Method for preparing rice with increased tiller number

Abstract

The invention discloses a method for preparing rice with increased tiller number, and belongs to the technical field of genetic breeding. The method comprises the following steps: mutating an encoding gene of OsD3 in target rice containing the encoding gene of OsD3 to obtain rice with increased tiller number, wherein the tiller number of the rice with increased tiller number is greater than that of the target rice; according to the mutation, a codon for coding the 644th amino acid of Os D3 in a coding gene in a target rice genome is mutated into codons for coding other amino acids. Experiments prove that the mutant protein shows weakened signal response to strigolactones due to D3 function reduction, so that the mutant protein shows a dwarf multi-tillering phenotype, and a mutant creation method can be used for genetic character improvement.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic breeding, and in particular relates to a method for preparing rice with increased tillering number. Background Art

[0002] Strigolactones are a class of plant hormones synthesized in the roots. They enter the aerial parts of plants through upward transport and inhibit the occurrence of plant branching. The discovery that strigolactones inhibit plant branching has made people fully aware that the occurrence of plant branching is closely related to the growth environment (nutritional conditions) of plant roots, and also provides direct research clues for the "fertile fields and strong seedlings" summarized in agricultural farming for thousands of years. In addition to being transported to the aerial parts, strigolactones can also be secreted from the roots to the rhizosphere. As an important information molecule for communication between plants and the external environment, they can promote the symbiosis between plants and symbiotic arbuscular fungi and overcome adverse growth conditions through symbiosis. When the soil nutrient conditions are unfavorable, plants will release a large amount of strigolactones around the rhizosphere to attract the symbiosis of symbiotic arbuscular fungi and plants, and improve the plant's ability to absorb and utilize nutrients in the soil. At the same time, strigolactones are transported upward to the stems, inhibiting the excessive nutrient growth of plants, ensuring that the main stems fully utilize limited nutrients and complete the life cycle.

[0003] In traditional crop improvement, yield growth is often achieved by introducing a few genetic loci, such as the famous Green Revolution, which introduced genetic loci such as sd1 and Rht to regulate the signaling pathway of gibberellins, change the plant height factor in the plant type, and achieve plant resistance to lodging. The inspiration brought to us by strigolactones is that we can comprehensively coordinate the plant type and the ecological environment of its roots to achieve the increase of crop yield. That is to say, on the one hand, we can improve the aboveground plant type of crops through the role of strigolactones in regulating branching, making it suitable for production practice. On the other hand, we can also use strigolactones to induce the symbiosis between plants and symbiotic arbuscular fungi, and optimize the ecological microenvironment of plant growth. Compared with traditional crop improvement, it has obvious advantages in improving plant type and optimizing the ecological environment. At the same time, we also see that the role of strigolactones in plants is constantly being revealed. At present, it has been found that strigolactones can change root morphology, stimulate nodule formation, etc. These all indicate that strigolactones have great potential to comprehensively regulate the overall structure of plants (above and below ground). The existence of strigolactones in plants is very common, and the symbiosis between plants and symbiotic arbuscular fungi occurs widely in the plant kingdom. Strigolactones can achieve synergistic optimization of plant type and ecological environment in many crops. Compared with the traditional major types of plant hormones, although strigolactones were discovered later, this does not prevent strigolactones from becoming a plant hormone with broad application prospects.

[0004] Nevertheless, as an important hormone regulating rice tillering, mutants with complete loss of its synthesis and signaling show extreme multi-tillering and dwarf phenotypes, accompanied by severe reductions in fruit set rate and yield, making it difficult to directly apply them to rice breeding practice. However, by finely regulating the function of strigolactones, it is possible to achieve the goal of plant type improvement. For example, in the restorer line material "Huazhan" of the super rice variety, the weak allele HTD1 of the strigolactone synthesis gene HTD1 / D17 was HZ It can effectively increase the number of rice tillers without affecting the fruiting rate, resulting in an increase in biomass and yield. HZ Green Revolution Gene SD1 DGWG It has been selected and widely used by breeders in high-yield rice breeding. The OsD3 gene comes from rice and is a signal component of the strigolactone pathway. Its main function is to control rice plant type, including the number of tillers and plant height of rice. Site-directed editing was used to create OsD3 function-reducing alleles to precisely regulate the strigolactone signaling pathway, adjust the number of rice tillers and plant height, and thus improve the rice plant type. Summary of the invention

[0005] The technical problem to be solved by the present invention is a method for preparing rice with increased tillering number. The technical problem to be solved is not limited to the technical subject described, and those skilled in the art can clearly understand other technical subjects not mentioned in this article through the following description.

[0006] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0007] The present invention provides a method for preparing rice with increased tiller number. The method comprises mutating a gene encoding OsD3 in target rice containing the gene encoding OsD3 to obtain rice with increased tiller number, wherein the tiller number of the rice with increased tiller number is greater than that of the target rice; the OsD3 is a protein whose amino acid sequence is SEQ ID No.1, the 644th amino acid of the OsD3 is the 644th amino acid of SEQ ID No.1, and the 644th amino acid is leucine; and the mutation is to mutate a codon encoding the 644th amino acid of the OsD3 in the encoding gene in the target rice genome into a codon encoding other amino acids.

[0008] In the above method, the other amino acid may specifically be serine.

[0009] The present invention also provides a method for increasing the tiller number of rice, the method comprising mutating the coding gene of OsD3 in a recipient rice containing the coding gene to increase the tiller number of the recipient rice, wherein the OsD3 is a protein whose amino acid sequence is SEQ ID No.1, the 644th amino acid of the OsD3 is the 644th amino acid of SEQ ID No.1, and the 644th amino acid is leucine; the mutation is mutating the codon encoding the 644th amino acid of the Os D3 in the coding gene in the target rice genome into a codon encoding other amino acids.

[0010] In the above method, the other amino acid may specifically be serine.

[0011] The present invention also provides an application, which is the application of a protein or a substance that regulates the expression of a gene encoding the protein or a substance that regulates the activity and / or content of the protein in any of the following:

[0012] M1) Regulate the number of plant tillers;

[0013] M2) preparing products for regulating the number of tillers of plants;

[0014] M3) Plant breeding;

[0015] The protein is OsD3, and the OsD3 is a protein whose amino acid sequence is SEQ ID No.1.

