclosure are provided in U.S. Application Nos. 16 / 568,116 and 16 / 622,843, the relevant disclosures of which are incorporated herein by reference in their entirety.

[0440] Examples of envisioned integration sites are provided in Table D.

[0441] Table D: sgRNA sequences

[0442]

[0443]

[0444]

[0445]

[0446]

[0447]

[0448]

[0449]

[0450] CRISPR-Cas editing

[0451] An effective example of gene editing is the CRISPR-Cas method (e.g., CRISPR-Cas9). This method combines the use of a guide polynucleotide (e.g., a guide RNA or gRNA) and a Cas endonuclease (e.g., a Cas9 endonuclease).

[0452] As used herein, a polypeptide referred to as a "Cas endonuclease" or having "Cas endonuclease activity" refers to a CRISPR-associated (Cas) polypeptide encoded by a Cas gene, wherein the Cas polypeptide is a target DNA sequence that can be cleaved when operably linked to one or more guide polynucleotides (see, e.g., U.S. Patent No. 8,697,359). This definition also includes variants of Cas endonucleases that retain guide polynucleotide-dependent endonuclease activity. The Cas endonucleases used in the donor DNA insertion methods detailed herein are endonucleases that introduce double-strand breaks into DNA at target sites (e.g., within a target locus or at a safe harbor site).

[0453] As used herein, the term "guide polynucleotide" refers to a polynucleotide sequence that can be complexed with a Cas endonuclease and allows the Cas endonuclease to recognize and cleave a DNA target site. The guide polynucleotide can be a single molecule or a double molecule. The guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (RNA-DNA combination sequence). The guide polynucleotide comprising only ribonucleic acid is also referred to as a "guide RNA". In some embodiments, a polynucleotide donor construct is inserted into a safe harbor locus using a combination of a guide RNA (gRNA) and a cas endonuclease (e.g., Cas9 endonuclease).

[0454] The guiding polynucleotide includes a first nucleotide sequence domain (also referred to as a variable targeting domain or VT domain) complementary to the nucleotide sequence in the target DNA, and a second nucleotide that interacts with the Cas endonuclease polypeptide. It can be a bimolecular (also referred to as a double-stranded guiding polynucleotide) comprising a sequence domain (referred to as a Cas endonuclease recognition domain or CER domain). The CER domain of this bimolecular guiding polynucleotide comprises two independent molecules that hybridize along the complementary region. The two independent molecules can be RNA sequences, DNA sequences and / or RNA-DNA combination sequences.

[0455] Genome editing using the CRISPR-Cas method relies on the repair of site-specific DNA double-strand breaks (DSBs) induced by RNA-guided Cas endonucleases (e.g., Cas9 endonucleases). Homology-directed repair (HDR) of these DSBs enables precise editing of the genome by introducing defined genomic changes (including base substitutions, sequence insertions, and deletions). Conventional HDR-based CRISPR / Cas9 genome editing involves transfecting cells with Cas9, gRNA, and donor DNA containing homology arms that match the target genomic locus.

[0456] HITI (homologous-independent targeted insertion) uses a homology-independent strategy based on non-homologous end joining (NHEJ), and this method is more effective than HDR. Guide RNA (gRNA) targets the insertion site. For HITI, the donor plasmid lacks homology arms, and DSB repair does not occur through the HDR approach. The donor polynucleotide construct can be engineered to include a Cas9 cleavage site flanking the gene or sequence to be inserted. This results in Cas9 cleavage at the donor plasmid and genomic target sequence. Both the target and the donor have blunt ends, and the linear donor DNA plasmid is used by the NHEJ approach, resulting in integration into the genomic DSB site. (See, e.g., Suzuki, K. et al. (2016). In vivo genome editing via CRISPR / Cas9 mediated homology-independent targeted integration. Nature, 540 (7631), 144-149, the relevant disclosures of which are incorporated herein in their entirety).

[0457] Methods for gene editing using CRISPR-Cas methods are known to those of ordinary skill in the art. (See, e.g., U.S. Application Nos. 16 / 312,676, 15 / 303,722, and 15 / 628,533, the disclosures of which are incorporated herein by reference in their entireties). In addition, the use of endonucleases for inserting transgenes into safe harbor loci is described, e.g., in U.S. Application No. 13 / 036,343, the disclosures of which are incorporated herein by reference in their entireties.

[0458] The guide RNA and / or mRNA (or DNA) encoding the endonuclease can be chemically linked to one or more oligonucleotides for enhancing activity, cell distribution or part or conjugate of cellular uptake. The non-limiting examples of such parts include lipid moieties (such as cholesterol moieties), cholic acid, thioethers, thiocholesterols, aliphatic chains (e.g., dodecanediol or undecyl residues), phospholipids (e.g., two-hexadecyl-racemization-glycerol or triethylammonium 1,2-two-O-hexadecyl-racemization-glycerol-3-H-phosphonates), polyamines or polyethylene glycol chains, adamantaneacetic acid, palmityl moieties and octadecylamine or hexylamino-carbonyl-t-hydroxycholesterol moieties. See, for example, U.S. Patent Publication No. 20180127786, the disclosure of which is incorporated herein by reference in its entirety.

[0459] Therapeutic applications

[0460] For therapeutic applications, the engineered cells, their populations, or compositions thereof are administered to a subject, typically a mammal, typically a human, in an effective amount. The engineered cells may be administered to a subject by infusion (e.g., continuous infusion over a period of time) or other administration methods known to those of ordinary skill in the art.

[0461] The engineered cells provided herein can be used not only for gene therapy, but also for non-pharmaceutical uses, such as, for example, the generation of animal models and the generation of recombinant cell lines expressing target proteins.

[0462] The engineered cells of the present disclosure can be any cell, typically a mammalian cell, typically a human cell, that has been modified by integration of a transgene at a safe harbor locus as described herein.Exemplary cells are provided in the Recombinant Cells section.

[0463] The engineered cells, compositions and methods disclosed herein can be used for therapeutic applications such as CAR T cell therapy and TCRT cell therapy. In some embodiments, inserting a sequence encoding a transgene into a safe harbor locus maintains TCR expression relative to the absence of the insertion, and achieves transgene expression while maintaining TCR function.

[0464] In some embodiments, the disclosure provides a method for treating a subject by administering a composition comprising any engineered cell described herein to a subject in need of treatment. In some embodiments, the administration of the engineered cell composition results in desired pharmacological and / or physiological effects. The effect can be a partial or complete cure of the disease and / or a side effect caused by the disease. In some embodiments, treatment encompasses any treatment of a subject (e.g., a mammal, such as a human) disease. In addition, treatment can stabilize or reduce adverse clinical symptoms of a subject (e.g., a patient). Cells, colonies thereof, or compositions thereof provided herein can be administered during or after the occurrence of a disease.

[0465] In certain embodiments, the subject suffers from a disease, illness and / or injury that can be treated and / or improved by cell therapy. In some embodiments, the subject in need of cell therapy is a subject with injury, disease or illness, thereby causing cell therapy (e.g., a therapy in which cellular material is administered to the subject). However, it is envisioned that it is possible to treat, improve at least one symptom associated with injury, disease or illness and / or reduce its severity.

[0466] Application method

[0467] An effective amount of immune cells comprising the system can be administered to treat cancer. The appropriate dosage of immune cells comprising the system can be determined based on the type of cancer to be treated, the type of immune cells comprising the system, the severity and course of the cancer, the individual's clinical condition, the individual's clinical history and response to treatment, and the judgment of the attending physician.

[0468] Pharmaceutical composition

[0469] The engineered recombinant cells provided herein can be administered as part of a pharmaceutical composition. In addition to one or more of the recombinant cells, these compositions may also include pharmaceutically acceptable excipients, carriers, buffers, stabilizers or other substances well known to those skilled in the art. The substance should be non-toxic and should not interfere with the efficacy of the active ingredient. The exact nature of the carrier or other substances may depend on the route of administration, such as oral, intravenous, transdermal or subcutaneous, nasal, intramuscular, intraperitoneal routes. The pharmaceutical composition may include one or more pharmaceutical excipients. Any suitable pharmaceutical excipient can be used, and a person of ordinary skill in the art can select a suitable pharmaceutical excipient. Therefore, the pharmaceutical excipients provided below are intended to illustrate rather than limit. Additional pharmaceutical excipients include, for example, those described in the following: Handbook of Pharmaceutical Excipients, Rowe et al. (ed.) 6th edition (2009), which is incorporated by reference as a whole.

[0470] Various modes of administration of the additional therapeutic agent are contemplated herein. In some embodiments, the additional therapeutic agent is administered by any suitable mode of administration.

[0471] Depending on the condition to be treated, the composition may be administered alone or in combination with other treatments, either simultaneously or sequentially.

[0472] Medicine boxes and products

[0473] The present application provides a kit comprising any one or more of the systems or cell compositions described herein and instructions for use. The instructions for use may be present in the kit as a package insert, in a label of the kit container or a component thereof, or may be in digital form (e.g., on a CD-ROM, via a link on the Internet). The kit may include one or more genome targeting nucleic acids, polynucleotides encoding genome targeting nucleic acids, site-directed polypeptides, and / or polynucleotides encoding site-directed polypeptides. Additional components within the kit, such as buffers (such as reconstitution buffers, stabilization buffers, dilution buffers) and / or one or more control vectors are also contemplated.

[0474] In some embodiments, the kit further comprises a component selected from any one of a secondary antibody, an immunohistochemical analysis reagent, a pharmaceutically acceptable excipient, and instructions, and any combination thereof. In a specific embodiment, the kit comprises a pharmaceutical composition comprising any one or more of the antibody compositions described herein and one or more pharmaceutically acceptable excipients.

[0475] The present application also provides an article of manufacture comprising any of the antibody compositions or kits described herein. Examples of articles of manufacture include vials (including sealed vials).

[0476] Additional embodiments

[0477] Embodiment 1 A system, the system comprising:

[0478] a. a first chimeric polypeptide comprising a priming receptor;

[0479] b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); and

[0480] c. Cytokines.

[0481] Embodiment 2 A system, the system comprising:

[0482] a. a first chimeric polypeptide comprising a priming receptor;

[0483] b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); and

[0484] c. A third chimeric polypeptide comprising a synthetic pathway activator (SPA).

[0485] Embodiment 3 A system, the system comprising:

[0486] a. a first chimeric polypeptide comprising a priming receptor;

[0487] b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR);

[0488] c. a third chimeric polypeptide comprising a synthetic pathway activator (SPA); and

[0489] d. Cytokines.

[0490] Embodiment 4 A system, the system comprising:

[0491] a. a first chimeric polypeptide comprising a priming receptor;

[0492] b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR);

[0493] c. gene expression repressors, and

[0494] d. One or both of the following:

[0495] i. a third chimeric polypeptide comprising a synthetic pathway activator (SPA); and / or

[0496] ii. Cytokines.

[0497] Embodiment 5 A system as described in embodiments 1-4, wherein the triggering receptor comprises from N-terminus to C-terminus:

[0498] a. the first extracellular antigen binding domain;

[0499] b. a first transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and

[0500] c. An intracellular domain comprising a human or humanized transcriptional effector.

[0501] Embodiment 6 The system of embodiment 5, wherein the first extracellular antigen binding domain specifically binds to germ cell alkaline phosphatase (ALPG / P).