[0016] In the above application, the regulation is to inhibit, reduce or down-regulate the expression of the gene encoding OsD3 or the content or activity of OsD3.

[0017] In the above application, the substance is any of the following:

[0018] C1) a nucleic acid molecule that inhibits, reduces or downregulates the expression of the gene encoding OsD3;

[0019] C2) expressing the gene encoding the nucleic acid molecule described in C1);

[0020] C3) an expression cassette containing the gene described in C2);

[0021] C4) a recombinant vector containing the gene described in C2) or a recombinant vector containing the expression cassette described in C3);

[0022] C5) a recombinant microorganism containing the gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4);

[0023] C6) a transgenic plant cell line containing the gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4);

[0024] C7) transgenic plant tissue containing the gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4);

[0025] C8) A transgenic plant organ containing the gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

[0026] Among the above substances, the expression cassette containing nucleic acid molecules described in C2) refers to a DNA capable of expressing the above-mentioned protein in a host cell. The expression cassette may also include a single-stranded or double-stranded nucleic acid molecule containing all regulatory sequences necessary for expressing the nucleic acid molecule of any of the above-mentioned proteins or the DNA of the RNA molecule. The regulatory sequence can guide the coding sequence to express the DNA of any of the above-mentioned proteins or the RNA molecule in a suitable host cell under its compatible conditions. The regulatory sequence includes, but is not limited to, a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal sequence and a transcription terminator. At a minimum, the regulatory sequence should include a promoter and termination signals for transcription and translation. In order to introduce a specific restriction enzyme site into the vector so as to connect the regulatory sequence to the coding region of the nucleic acid sequence encoding the protein or the DNA of the RNA molecule, a regulatory sequence with a joint can be provided. The regulatory sequence may be a suitable promoter sequence, i.e., a nucleic acid sequence that can be recognized by the host cell expressing the nucleic acid sequence. The promoter sequence contains a transcriptional regulatory sequence that mediates the expression of the DNA of the protein or the RNA molecule. The promoter can be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutant, truncated and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular proteins that are homologous or heterologous to the host cell. The regulatory sequence can also be a suitable transcription termination sequence, i.e., a sequence that can be recognized by the host cell to terminate transcription. The termination sequence can be operably connected to the 3' end of the nucleic acid sequence encoding the protein or the DNA of the RNA molecule. Any terminator that can function in the selected host cell can be used in the present invention. The regulatory sequence can also be a suitable leader sequence, i.e., an mRNA non-translated region that is very important for the translation of the host cell. The leader sequence can be operably connected to the 5' end of the nucleic acid sequence encoding the protein or the DNA of the RNA molecule. Any leader sequence that can function in the selected host cell can be used in the present invention. The regulatory sequence can also be a signal peptide coding region, which encodes an amino acid sequence connected to the amino terminus of the protein, which can guide the DNA encoding the protein or the RNA molecule into the cell secretory pathway. Signal peptide coding regions that can guide the expressed protein or the DNA of the RNA molecule into the secretory pathway of the host cell used can be used in the present invention. It may also be desirable to add regulatory sequences that regulate the expression of the protein or the RNA molecule according to the growth of the host cell. Examples of regulatory sequences are systems that can turn gene expression on or off in response to chemical or physical stimuli, including in the presence of regulatory compounds. Other examples of regulatory sequences are those that allow gene amplification.

[0027] In the above substances, the vector can be a plasmid, a cosmid, a phage or a virus vector.

[0028] In the above substances, the microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium.

[0029] In the above substances, the transgenic plant cell lines do not include propagation materials.

[0030] The present invention also provides an application, which is the application of a protein or a substance that regulates the expression of a gene encoding the protein or a substance that regulates the activity and / or content of the protein in any of the following:

[0031] M1) Regulate the number of plant tillers;

[0032] M2) preparing products for regulating the number of tillers of plants;

[0033] M3) Plant breeding;

[0034] The protein is an OsD3 mutant, and the OsD3 mutant is a protein in which the amino acid at position 644 of SEQ ID No. 1 is mutated from leucine to serine while the other amino acids of SEQ ID No. 1 remain unchanged.

[0035] In the above application, the regulation is to upregulate, enhance or increase the expression of the coding gene of the OsD3 mutant or the content or activity of the OsD3 mutant.

[0036] In the above application, the nucleic acid molecule in B1) above is a gRNA targeting the gene encoding OsD3.

[0037] The target sequence of the gRNA may be 5'-CCGGAGCCTGACATTGCCAG-3'. The target sequence of the gRNA targets nucleotides 2000-2019 of the wild-type genomic sequence of the OsD3 gene.

[0038] The aforementioned proteins, nucleic acid molecules and substances, namely biological materials, also fall within the protection scope of the present invention.

[0039] The nucleic acid molecule may specifically be a DNA molecule in which the coding sequence of the coding chain is obtained by mutating the 1931st thymine deoxyribonucleotide of SEQ ID No. 2 to a cytosine deoxyribonucleotide while keeping the other nucleotides of SEQ ID No. 2 unchanged.

[0040] The allelic mutation creation method provided by the present invention can accurately obtain a rice tillering control gene OsD3 with reduced function mutant, which exhibits a weakened response to strigolactone signals due to reduced D3 function, thereby presenting a dwarf and multi-tillering phenotype. The mutant creation method can be used for genetic trait improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 A yeast experiment was conducted to detect the effects of mutations at key amino acid sites of D3 on the interaction between D14 and D3.

[0042] Figure 2 A rice protoplast experiment was conducted to detect the effects of mutations in key amino acid sites of D3 on the interaction between D14 and D3.

[0043] Figure 3 Rice CRI-d3 L644S Genome editing information. Construction of CRI-d3 using adenine base editing technology L644S Genome site-specific editing materials. The gray highlighted TT is the edited base that was inferred when designing the target site.

[0044] Figure 4 On the left is rice CRI-d3 L644S Maturation phenotype, the scale bar is 20 cm. The right side shows the wild type and mutant CRI-d3 L644S Statistical analysis of tiller number, values ​​represent mean ± SD (n = 15).

[0045] Figure 5 For wild type (NP) and mutant CRI-d3 L644S The D53 protein level. DETAILED DESCRIPTION

[0046] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0047] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0048] The following examples used GraphPad Prism 8 statistical software to process the data, and the experimental results were expressed as mean ± standard deviation, and two-tailed Student's t-test was used, P < 0.05 (*), P < 0.01 (**), P < 0.001 (***), ns (not significant).