[0502] Embodiment 7 A system as described in Embodiment 5 or 6, wherein the first extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, wherein the variable heavy (VH) chain sequence comprises three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, and the variable light (VL) chain sequence comprises three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein:

[0503] a. CDR-H1 comprises the sequence shown in SEQ ID NO: 1, 39, 40, 41 or 42,

[0504] b. CDR-H2 comprises the sequence shown in SEQ ID NO: 2, 43, 44, 45 or 46,

[0505] c. CDR-H3 comprises the sequence shown in SEQ ID NO: 3, 47 or 48,

[0506] d. CDR-L1 comprises the sequence shown in SEQ ID NO: 4, 49 or 50,

[0507] e. CDR-L2 comprises the sequence shown in SEQ ID NO: 5 or 51, and

[0508] f. CDR-L3 comprises the sequence shown in SEQ ID NO: 6 or 53.

[0509] Embodiment 8 is a system as described in embodiment 7, wherein the VH chain sequence comprises the sequence shown in SEQ ID NO:7.

[0510] Embodiment 9 is a system as described in embodiment 7 or 8, wherein the VL chain sequence comprises the sequence shown in SEQ ID NO:8.

[0511] Embodiment 10 The system of any one of Embodiments 5-9, wherein the first extracellular antigen binding domain comprises the sequence shown in SEQ ID NO:9.

[0512] Embodiment 11 A system as described in any of Embodiments 5-10, wherein binding of the first extracellular antigen binding domain to ALPG / P results in cleavage at one or more ligand-inducible proteolytic cleavage sites within the intracellular domain.

[0513] Embodiment 12 The system of any one of Embodiments 5-11, wherein the triggering receptor further comprises a first hinge domain positioned between the first extracellular antigen binding domain and the first transmembrane domain.

[0514] Embodiment 13 A system as described in Embodiment 12, wherein the first hinge domain comprises CD8α or a truncated CD8α hinge domain.

[0515] Embodiment 14 is a system as described in Embodiment 13, wherein the first hinge comprises the sequence shown as SEQ ID NO:18.

[0516] Embodiment 15 A system as described in any of Embodiments 5-14, wherein the first transmembrane domain comprises a Notch1 transmembrane domain.

[0517] Embodiment 16 A system as described in Embodiment 15, wherein the first transmembrane domain comprises the sequence shown as SEQ ID NO:19.

[0518] Embodiment 17 The system of any one of embodiments 5-16, wherein the intracellular domain comprises an HNF1a / p65 domain or a Gal4 / VP64 domain.

[0519] Embodiment 18 A system as described in Embodiment 17, wherein the intracellular domain comprises the sequence shown as SEQ ID NO:23.

[0520] Embodiment 19 A system as described in any of embodiments 5-18, wherein the trigger receptor further comprises a termination transfer sequence between the first transmembrane domain and the intracellular domain.

[0521] Embodiment 20 A system as described in embodiment 19, wherein the termination transfer sequence comprises the sequence shown as SEQ ID NO:20.

[0522] Embodiment 21 A system as described in any of Embodiments 1-20, wherein the triggering receptor comprises the sequence shown as SEQ ID NO:24.

[0523] Embodiment 22 The system of any one of Embodiments 1-21, wherein the CAR comprises from N-terminus to C-terminus:

[0524] a. a second extracellular antigen binding domain;

[0525] b. The second transmembrane domain;

[0526] c. an intracellular co-stimulatory domain; and

[0527] d. Intracellular activation domain.

[0528] Embodiment 23 A system as described in Embodiment 22, wherein the second extracellular antigen binding domain specifically binds to mesothelin (MSLN), wherein the second extracellular antigen binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, wherein the variable heavy (VH) chain sequence comprises three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, and the variable light (VL) chain sequence comprises three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein:

[0529] a. CDR-H1 comprises the sequence shown in SEQ ID NO: 10, 54, 56, 57 or 71,

[0530] b. CDR-H2 comprises the sequence shown in SEQ ID NO: 11, 58, 59, 60 or 61,

[0531] c. CDR-H3 comprises the sequence shown in SEQ ID NO: 12, 62 or 63,

[0532] d. CDR-L1 comprises the sequence shown in SEQ ID NO: 14, 64, 65, 66 or 67,

[0533] e. CDR-L2 comprises the sequence shown in SEQ ID NO: 15, 68, 69 or 70, and

[0534] f. CDR-L3 comprises the sequence shown in SEQ ID NO:16, 72 or 73.

[0535] Embodiment 24 is a system as described in Embodiment 23, wherein the VH chain sequence comprises the sequence shown in SEQ ID NO:13.

[0536] Embodiment 25 is a system as described in embodiment 23 or 24, wherein the VL chain sequence comprises the sequence shown in SEQ ID NO:17.

[0537] Embodiment 26 A system as described in any of Embodiments 23-25, wherein the second extracellular antigen binding domain comprises the amino acid sequence shown in SEQ ID NO:30.

[0538] Embodiment 27 is a system as described in any of Embodiments 1-26, wherein the CAR comprises a second hinge domain.

[0539] Embodiment 28 A system as described in Embodiment 27, wherein the second hinge domain comprises CD8α or a truncated CD8α hinge domain.

[0540] Embodiment 29 The system of any one of Embodiments 22-28, wherein the second transmembrane domain comprises a CD8α transmembrane domain.

[0541] Embodiment 30 The system of any one of Embodiments 22-29, wherein the intracellular co-stimulatory domain comprises a 4-1BB domain.

[0542] Embodiment 31 A system as described in any of Embodiments 22-30, wherein the intracellular activation domain comprises a CD3ζ domain.

[0543] Embodiment 32 is a system as described in any of embodiments 1-31, wherein the CAR comprises a sequence as shown in SEQ ID NO:31 or 32.

[0544] Embodiment 33 A system as described in any of Embodiments 2-32, wherein the SPA is an activator of STAT phosphorylation, optionally STAT1, STAT3 and / or STAT5 phosphorylation.

[0545] Embodiment 34 A system as described in any of embodiments 2-33, wherein the SPA comprises an extracellular domain connected to an intracellular signaling domain.

[0546] Embodiment 35 A system as described in Embodiment 34, wherein the intracellular signaling domain comprises an intracellular signaling region derived from a cytokine receptor.

[0547] Embodiment 36 A system as described in embodiment 34 or 35, wherein the intracellular signaling domain comprises a polypeptide sequence derived from an interleukin receptor.

[0548] Embodiment 37 A system as described in embodiment 34 or 35, wherein the cytokine receptor comprises interleukin 6 signal transducer (IL6ST).

[0549] Embodiment 38 The system of any one of Embodiments 34-37, wherein the extracellular domain transmits constitutive activity to the intracellular signaling domain.

[0550] Embodiment 39 A system as described in any of Embodiments 34-38, wherein the extracellular domain comprises a dimerization region, optionally wherein the dimerization region comprises at least one of a cysteine ​​residue and a leucine zipper.

[0551] Embodiment 40 is a system as described in Embodiment 39, wherein the dimerization region forms a homodimer.

[0552] Embodiment 41 A system as described in any of Embodiments 2-40, wherein the SPA comprises leucine zipper-gp130 (L-gp130).

[0553] Embodiment 42 A system as described in any of embodiments 2-41, wherein the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the sequence shown in SEQ ID NO:74.

[0554] Embodiment 43 A system as described in any of Embodiments 2-42, wherein the SPA comprises the amino acid sequence of SEQ ID NO:74.

[0555] Embodiment 44 is a system as described in any of embodiments 2-43, wherein the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the sequence shown in SEQ ID NO:75.

[0556] Embodiment 45 A system as described in any of Embodiments 2-44, wherein the SPA comprises the amino acid sequence of SEQ ID NO:75.

[0557] Embodiment 46 A system as described in Embodiment 38, wherein the extracellular domain comprises a polypeptide derived from a cytokine and mimics receptor agonism.

[0558] Embodiment 47 The system of any one of embodiments 2-36, 38 or 46, wherein the SPA comprises membrane-bound interleukin 15 (mbIL-15).

[0559] Embodiment 48 The system of any one of embodiments 2-38, 46 or 47, wherein the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the sequence shown in SEQ ID NO:76.

[0560] Embodiment 49 is a system as described in embodiments 2-36, 38 or 46-48, wherein the SPA comprises the amino acid sequence of SEQ ID NO:76.

[0561] Embodiment 50 A system as described in any of embodiments 2-36 or 38, wherein the SPA comprises CD34-interleukin 7 receptor (C7R).

[0562] Embodiment 51 A system as described in embodiments 2-36, 38 or 50, wherein the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the sequence shown in SEQ ID NO:77.

[0563] Embodiment 52 is a system as described in embodiment 2-36, 38, 50 or 51, wherein the SPA comprises the amino acid sequence of SEQ ID NO:77.

[0564] Embodiment 53 is a system as described in embodiments 2-36, 38 or 50-52, wherein the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the sequence shown in SEQ ID NO:78.

[0565] Embodiment 54 is a system as described in embodiments 2-36, 38 or 50-53, wherein the SPA comprises the amino acid sequence of SEQ ID NO:78.

[0566] Embodiment 55 The system of any one of embodiments 1-32, wherein the cytokine is a secreted cytokine.

[0567] Embodiment 56 A system as described in any of embodiments 1-32, wherein the cytokine is a membrane-bound cytokine.

[0568] Embodiment 57 The system of any one of embodiments 1-32, 55, and 56, wherein the cytokine is an interleukin.

[0569] Embodiment 58 A system as described in any of embodiments 1-32 and 55-57, wherein the cytokines include at least one of interleukin (IL)-2, Super-2, IL-12, IL-12 / 23p40, IL-7, IL-15, IL-21 and IL-18.

[0570] Embodiment 59 The system of any one of embodiments 1-32 and 55-58, wherein the cytokine is IL-2.

[0571] Embodiment 60 The system of any one of embodiments 1-32 and 55-58, wherein the cytokine is Super-2.

[0572] Embodiment 61 The system of any one of embodiments 1-32 and 55-58, wherein the cytokine is IL-12.

[0573] Embodiment 62 The system of any of embodiments 1-32 and 55-58, wherein the cytokine is IL-12 / 23p40.

[0574] Embodiment 63 The system of any one of embodiments 1-32 and 55-58, wherein the cytokine is IL-7.

[0575] Embodiment 64 The system of any one of embodiments 1-32 and 55-58, wherein the cytokine is IL-15.

[0576] Embodiment 65 The system of any one of embodiments 1-32 and 55-58, wherein the cytokine is IL-21.

[0577] Embodiment 66 The system of any one of embodiments 1-32 and 55-58, wherein the cytokine is IL-18.

[0578] Embodiment 67 The system of any one of embodiments 1-32 and 55-66, wherein the cytokine comprises a non-native signal peptide.

[0579] Embodiment 68 A system as described in Embodiment 67, wherein the non-natural signal peptide comprises a signal peptide from at least one of the following: CD44, CD3E, CD5, IGTAL, IL-2, GMCSF, chymotrypsinogen, trypsinogen, IgK, IgKVIII, IgE, OSM, IgG2H, BM40, secrecon and tPA.

[0580] Embodiment 69 is a system as described in embodiment 67 or 68, wherein the non-natural signal peptide comprises or consists of the amino acid sequence shown in SEQ ID NO: 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128 or 130.