[0049] Example 1: Analysis of key sites of D3 gene affecting the interaction between D3 and D14

[0050] 1. Yeast two-hybrid assay

[0051] The corresponding vectors include: pGADT7, pGADT7-D14ΔN, pGBKT7, pGBKT7-OsSKP1-D3, pGBKT7-OsSKP1-D3 T599A 、pGBKT7-OsSKP1-D3 D606A 、pGBKT7-OsSKP1-D3 L644A 、pGBKT7-OsSKP1-D3 H668A 、pGBKT7-OsSKP1-D3 R702A and pGBKT7-OsSKP1-D3 E704A . pGADT7 (AD) and pGBKT7 (BK) are described in the non-patent literature "Song, X., Lu, Z., Yu, H., Shao, G., Xiong, J., Meng, X., Jing, Y., Liu, G., Xiong, G., Duan, J., et al. (2017). IPA1 functions as a downstream transcription factor repressed by D53 in strigolactone signaling in rice. Cell Res. 27, 1128-1141.". The public can obtain the biological material from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0052] The primers for constructing pGADT7-D14ΔN (AD-D14ΔN) are:

[0053] AD-NdeI-D14ΔN-F:

[0054] AD-EcoRI-D14ΔN-R:

[0055] Among the above primers, the bold black sequence is the primer for amplifying D14ΔN, and the underlined sequence is used for homologous recombination with the pGADT7 vector. The AD-D14ΔN vector is a recombinant expression vector obtained by replacing the small fragment between the two restriction enzyme recognition sites of the pGADT7 vector with the CDS nucleotide sequence of the OsD14ΔN gene, and keeping the other nucleotide sequences of the pGADT7 vector unchanged.

[0056] The primers for constructing pGBKT7-OsSKP1-D3 (BK-OsSKP1-D3) are:

[0057] BK-NdeI-OsSKP1-D3-F:

[0058] BK-EcoRI-OsSKP1-D3-R:

[0059] Among the above primers, the bold black sequence is the primer for amplifying OsSKP1-D3, and the underlined sequence is used for homologous recombination with the pGBKT7 vector. The BK-OsSKP1-D3 vector is a recombinant expression vector obtained by replacing the small fragment between the two restriction enzyme recognition sites of the pGBKT7 vector with the CDS nucleotide sequence encoding the OsSKP1-D3 fusion protein, while keeping the other nucleotide sequences of the pGBKT7 vector unchanged.

[0060] To construct the mutant amino acid form of D3, pGBKT7-OsSKP1-D3 T599A 、pGBKT7-OsSKP1-D3 D606A 、pGBKT7-OsSKP1-D3 L644A 、pGBKT7-OsSKP1-D3 H668A 、pGBKT7-OsSKP1-D3 R702A and pGBKT7-OsSKP1-D3 E704A The corresponding primers for introducing mutations were used to circularly amplify the BK-OsSKP1-D3 vector as a template to obtain the final vector for site-directed mutation of amino acids. In the following primers, the base sequence of the amino acid site for site-directed mutation is in bold black.

[0061] D3-T599A-F:

[0062] D3T599A-R:

[0063] D3-D606A-F:

[0064] D3-D606A-R:

[0065] D3-L644A-F:

[0066] D3-L644A-R:

[0067] D3-H668A-F:

[0068] D3-H668A-R:

[0069] D3-R702A-F:

[0070] D3-R702A-R:

[0071] D3-E704A-F:

[0072] D3-E704A-R:

[0073] Experimental method: The plasmid transformation of yeast was based on the experimental process in the DUAL membrane starter kits and was fine-tuned according to the previous experimental experience of the laboratory. The specific operation process is as follows: (1) Streak the Y2HGold yeast strain on YPDA solid medium and incubate at 30°C for 2-3 days until single colonies appear. (2) Pick 3-4 single colonies and place them in 3mL YPDA liquid medium. Incubate at 250rpm at 30°C for 12-14h. (3) Transfer 3mL of bacterial liquid to 30mL YPDA liquid medium and continue to incubate at 250rpm at 30°C for 3-5h. When OD 600When the pH reaches 0.6-0.8, centrifuge at 700g for 5 minutes at room temperature. (4) After discarding the supernatant, resuspend the precipitate in 30mL sterile water and centrifuge again at 700g for 5 minutes. (5) After discarding the supernatant, determine the volume of sterile medium to be added to resuspend the yeast cells according to the number of experimental reactions, place the resuspended yeast competent cells on ice and wait for transformation. (6) When preparing yeast competent cells, denature the salmon sperm single-stranded ssDNA, first boil it at 100℃ for 5 minutes and then place it on ice for 5 minutes, repeat 2-3 times. (7) Determine the configuration of the PEG / LiOAc reaction mixture according to the number of experimental reactions. Each reaction contains 240μL 50% PEG, 36μL LiOAc and 25μL salmon sperm single-stranded ssDNA. (8) Add the corresponding vector (see above), 300 μL PEG / LiOAc reaction mixture and 100 μL yeast competent cells to a sterilized 1.7 mL centrifuge tube, mix well and incubate at 42°C for 45 min. (9) Collect the cells by centrifugation at 700 g for 5 min at room temperature, discard the supernatant and resuspend in 200 μL 0.9% NaCl solution, spread evenly on SD-Leu / -Trp solid yeast defective medium, and incubate at 30°C for 3-4 days until colonies appear. (10) Pick about 10 single clones from the SD-Leu / -Trp solid yeast defective medium and place them in 100 μL 0.9% NaCl solution, and prepare 10-fold and 100-fold dilution yeast solutions at the same time. (11) Take 6 μL of yeast suspension and spot it on SD-Leu / -Trp, SD-Leu / -Trp / -His / -Ade containing acetone, and SD-Leu / -Trp / -His / -Ade solid yeast defective medium containing 10 μM rac-GR24, and culture it upside down at 30°C for 3-7 days before taking photos and analyzing them.

[0074] Yeast culture medium formula:

[0075] 1L of YPAD liquid medium includes 10 grams of Bacto-yeast extract and 20 grams of Bacto-peptone.

[0076] 20 g Dextrose and 100 mg Adenine sulfate.