[0581] Embodiment 70 is a system as described in any of embodiments 1-32 and 55-69, wherein the cytokine comprises the amino acid sequence shown in SEQ ID NO:86, 88, 90, 92, 94, 96, 98 or 132.

[0582] Embodiment 71 A system as described in any of Embodiments 3-32, wherein the gene expression repressor is sgRNA or shRNA.

[0583] Embodiment 72 is a system as described in any of embodiments 3-32 and 71, wherein the gene expression repressor is sgRNA.

[0584] Embodiment 73 A system as described in Embodiment 72, wherein the sgRNA represses the expression of a gene selected from the group consisting of: PTPN2, RASA2, SOCS1, ZC3H12A and CISH.

[0585] Embodiment 74 is a system as described in embodiment 72 or 73, wherein the sgRNA represses the expression of PTPN2.

[0586] Embodiment 75 is a system as described in embodiment 72 or 73, wherein the sgRNA represses the expression of RASA2.

[0587] Embodiment 76 A system as described in Embodiment 72 or 73, wherein the sgRNA represses the expression of SOCS1.

[0588] Embodiment 77 A system as described in Embodiment 72 or 73, wherein the sgRNA represses the expression of ZC3H12A.

[0589] Embodiment 78 A system as described in Embodiment 72 or 73, wherein the sgRNA represses the expression of CISH.

[0590] Embodiment 79 A system as described in Embodiment 72 or 73, wherein the sgRNA comprises a nucleic acid sequence shown in any one of SEQ ID NOs: 160-164.

[0591] Embodiment 80 The system of any one of embodiments 3-32 and 71, wherein the gene expression repressor is shRNA.

[0592] Embodiment 81 A system as described in Embodiment 80, wherein the shRNA suppresses the expression of a gene selected from the group consisting of: RASA2, SOCS1, ZC3H12A, TGFBR1 and CISH.

[0593] Embodiment 82 A system as described in embodiment 80 or 81, wherein the shRNA suppresses the expression of RASA2.

[0594] Embodiment 83 A system as described in embodiment 80 or 81, wherein the shRNA suppresses the expression of SOCS1.

[0595] Embodiment 84 The system of embodiment 80 or 81, wherein the shRNA suppresses the expression of ZC3H12A.

[0596] Embodiment 85 A system as described in embodiment 80 or 81, wherein the shRNA suppresses the expression of TGFBR1.

[0597] Embodiment 86 A system as described in embodiment 80 or 81, wherein the shRNA suppresses the expression of CISH.

[0598] Embodiment 87 A system as described in Embodiment 80 or 81, wherein the shRNA comprises a nucleic acid sequence shown in any one of SEQ ID NOs: 165-172.

[0599] Embodiment 88 The system of any one of embodiments 3-32, wherein the system comprises two or more gene expression repressors.

[0600] Embodiment 89 The system of embodiment 88, wherein the system comprises shRNA that suppresses TNFRSF6 (Fas) expression and another gene expression suppressor.

[0601] Embodiment 90: A system as described in Embodiment 88, wherein the system comprises shRNA that suppresses TNFRSF6 (Fas) expression, shRNA that suppresses TGFBR2 expression, and another gene expression suppressor.

[0602] Embodiment 91 The system of embodiment 88, wherein the system comprises shRNA that suppresses TNFRSF6 (Fas) expression, shRNA that suppresses PTPN2 expression, and another gene expression suppressor.

[0603] Embodiment 92 A system as described in any of Embodiments 3-32, wherein the system comprises an sgRNA that suppresses CISH expression and a cytokine that is IL-2.

[0604] Embodiment 93 A system as described in any of Embodiments 3-32, wherein the system comprises an sgRNA that suppresses PTPN2 expression and a cytokine that is IL-2.

[0605] Embodiment 94 is a system as described in any of embodiments 3-32, wherein the system comprises an sgRNA that suppresses RASA2 expression and a cytokine that is IL-2.

[0606] Embodiment 95 A system as described in any of embodiments 3-32, wherein the system comprises an sgRNA that suppresses SOCS1 expression and a cytokine that is IL-2.

[0607] Embodiment 96 A system as described in any of Embodiments 3-32, wherein the system comprises an sgRNA that suppresses ZC3H12A expression and a cytokine that is IL-2.

[0608] Embodiment 97 A system as described in any of Embodiments 3-32, wherein the system comprises an sgRNA that suppresses PTPN2 expression and a cytokine that is IL-21.

[0609] Embodiment 98 The system of any one of Embodiments 3-32, wherein the system comprises an sgRNA that suppresses ZC3H12A expression and a cytokine that is IL-21.

[0610] Embodiment 99 The system of any one of embodiments 3-32, wherein the system comprises a shRNA that suppresses RASA2 expression and a cytokine that is IL-2.

[0611] Embodiment 100 is a system as described in any of embodiments 3-32, wherein the system comprises an sgRNA that suppresses CISH expression and a SPA that is C7R.

[0612] Embodiment 101 A system as described in any of Embodiments 3-32, wherein the system comprises an sgRNA that suppresses PTPN2 expression and a SPA that is C7R.

[0613] Embodiment 102 A system as described in any of Embodiments 3-32, wherein the system comprises an sgRNA that suppresses RASA2 expression and a SPA that is C7R.

[0614] Embodiment 103 is a system as described in any of embodiments 3-32, wherein the system comprises an sgRNA that suppresses the expression of SOCS1 and a SPA that is C7R.

[0615] Embodiment 104 is a system as described in any of embodiments 3-32, wherein the system comprises an sgRNA that suppresses the expression of ZC3H12A and a SPA that is C7R.

[0616] Embodiment 105 The system of any one of Embodiments 3-32, wherein the system comprises an sgRNA that suppresses CISH expression and a SPA that is L-gp130.