[0077] 1L of YPAD solid medium is prepared by adding 15g of Agar to the above YPAD liquid medium.

[0078] 1L of yeast amino acid deficiency medium includes 6.7g of yeast nitrogen base medium without amino acids, 0.6-0.7g (added according to the instructions of the specific deficiency SD) of Dropout mix, 20g of Glucose and 20g of Agar. These yeast medium formulas need to be autoclaved at 121°C for 15min and stored at 4°C.

[0079] The results showed that after mutations at the D606, L644 and E704 sites of D3 on the interaction interface, the interaction between D14 and D3 in yeast disappeared. After mutations at the T599, H668 and R702 sites of D3, the interaction between D14 and D3 in yeast was significantly weakened. Figure 1 (A).

[0080] 2. Yeast three-hybrid assay

[0081] The corresponding vectors include: pGADT7-D53, pBridge, pBridge-MCS1-OsSKP1-D3-MCS2-Blank, pBridge-MCS1-OsSKP1-D3-MCS2-D14ΔN, pBridge-MCS1-OsSKP1-D3 T599 -MCS2-D14ΔN, pBridge-MCS1-OsSKP1-D3 D606A -MCS2-D14ΔN, pBridge-MCS1-OsSKP1-D3 L644A -MCS2-D14ΔN, pBridge-MCS1-OsSKP1-D3 H668A -MCS2-D14ΔN, pBridge-MCS1-OsSKP1-D3 R702A -MCS2-D14ΔN and pBridge-MCS1-OsSKP1-D3 E704A-MCS2-D14ΔN. pBridge is an empty vector, which is recorded in the non-patent document "Yu, H., Yang, L., Long, H., Su, X., Wang, Y., Xing, Q., Yao, R., Zhang, M., and Chen, L. (2022). Strigolactone signaling complex formation in yeast: A paradigm for studying hormone-induced receptor interaction with multiple downstream proteins. Methods Enzymol. 674, 519-541.". The public can obtain the biological material from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes. pGADT7-D53, referred to as AD-D53, is recorded in the non-patent document "Song, X., Lu, Z., Yu, H., Shao, G., Xiong, J., Meng, X., Jing, Y., Liu, G., Xiong, G., Duan, J., et al. (2017). IPA1 functions as a downstream transcription factor repressed by D53 in strigolactone signaling in rice. Cell Res. 27, 1128-1141.". The public can obtain this biological material from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. This biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0082] The pBridge-MCS1-OsSKP1-D3-MCS2-Blank vector is a recombinant expression vector obtained by adding the OsSKP1-D3 fusion protein encoding CDS nucleotide sequence to the BamH1 single enzyme recognition site of the pBridge vector, while keeping other nucleotide sequences of the pBridge vector unchanged.

[0083] The primers for constructing pBridge-MCS1-OsSKP1-D3-MCS2-Blank are:

[0084] BamHI-OsSKP1-D3-F:

[0085] BamHI-OsSKP1-D3-R:

[0086] Among the above primers, the bold black sequences are primers for amplifying OsSKP1-D3, and the underlined sequences are used for homologous recombination with the pGBKT7 vector.

[0087] The pBridge-MCS1-OsSKP1-D3-MCS2-D14ΔN vector is a recombinant expression vector obtained by adding the OsD14ΔN gene CDS nucleotide sequence between the NotI and BglII restriction enzyme recognition sites of the pBridge-MCS1-OsSKP1-D3-MCS2-Blank vector, while keeping the other nucleotide sequences of the pBridge-MCS1-OsSKP1-D3-MCS2-Blank vector unchanged.

[0088] Not I-MCSI I-D14ΔN-F:

[0089] BglII-MCSII-D14ΔN-R:

[0090] Among the above primers, the bold black sequence is the primer for amplifying D14ΔN, and the underlined sequence is used for homologous recombination with the pBridge-MCS1-OsSKP1-D3-MCS2-Blank vector.

[0091] To construct the mutant amino acid form of D3, pBridge-MCS1-OsSKP1-D3 T599A -MCS2-D14ΔN, pBridge-MCS1-OsSKP1-D3 D606A -MCS2-D14ΔN, pBridge-MCS1-OsSKP1-D3 L644A -MCS2-D14ΔN, pBridge-MCS1-OsSKP1-D3 H668A -MCS2-D14ΔN, pBridge-MCS1-OsSKP1-D3 R702A -MCS2-D14ΔN and pGBKT7-OsSKP1-D3 E704A The corresponding primers for introducing mutations were used to circularly amplify the BK-OsSKP1-D3 vector as a template to obtain the final vector for site-directed mutation of amino acids. In the following primers, the base sequence of the amino acid site for site-directed mutation is in bold black.

[0092] D3-T599A-F:

[0093] D3-T599A-R:

[0094] D3-D606A-F:

[0095] D3-D606A-R:

[0096] D3-L644A-F:

[0097] D3-L644A-R:

[0098] D3-H668A-F:

[0099] D3-H668A-R:

[0100] D3-R702A-F:

[0101] D3-R702A-R:

[0102] D3-E704A-F:

[0103] D3-E704A-R:

[0104] Experimental method: The method of yeast three-hybridization refers to "1. Yeast two-hybridization experiment" in Example 1, "Experimental method steps (1) to (10)". The last step was adjusted. 6 μL of yeast suspension was spotted on SD-Leu / -Trp, SD-Leu / -Trp / -His / -Ade / -Met containing acetone, and SD-Leu / -Trp / -His / -Ade-Met solid yeast defective medium containing 10 μM rac-GR24, and cultured upside down at 30°C for 3-7 days before photographing and analysis.

[0105] The results showed that the T599A, D606A, L644A, H668A, R702A, and E704A mutations of D3 impaired or blocked the formation of the D3-D14-D53 complex ( Figure 1 (middle B).

[0106] 3. D3 mutant inhibits rac-GR24-induced D14-D3 interaction

[0107] Experimental methods:

[0108] The 35S:D14-FLAG plasmid is a recombinant expression plasmid obtained by inserting the CDS nucleotide sequence of the OsD14 gene into 35S:FLAG. The primer sequence is:

[0109] OsD14-SpeI-SCC-3FLAG-F:

[0110] OsD14-XhoI-SCC-3FLAG-R:

[0111] Among the above primers, the bold black sequence is the primer for amplifying OsD14, and the underlined sequence is used for homologous recombination with the 35S:FLAG vector.

[0112] The 35S:D3-GFP plasmid is a recombinant expression plasmid obtained by inserting the CDS nucleotide sequence of the OsD3 gene into 35S:GFP, wherein the D3 mutant amino acid site-directed mutagenesis primers are used for yeast two-hybrid and yeast three-hybrid experiments.

[0113] 35S:D3 T599A -GFP plasmid is D3 T599A The recombinant expression plasmid obtained by inserting the sequence of D3 into 35S:GFP. T599A The amino acid sequence of D3 was modified from T to A at the 599th amino acid position.

[0114] 35S:D3 H668A -GFP plasmid is D3 H668A The recombinant expression plasmid obtained by inserting the sequence of D3 into 35S:GFP. H668A The amino acid sequence of D3 was modified from H to A at the 668th amino acid position.

[0115] 35S:D3 E704A -GFP plasmid is D3 E704A The recombinant expression plasmid obtained by inserting the sequence of D3 into 35S:GFP. E704A The 704th amino acid position of the amino acid sequence of D3 was mutated from E to A.

[0116] 35S:D3 D606A -GFP plasmid is D3 D606A The recombinant expression plasmid obtained by inserting the sequence of D3 into 35S:GFP. D606A The amino acid sequence of D3 was modified from D to A at the 606th amino acid position.

[0117] 35S:D3 L644A -GFP plasmid is D3 L644A The recombinant expression plasmid obtained by inserting the sequence of D3 into 35S:GFP. L644A The amino acid sequence of D3 was modified from L to A at the 644th amino acid position.

[0118] 35S:D3 R702A -GFP plasmid is D3R702A The recombinant expression plasmid obtained by inserting the sequence of D3 into 35S:GFP. R702A The amino acid sequence of D3 was modified from R to A at the 702nd amino acid position.

[0119] 35S:D3 3M -GFP plasmid is D3 3MA The recombinant expression plasmid obtained by inserting the sequence of D3 into 35S:GFP. 3M The amino acid sequence of D3 was obtained by mutating the 606th amino acid position from D to A, the 644th amino acid position from L to A, and the 702nd amino acid position from R to A.

[0120] Protoplasts of rice seedlings were prepared with reference to the literature "Bart, R., Chern, M., Park, CJ, Bartley, L., and Ronald, PC (2006). A novel system for gene silencing using siRNAs in rice leaf and stem-derived protoplasts. Plant Methods 2, 13.", and plasmids 35S:D3-GFP plasmid, 35S:D3 T599A -GFP plasmid, 35S:D3 H668A -GFP plasmid, 35S:D3 E704A -GFP plasmid, 35S:D3 D606A -GFP plasmid, 35S:D3 L644A -GFP plasmid, 35S:D3 R702A -GFP plasmid or 35S:D3 3M -GFP plasmid and 35S:D14-FLAG plasmid were co-transformed into the aforementioned rice protoplasts.

[0121] The rice protoplast immunoprecipitation method was as follows: 10 reactions (10 2 mL centrifuge tubes) for each combination were cultured at 28 °C in the dark for 14 h, and then centrifuged at 150 g for 3 min to collect the protoplasts; 0.2 mL of W5 solution (154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 2 mM MES, pH 5.7) was added to each 2 mL centrifuge tube to resuspend the previously transformed 35S:D3-GFP plasmid + 35S:D14-GFP plasmid, 35S:D3 T599A -GFP plasmid + 35S:D14-GFP plasmid, 35S:D3 H668A -GFP plasmid + 35S:D14-GFP plasmid or 35S:D3 E704A-GFP plasmid + 35S:D14-GFP plasmid, 35S:D3 D606A -GFP plasmid + 35S:D14-GFP plasmid, 35S:D3 L644A -GFP plasmid + 35S:D14-GFP plasmid, 35S:D3 R702A -GFP plasmid + 35S:D14-GFP plasmid or 35S:D3 3M -GFP plasmid + 35S:D14-FLAG plasmid protoplasts, 10 reactions in each combination were first combined into a 5mL centrifuge tube, and then equally divided into two new 2mL centrifuge tubes; 1μL 50mM rac-GR24 or 1μL acetone was added to the protoplasts, and after incubation at 28℃ in the dark for 1h, the protoplasts were collected by centrifugation at 150g for 3min; 1mL IP protein extraction solution (50mM Tris-HCl (pH7.5), 150mM NaCl, 10% (v / v) glycerol, 0.5% Nonidet P-40, 1x Rochec Omplete TM Protoplasts were lysed with 1 μL of 50 mM rac-GR24 or 1 μL of acetone and 25 μL of GFP-Trap beads (ChromoTek, Cat# Gta-200) at 4°C, and the mixture was incubated with an IP protein cleaning solution (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10% (v / v) glycerol, 0.1% Nonidet P-40, 1x Roche cOmplete TM Protease Inhibitor Cocktail) was used for 3 times, and 25 μL SDS loading was added and vortexed to mix. The samples were denatured at 100°C for 5 min, and then subjected to Western Blot experiments, where the FLAG antibody was a mouse monoclonal antibody (Sigma-Aldrich, Cat#F1804) at a dilution ratio of 1:3,000, and the GFP antibody was a mouse monoclonal antibody (Roche, Cat#11814460001) at a dilution ratio of 1:3,000.

[0122] The results showed that in rice, the T599A, D606A, L644A, H668A, R702A and E704A mutations of D3 also significantly inhibited the D14-D3 interaction induced by rac-GR24 (Figure 2 A and B).

[0123] The triple mutation of D606A, L644A and R702A completely blocked the strigolactone-induced interaction between D14 and D3 ( Figure 2 (middle B).

[0124] This shows that the D3 amino acid in the interaction interface of the AtD14-D3-ASK1 complex is very important for the direct interaction between D14 and D3.