[0617] Embodiment 106 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses RASA2 expression and a SPA that is L-gp130.

[0618] Embodiment 107 The system of any one of Embodiments 3-32, wherein the system comprises an sgRNA that suppresses expression of ZC3H12A and a SPA that is L-gp130.

[0619] Embodiment 108 The system of any one of Embodiments 3-32, wherein the system comprises shRNA that suppresses RASA2 expression, a cytokine that is IL-2, and a SPA that is L-gp130.

[0620] Embodiment 109 The system of any one of Embodiments 3-32, wherein the system comprises an sgRNA that suppresses RASA2 expression, a cytokine that is IL-2, and a SPA that is L-gp130.

[0621] Embodiment 110 The system of any one of Embodiments 3-32, wherein the system comprises shRNA that suppresses RASA2 expression, a cytokine that is IL-15, and a SPA that is L-gp130.

[0622] Embodiment 111 The system of any one of Embodiments 3-32, wherein the system comprises an sgRNA that suppresses RASA2 expression, a cytokine that is IL-15, and a SPA that is L-gp130.

[0623] Embodiment 112 is a system as described in any of Embodiments 3-112, wherein the activation receptor and the CAR are capable of binding to the same target cell.

[0624] Embodiment 113 A system as described in Embodiment 112, wherein the target cell is a human cell.

[0625] Embodiment 114 A system as described in Embodiment 112 or 113, wherein the target cell is a cancer cell.

[0626] Embodiment 115 A system as described in Embodiment 114, wherein the cancer cell is a solid cancer cell or a liquid cancer cell.

[0627] Embodiment 116 A system as described in embodiment 114 or 115, wherein the cancer cell is ovarian cancer, fallopian tube cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer or pancreatic cancer.

[0628] Embodiment 117 One or more recombinant nucleic acids, said recombinant nucleic acids comprising at least one nucleic acid fragment, said at least one nucleic acid fragment comprising a nucleotide sequence encoding the system of any one of embodiments 1-116.

[0629] Embodiment 118 One or more recombinant nucleic acids, said recombinant nucleic acids comprising at least one nucleic acid segment, said at least one nucleic acid segment comprising:

[0630] a. a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen binding domain;

[0631] b. a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain; and

[0632] c. Nucleotide sequences encoding cytokines.

[0633] Embodiment 119 One or more recombinant nucleic acids, said recombinant nucleic acids comprising at least one nucleic acid segment, said at least one nucleic acid segment comprising:

[0634] a. a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen binding domain;

[0635] b. a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain; and

[0636] c. A nucleotide sequence encoding a synthetic pathway activator.

[0637] Embodiment 120 One or more recombinant nucleic acids, said recombinant nucleic acids comprising at least one nucleic acid segment, said at least one nucleic acid segment comprising:

[0638] a. a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen binding domain;

[0639] b. a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain;

[0640] c. a nucleotide sequence encoding a synthetic pathway activator; and

[0641] d. Nucleotide sequences encoding cytokines.

[0642] Embodiment 121 One or more recombinant nucleic acids, said recombinant nucleic acids comprising at least one nucleic acid segment, said at least one nucleic acid segment comprising:

[0643] a. a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen binding domain;

[0644] b. a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain; and

[0645] c. the nucleotide sequence of a gene expression repressor; and

[0646] d. One or both of the following:

[0647] i. a nucleotide sequence encoding a synthetic pathway activator; and / or

[0648] ii. Nucleotide sequences encoding cytokines.

[0649] Embodiment 122 A recombinant nucleic acid as described in any of Embodiments 118-121, wherein the first extracellular antigen binding domain specifically binds to ALPG / P.

[0650] Embodiment 123 A recombinant nucleic acid as described in any of Embodiments 118-122, wherein the second extracellular antigen binding domain specifically binds to MSLN.

[0651] Embodiment 124 is a recombinant nucleic acid as described in embodiments 117-123, wherein the recombinant nucleic acid comprises two or more nucleic acid fragments.

[0652] Embodiment 125 is a recombinant nucleic acid as described in any of Embodiments 117-124, wherein the recombinant nucleic acid also comprises an inducible promoter operably linked to the nucleotide sequence encoding the CAR.

[0653] Embodiment 126 is a recombinant nucleic acid as described in any of embodiments 117-125, wherein the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the activation receptor.

[0654] Embodiment 127 is a recombinant nucleic acid as described in any of embodiments 117-125, wherein the recombinant nucleic acid further comprises a constitutive promoter operably linked to the nucleotide sequence encoding the activating receptor.

[0655] Embodiment 128 is a recombinant nucleic acid as described in any of embodiments 117-125, wherein the recombinant nucleic acid further comprises a constitutive promoter operably linked to the nucleotide sequence encoding the synthetic pathway activator.

[0656] Embodiment 129 is a recombinant nucleic acid as described in any of embodiments 117-127, wherein the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the synthetic pathway activator.

[0657] Embodiment 130 A recombinant nucleic acid as described in embodiment 127 or 128, wherein the initiation receptor and the synthetic pathway activator are under the control of the same constitutive promoter.

[0658] Embodiment 131 A recombinant nucleic acid as described in any of Embodiments 117-124, wherein the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor and a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor and the nucleotide sequence encoding the synthetic pathway activator.

[0659] Embodiment 132 The recombinant nucleic acid of embodiment 131, wherein the nucleic acid comprises in the 5' to 3' direction:

[0660] a. the constitutive promoter;

[0661] b. a nucleotide sequence encoding the synthetic pathway activator;

[0662] c. a nucleotide sequence encoding a priming receptor;

[0663] d. said inducible promoter; and

[0664] e. Nucleotide sequence encoding a chimeric antigen receptor.