[0125] Example 2: Multi-tillering phenotype of the site-directed editing mutant of the D3 gene L644

[0126] Source of pH-PABE-7 (pH-PABE-7-sgRNA) vector: recorded in the non-patent literature "Li, C., Zong, Y., Wang, Y., Jin, S., Zhang, D., Song, Q., Zhang, R., and Gao, C. (2018). Expanded baseediting in rice and wheat using a Cas9-adenosine deaminase fusion. Genome Biol. 19, 59.". The public can obtain this biological material from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. This biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0127] 1. Vector construction

[0128] The recombinant vector D3L644-pH-PABE-7 is a recombinant vector obtained by inserting the nucleotides CCGGAGCCTGACATTGCCAG at positions 1917-1936 in SEQ ID No. 2 (i.e., the nucleotides 2000-2019 of the wild-type genomic sequence of the OsD3 gene) into the Bsa I restriction enzyme recognition site of the pH-PABE-7 vector, while keeping the other nucleotide sequences of the pH-PABE-7 vector unchanged.

[0129] D3L644 genomic site-directed oligo adapter primers:

[0130] D3L644-ABE-F:

[0131] D3L644-ABE-R:

[0132] The bold black lines indicate the editing target sequence of D3.

[0133] 1) Dissolve the adapter primers D3L644-ABE-F and D3L644-ABE-R into 100 μM master solutions, take 5 μL of each, mix to obtain a primer mixture, and further dilute to 1 μM with water. Place at 95°C for 30 seconds, then turn off the PCR instrument and slowly cool to complete annealing to obtain the oligo dimer adapter.

[0134] 2) Enzyme digestion of pH-PABE-7 vector: 2 μg of pH-PABE-7 vector was digested with 25 U of Bsa I in a 50 μL reaction system for 5 h, and then purified to obtain the pH-PABE-7 vector after enzyme digestion.

[0135] The adapter was connected to the digested vector: 1 μL 10×T4 DNA ligase buffer, 1 μL T4 DNA ligase, 0.5 μL diluted sgRNA mixture (the aforementioned oligo dimer adapter) and 1 μL digested linear vector (the aforementioned digested pH-PABE-7 vector), and finally ddH2O was added to the total volume of 10 μL, and the connection was carried out overnight at 16°C to obtain the D3L644-pH-PABE-7 recombinant vector.

[0136] 2. Obtaining transgenic plants

[0137] (1) Conversion

[0138] Using japonica rice Nipponbare NP as the rice receptor, the seeds of the japonica rice Nipponbare NP to be transformed were shelled, surface disinfected with 70% (v / v) ethanol for 1 minute, then rotated and washed with sodium hypochlorite with an effective concentration of 2.5% (w / v) for 45 minutes, washed three times with sterile water, and then sown on NB solid culture medium and cultured at 28°C in the dark for two weeks. After callus tissue grows at the mature embryo scutellum, the callus tissue is cut off and subcultured on a new NB solid culture medium, and transferred to a new NB solid culture medium every 7 days. After 3-4 times, Agrobacterium infection can be carried out.

[0139] 1L LB solid medium composition: Tryptone 10g, Yeast Extract 5g, NaCl 10g, agar 15g.

[0140] 1L LB liquid culture medium composition: Tryptone 10g, Yeast Extract 5g, NaCl 10g.

[0141] Composition of rice transformation solution: Add the following reagents to NB basic medium: Inositol 2g / L, Glutamine 2g / L, Casein hydrolysate 500mg / L, 10% Synperonic PE 10ml / L, Acetosyringone 100μM.

[0142] When the rice callus tissue is in good growth condition, the recombinant vector D3L644-pH-PABE-7 is transformed into the Agrobacterium EHA105 strain by high-voltage electroporation and spread on LB solid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin for 2-3 days. 4-5 single clones of each transformation are selected and inoculated into 7 mL of LB liquid culture medium containing kanamycin and 25 mg / L rifampicin, and then cultured overnight at 250 rpm at 28°C. The bacteria are centrifuged at 3,000 rpm for 5 minutes at room temperature and resuspended with rice transformation solution for transformation of rice callus tissue.

[0143] (2) Agrobacterium EHA105 infection of rice callus

[0144] The callus tissue in good condition obtained in step (1) was collected, and an appropriate amount of transformation liquid was added until the bacterial liquid completely submerged the callus tissue, and the callus tissue was placed at room temperature for 20 minutes, during which time it was shaken from time to time. Then, the transformed callus tissue was taken out, and the excess bacterial liquid was absorbed with sterile filter paper. The callus tissue was placed in an incubator at 23°C in the dark and cultured for 2-3 days to obtain transgenic callus tissue.

[0145] (3) Differentiation

[0146] The rice callus obtained in step (2) is transferred to a NB solid screening medium containing hygromycin, cultured in the dark at 28°C for 7-10 days, and then subcultured to a new NB solid screening medium containing hygromycin, and 3-4 rounds of hygromycin screening medium are performed. The callus with good growth status is propagated to a differentiation medium for differentiation and regeneration of seedlings, and after culturing at 28°C for about one month, the grown seedlings are transferred to a rooting medium for about 4 weeks for rooting and strengthening, and then transplanted to a greenhouse for about one month before being transferred to the field.

[0147] 3. Identification of positive plants

[0148] The specific method is as follows: Leaves are taken from individual rice plants, and rice genomic DNA is extracted by the CTAB method. The extracted DNA is used as a template, and PCR amplification is performed using D3-detect (1563)-transgenic-F and D3-detect (2533)-transgenic-R identification primers, respectively. The PCR products are sent to Beijing Ruibo Xingke Biotechnology Co., Ltd. for Sanger sequencing to obtain sequencing results. The sequencing results are compared with the sequence of the wild-type plant Nipponbare. If there is only one PCR amplification product of the regenerated plant, and the nucleotide sequence is consistent with the PCR amplification product of the wild-type plant Nipponbare, the regenerated plant is wild-type. If there are two PCR amplification products of the regenerated plant, one is consistent with the nucleotide sequence of the PCR amplification product of the wild-type plant Nipponbare, and the other is mutated compared with the nucleotide sequence of the PCR amplification product of the wild-type plant Nipponbare (the mutation includes the deletion, insertion or substitution of one or more nucleotides), the regenerated plant is heterozygous. If there are two PCR amplification products of the regenerated plant, and both of them have mutations compared with the nucleotide sequence of the PCR amplification product of the wild-type plant Nipponbare (mutations include deletions, insertions or substitutions of one or more nucleotides), the regenerated plant is a biallelic mutant type. If there is one PCR amplification product of the regenerated plant, and both of them have mutations compared with the nucleotide sequence of the PCR amplification product of the wild-type plant Nipponbare (mutations include deletions, insertions or substitutions of one or more nucleotides), the regenerated plant is a homozygous mutant type. If there are three or more PCR amplification products of the regenerated plant, the regenerated plant is a mosaic type. Heterozygous, biallelic mutant, homozygous mutant, and mosaic plants are collectively referred to as edited plants.

[0149] Primers for identifying homozygous mutant rice transgenic positive seedlings of D3 gene mutation:

[0150] D3-detect(1563)-transgenic-F:5'-GCTCAGGTCACTCTCCCTATG-3';

[0151] D3-detect(2533)-transgenic-R:5'-GCCAATTTGCCAATTACTCTTG-3'.

[0152] PCR reaction system: 1μL DNA template, 2μL 10μM Primer F, 2μL 10μM Primer R and 45μL Gold Mix. Reaction procedure: 98℃ pre-denaturation for 3min; 35 cycles of 98℃ denaturation for 10s, 55℃ annealing for 15s, 72℃ extension for 15s; 72℃ extension for 5min.

[0153] Plants with non-synonymous mutations at leucine 644 were the focus of subsequent research. As a result, a total of 4 D3L644-pH-PABE-7 homozygous plants were obtained. The homozygous plants used in subsequent experiments were named CRI-d3 L644S Compared with wild-type rice, CRI-d3 L644S The D3 genes in the two homologous chromosomes of the OsD3 gene underwent the following mutations: the nucleotide 2014 of the wild-type genomic sequence of the OsD3 gene was mutated from T to C, corresponding to the nucleotide 1931 of the CDS (SEQ ID No. 2) being mutated from T to C, and the amino acid at position 644 was mutated from leucine Leu (L) to serine Ser ( Figure 3 ).

[0154] 4. Count the number of tillers of homozygous positive plants

[0155] The experimental method is as follows: Japonica rice Nipponbare NP, the homozygous plant CRI-d3 L644S Planted in the field at the experimental base of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Changping District, Beijing, 24 plants were planted in each line with a spacing of 17 cm between plants and rows, and the growth period was from May to November each year. The field phenotypic survey time of rice materials was from September 20 to October 7 each year. The number of tillers counted was the number of effective tillers at maturity (i.e. the number of tillers that grew ears), and the plant height was the distance between the highest ear of rice and the ground. Based on the average number of tillers of each material, representative single-plant transplant pots were selected for photography.

[0156] The results showed that the D3 site-directed editing homozygous mutant CRI-d3 L644S It presents a dwarf multi-tillering phenotype ( Figure 4 ).

[0157] 5. CRI-d3 L644S Detection of D53 protein levels

[0158] Western Blot assay was used to detect CRI-d3 L644SThe degradation of D53 protein is measured as follows: (1) Prepare a 10% concentration 12-well or 15-well SDS-PAGE protein gel. The amount of protein sample loaded depends on the experimental requirements. Set the voltage to 80-120V for about 1-2h. (2) Use the semi-dry transfer method to transfer the protein to the PVDF or NC membrane. The voltage is 15-20V and the transfer time is 30-60min. (3) During the transfer, prepare 4% skimmed milk powder in TBST solution. After the transfer, place the PVDF or NC membrane in 4% skimmed milk powder and incubate it at room temperature at 70rpm on a shaker for 60min. (4) Pour out the skimmed milk powder, rinse with TBST, add new 4% skimmed milk powder, add the protein antibody to be detected, and incubate for 1-2h or overnight at 4℃. (5) After incubation with the primary antibody, wash the PVDF or NC membrane three times with TBST, each time at 70 rpm for 5 minutes at room temperature, then add 4% skim milk containing the secondary antibody and incubate at room temperature for 60 minutes on a 60 rpm shaker. (6) After incubation with the secondary antibody, wash the membrane three times with TBST, each time at 70 rpm for 5 minutes at room temperature. Add the color developing solution and use a photosensitive film or a protein developing instrument for protein development. GFP mouse monoclonal antibody (Cat#11814460001) was purchased from Roche. The internal reference protein is Actin, purchased from Abmart, Cat#M20009L.

[0159] D53 is the core inhibitory protein of the strigolactone signaling pathway, and its protein amount is directly related to the strength of the strigolactone signal. L644S The D53 protein level in the stem base of the mutant 2-week-old seedlings was also significantly higher than that of the wild type ( Figure 5 ), consistent with typical strigolactone synthesis or accumulation of signaling mutant D53, indicating that CRI-d3 L644S It is a typical mutant of the strigolactone pathway.

[0160] SEQ ID No.1 Wild-type amino acid sequence encoded by D3 gene

[0161] MAEEEEVEEGRSSSSAILDLPEPLLLHILSFLTDVRSRHRAALACGRMRAAERATRSELSLRGDPRSPGFLFLSHAFRFPALEHLDLSLVSPWGHPLLSSVPPCGGGGGGAPSASSSSGMNVYHPEAISEQNAFIAARLAGCFPAVTSLAVYCRDPTTLANLTPHWQASLRRVKLVRWHQRPPTLPDGADLEPLLETCAALRELDLSEFYCWTEDVVRALTTHPSATAALTHLDLGLAAATDGFKSSELGPIAASCPNLRKLVAPCLFNPRFSDCVGDDALLSLATSCPRLTVLRLSEPFEAAANIQREEAAITVAGLVAFFAALPALEDFTMDLQHNVLEAAPAMEALARRCPRIKFLTLGSFQGLCKASWLHLDGVAVCGGLESLYMKNCQDLTDASLAAIGRGCRRLAKFGIHGCDLVTSAGIRRLAFTLRPTLKEVTVLHCRLLHTAECLTALSPIRDRIESLEINCVWNTTEQPCSVANGTTTECDPEDDELGEVYESAAKKCRYMEFDDLGSWEMLRSLSLWFSAGQLLSPLISAGLDSCPVLEEISIKVEGDCRTCPRPAPRTIFGLSDLAGFPVLAKMKLDLSEAVGYALTAPTGQMDLSLWERFYLHGIESLQTLYELDYWPPQDKDVHHRSLTLPAVGLIQRCVGLRKLFIHGTTHEHFMTFFLSIPNLRDMQLREDYYPAPENDLMFTEMRAESWLRFEVQLNSRQIDD*。

[0162] CDS nucleotide sequence encoded by SEQ ID No.2D3 gene

[0163]