[0665] Embodiment 133 The recombinant nucleic acid of any one of Embodiments 131, wherein the nucleic acid comprises in the 5' to 3' direction:

[0666] a. the inducible promoter;

[0667] b. a nucleotide sequence encoding a chimeric antigen receptor;

[0668] c. the constitutive promoter;

[0669] d. a nucleotide sequence encoding a priming receptor; and

[0670] e. A nucleotide sequence encoding the synthetic pathway activator.

[0671] Embodiment 134 is a recombinant nucleic acid as described in any of embodiments 117-127, wherein the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the cytokine.

[0672] Embodiment 135 The recombinant nucleic acid of any one of Embodiments 117-127 and 134, wherein the recombinant nucleic acid further comprises:

[0673] a. an inducible promoter operably linked to a nucleotide sequence encoding the chimeric antigen receptor and a nucleotide sequence encoding the cytokine; and

[0674] b. a consti...

Claims

1. A system, comprising: a. a first chimeric polypeptide comprising a priming receptor; b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); and c. A third chimeric polypeptide comprising a synthetic pathway activator (SPA).

2. A system, comprising: a. a first chimeric polypeptide comprising a priming receptor; b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); c. a third chimeric polypeptide comprising a synthetic pathway activator (SPA); and d. Cytokines.

3. A system, comprising: a. a first chimeric polypeptide comprising a priming receptor; b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); and c. Cytokines.

4. A system, comprising: a. a first chimeric polypeptide comprising a priming receptor; b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); c. gene expression repressors, and d. One or both of the following: i. a third chimeric polypeptide comprising a synthetic pathway activator (SPA); and / or ii. Cytokines.

5. The system of claims 1-4, wherein the trigger receptor comprises, from N-terminus to C-terminus: a. the first extracellular antigen binding domain; b. a first transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and c. An intracellular domain comprising a human or humanized transcriptional effector.

6. The system of claim 5, wherein the first extracellular antigen binding domain specifically binds to germ cell alkaline phosphatase (ALPG / P).

7. The system of claim 5 or 6, wherein the first extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, wherein the variable heavy (VH) chain sequence comprises three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, and the variable light (VL) chain sequence comprises three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: a. CDR-H1 comprises the sequence shown in SEQ ID NO: 1, 39, 40, 41 or 42, b. CDR-H2 comprises the sequence shown in SEQ ID NO: 2, 43, 44, 45 or 46, c. CDR-H3 comprises the sequence shown in SEQ ID NO: 3, 47 or 48, d. CDR-L1 comprises the sequence shown in SEQ ID NO: 4, 49 or 50, e. CDR-L2 comprises the sequence shown in SEQ ID NO: 5 or 51; and f. CDR-L3 comprises the sequence shown in SEQ ID NO: 6 or 53.

8. The system of any one of claims 1-6, wherein the CAR comprises, from N-terminus to C-terminus: a. a second extracellular antigen binding domain; b. The second transmembrane domain; c. an intracellular co-stimulatory domain; and d. Intracellular activation domain.

9. The system of claim 8, wherein the second extracellular antigen-binding domain specifically binds to mesothelin (MSLN), wherein the second extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, wherein the variable heavy (VH) chain sequence comprises three heavy chain CDR sequences CDR-H1, CDR-H2, and CDR-H3, and the variable light (VL) chain sequence comprises three light chain CDR sequences CDR-L1, CDR-L2, and CDR-L3, wherein: a. CDR-H1 comprises the sequence shown in SEQ ID NO: 10, 54, 55, 56 or 57, b. CDR-H2 comprises the sequence shown in SEQ ID NO: 11, 58, 59, 60 or 61, c. CDR-H3 comprises the sequence shown in SEQ ID NO: 12, 62 or 63, d. CDR-L1 comprises the sequence shown in SEQ ID NO: 14, 64, 65, 66 or 67, e. CDR-L2 comprises the sequence shown in SEQ ID NO: 15, 68, 69 or 70, and f. CDR-L3 comprises the sequence shown in SEQ ID NO:16, 72 or 73.

10. The system of any of claims 171, 2, or 4-9, wherein the SPA comprises leucine zipper-gp130 (L-gp130).

11. The system of any of claims 171, 2, or 4-9, wherein the SPA comprises membrane-bound interleukin 15 (mbIL-15).

12. The system of any of claims 171, 2, or 4-9, wherein the SPA comprises CD34-interleukin 7 receptor (C7R).

13. The system of any one of claims 2-12, wherein the cytokine is a secreted cytokine or a membrane-bound cytokine.

14. The system of any one of claims 2-13, wherein the cytokines include at least one of interleukin (IL)-2, Super-2, IL-12, IL-12 / 23p40, IL-7, IL-15, IL-21, and IL-18.

15. The system of any one of claims 4-14, wherein the gene expression repressor is sgRNA or shRNA.

16. The system of claim 15, wherein the sgRNA represses expression of a gene selected from the group consisting of: PTPN2, RASA2, SOCS1, ZC3H12A, and CISH.

17. The system of claim 15, wherein the shRNA suppresses expression of a gene selected from the group consisting of: RASA2, SOCS1, ZC3H12A, TGFBR1, and CISH.

18. One or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding the system of any one of claims 1-17.

19. One or more recombinant nucleic acids, said recombinant nucleic acids comprising at least one nucleic acid fragment, said at least one nucleic acid fragment comprising: a. a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen binding domain; b. a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain; and c. Nucleotide sequences encoding cytokines.

20. One or more recombinant nucleic acids, said recombinant nucleic acids comprising at least one nucleic acid fragment, said at least one nucleic acid fragment comprising: a. a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen binding domain; b. a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain; and c. A nucleotide sequence encoding a synthetic pathway activator.

21. One or more recombinant nucleic acids, said recombinant nucleic acids comprising at least one nucleic acid fragment, said at least one nucleic acid fragment comprising: a. a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen binding domain; b. a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain; c. a nucleotide sequence encoding a synthetic pathway activator; and d. Nucleotide sequences encoding cytokines.

22. One or more recombinant nucleic acids, said recombinant nucleic acids comprising at least one nucleic acid fragment, said at least one nucleic acid fragment comprising: a. a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen binding domain; b. a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain; and c. the nucleotide sequence of a gene expression repressor; and d. One or both of the following: i. a nucleotide sequence encoding a synthetic pathway activator; and / or ii. Nucleotide sequences encoding cytokines.

23. An expression vector comprising the recombinant nucleic acid of any one of claims 18-22.

24. An immune cell, comprising: a. A system according to any one of claims 1-17; b. at least one recombinant nucleic acid according to any one of claims 18 to 22; and / or c. The vector of claim 23.

25. A primary immune cell, comprising at least one recombinant nucleic acid, wherein the recombinant nucleic acid comprises: a. a nucleic acid sequence encoding a priming receptor comprising a first extracellular antigen binding domain; b. a nucleic acid sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain; and c. a nucleic acid sequence encoding a synthetic pathway activator and / or a nucleic acid sequence encoding a cytokine; wherein the recombinant nucleic acid is inserted into a target region of the genome of the primary immune cell, wherein the primary immune cell does not contain a viral vector for introducing the recombinant nucleic acid into the primary immune cell.

26. A live, virus-free primary cell comprising a ribonucleoprotein complex (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the recombinant nucleic acid comprises: a. a nucleic acid sequence encoding a priming receptor comprising a first extracellular antigen binding domain; b. a nucleic acid sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain; and c. a nucleic acid sequence encoding a synthetic pathway activator that constitutively activates cytokine signaling and / or a nucleic acid sequence encoding a cytokine; The 5' end and the 3' end of the recombinant nucleic acid comprise nucleotide sequences homologous to the genomic sequences flanking the insertion site in the genome of the primary cell.

27. A live, virus-free primary cell comprising a ribonucleoprotein complex (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the recombinant nucleic acid comprises: a. a nucleic acid sequence encoding a priming receptor comprising a first extracellular antigen binding domain that specifically binds to ALPG / P; b. a nucleic acid sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain that specifically binds to MSLN; and c. a nucleic acid sequence encoding a synthetic pathway activator that constitutively activates cytokine signaling and / or a nucleic acid sequence encoding a cytokine; The 5' end and the 3' end of the recombinant nucleic acid comprise nucleotide sequences homologous to the genomic sequences flanking the insertion site in the genome of the primary cell.

28. A cell population, comprising a plurality of immune cells according to claim 24 or primary cells according to any one of claims 25-27.

29. A pharmaceutical composition comprising the immune cell of claim 24, the primary cell of any one of claims 25-27 or the cell population of claim 28, and a pharmaceutically acceptable excipient.

30. A pharmaceutical composition comprising the recombinant nucleic acid according to any one of claims 18 to 22 or the vector according to claim 23, and a pharmaceutically acceptable excipient.

31. A method for editing immune cells, the method comprising: a. providing a ribonucleoprotein complex (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the recombinant nucleic acid comprises the recombinant nucleic acid of any one of claims 18-22, and wherein the 5' end and the 3' end of the recombinant nucleic acid comprise nucleotide sequences homologous to genomic sequences flanking the insertion site in the genome of the immune cell; b. introducing the RNP-recombinant nucleic acid complex into the immune cell in a non-viral manner, wherein the guide RNA specifically hybridizes to a target region of the genome of the primary immune cell, and wherein the nuclease domain cleaves the target region to generate the insertion site in the genome of the immune cell; as well as c. Editing the immune cell by inserting the recombinant nucleic acid of any one of claims 18-22 into the insertion site in the genome of the immune cell.

32. A method for treating a disease in a subject, the method comprising administering to the subject the immune cell of claim 24, the primary cell of any one of claims 25-27, or the cell population of claim 28, or the pharmaceutical composition of claim 30 or 30.

33. A method of inhibiting a target cell in a subject, the method comprising administering to the subject the immune cell of claim 24, the primary cell of any one of claims 25-27, or the cell population of claim 28, wherein the immune cell inhibits the target cell.

34. A method for regulating the activity of immune cells, the method comprising: a. obtaining immune cells, the immune cells comprising i. The system of any one of claims 1-17; ii. the recombinant nucleic acid according to any one of claims 18 to 22; and / or iii. The vector according to claim 23; as well as b. contacting the immune cell with a target cell expressing a priming receptor antigen and a CAR antigen, wherein binding of the priming receptor to the priming receptor antigen on the target cell induces activation of the priming receptor and expression of the chimeric antigen receptor, wherein binding of the chimeric antigen receptor to the CAR antigen on the target cell regulates the activity of the immune cell, and wherein the synthetic pathway activator and / or the cytokine also regulates the activity of the immune cell.

35. A method for regulating the activity of immune cells, the method comprising: a. obtaining immune cells, the immune cells comprising i. The system of any one of claims 1-17; ii. the recombinant nucleic acid according to any one of claims 18 to 22; and / or iii. The vector of claim 23; and b. contacting the immune cell with a target cell expressing ALPG / P and MSLN, wherein binding of the priming receptor to ALPG / P on the target cell induces activation of the priming receptor and expression of the chimeric antigen receptor, wherein binding of the chimeric antigen receptor to MSLN on the target cell regulates the activity of the immune cell, and wherein the synthetic pathway activator and / or the cytokine also regulates the activity of the immune cell.

Images