[0164] Wild-type genomic sequence of the OsD3 gene

[0165]

[0166] OsSKP1-D3 fusion protein encoding CDS nucleotide sequence

[0167] 5'-ATGGCGGCTGAGGGAGAGAAGAAGATGATCACCCTGAAGAGCTCCGACGGGGAGGAGTTCGAGGT GGAGGAGGCGGTGGCGATGGAGTCGCAGACGATCCGCCACATGATCGAGGACGACTGCGCCGACAACGGCATCCCG CTCCCCAACGTCAACTCCAAGATCCTCTCCAAGGTCATCGAGTACTGCAACAAGCACGTGCACGCCGCGGCCGCCG CGGCCTCCAAGGCCGCCGACGACGCCGCGTCCGCCGCCGCAGCCGTGCCGCCGCCCTCCGGCGAGGACCTCAAGAA CTGGGACGCCGACTTCGTCAAGGTCGACCAGGCCACCCTCTTCGACCTCATCCTGGCCGCGAACTACCTCAACATC AAGGGGTTGCTGGACCTTACTTGCCAGACTGTTGCTGACATGATCAAGGGGAAGACTCCTGAGGAGATCCGCAAGA CCTTCAACATCAAGAACGACTTCACCCCTGAGGAGGAAGAGGAGATCCGCAGGGAGAACCAGTGGGCTTTTGAG3'。

[0168] OsD14 gene CDS nucleotide sequence

[0169] 5'-ATGCTGCGATCGACGCATCCGCCGCCCAGTAGCCCGAGCAGCAGCAGCAGCGGCGGCGGCGGGGGCGGGGGGTCGTCGGCGTCGTCGAGCTCGGAGAAGACGATGGTGGGCGGCGGGGGAGGAGGGGGAGGAGGGAGCGGGTCGGCGGCGCCGAGCGGGGCGAAGCTGCTGCAGATCCTGAACGTGCGGGTGGTGGGGAGCGGCGAGCGGGTGGTGGTGCTGTCGCATGGCTTCGGGACGGACCAGTCGGCGTGGAGCCGCGTGCTGCCGTACCTCACCCGCGACCACCGCGTCGTGCTCTACGACCTCGTCTGCGCCGGCAGCGTCAACCCGGACCACTTCGACTTCCGCCGCTACGACAACCTCGACGCCTACGTCGACGACCTGCTCGCCATCCTCGACGCGCTCCGCATCCCGCGCTGCGCCTTCGTCGGCCACTCCGTCTCCGCCATGATCGGCATCCTCGCCTCCATCCGACGACCTGACCTCTTCGCCAAGCTTGTCCTCATCGGCGCCTCTCCCCGGTTCTTGAACGACAGCGACTACCACGGCGGGTTCGAGCTGGAGGAGATACAGCAGGTGTTCGACGCGATGGGGGCGAACTACTCGGCGTGGGCGACGGGGTACGCGCCTCTGGCGGTGGGCGCCGACGTGCCGGCGGCGGTGCAGGAGTTCAGCCGCACCCTCTTCAACATGCGCCCGGACATCTCCCTCCACGTCTGCCAGACCGTCTTCAAGACCGACCTCCGCGGCGTGCTCGGCATGGTCCGCGCCCCCTGCGTCGTCGTCCAGACCACCCGCGACGTCTCCGTCCCGGCCTCCGTCGCCGCCTACCTCAAGGCCCACCTCGGCGGCCGCACCACCGTCGAGTTCCTCCAGACCGAGGGTCACCTCCCCCACCTCAGCGCCCCCAGCCTCCTCGCCCAGGTGCTCCGCCGCGCTCTCGCCCGGTACTAA-3'。

[0170] CDS nucleotide sequence of OsD14ΔN gene

[0171] 5'-ATGAGCGGGGCGAAGCTGCTGCAGATCCTGAACGTGCGGGTGGTGGGGAGCGGCGAGCGGGTGGTGGTGCTGT CGCATGGCTTCGGGACGGACCAGTCGGCGTGGAGCCGCGTGCTGCCGTACCTCACCCGCGACCACCGCGTCGTGCTCTACGACCTCGTCTGCGCCGGCAGCGTCAACCCGGACCACTTCGACTTCCGCCGCTACGACAACCTCGACGCCTACGTCGACGACCTGCTCGCCATCCTCGACGCGCTCCGCATCCCGCGCTGCGCCTTCGTCGGCCACTCCGTCTCCGCCATGATCGGCATCCTCGCCTCCATCCGACGACCTGACCTCTTCGCCAAGCTTGTCCTCATCGGCGCCTCTCCCCGGTTCTTGAACGACAGCGACTACCACGGCGGGTTCGAGCTGGAGGAGATACAGCAGGTGTTCGACGCGATGGGGGCGAACTACTCGGCGTGGGCGACGGGGTACGCGCCTCTGGCGGTGGGCGCCGACGTGCCGGCGGCGGTGCAGGAGTTCAGCCGCACCCTCTTCAACATGCGCCCGGACATCTCCCTCCACGTCTGCCAGACCGTCTTCAAGACCGACCTCCGCGGCGTGCTCGGCATGGTCCGCGCCCCCTGCGTCGTCGTCCAGACCACCCGCGACGTCTCCGTCCCGGCCTCCGTCGCCGCCTACCTCAAGGCCCACCTCGGCGGCCGCACCACCGTCGAGTTCCTCCAGACCGAGGGTCACCTCCCCCACCTCAGCGCCCCCAGCCTCCTCGCCCAGGTGCTCCGCCGCGCTCTCGCCCGGTACTAA-3'。

[0172] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A method for preparing rice with increased tillering number, characterized in that: The method comprises mutating the coding gene of OsD3 in target rice containing the coding gene of OsD3 to obtain rice with increased tillering number, wherein the tillering number of the rice with increased tillering number is greater than that of the target rice; the OsD3 is a protein whose amino acid sequence is SEQ ID No.1, the 644th amino acid of the OsD3 is the 644th amino acid of SEQ ID No.1, and the 644th amino acid is leucine; and the mutation is to mutate the codon encoding the 644th amino acid of the OsD3 in the coding gene in the target rice genome into a codon encoding other amino acids.

2. A method for increasing the number of rice tillers, characterized in that: The method comprises mutating the coding gene of OsD3 in a recipient rice plant containing the coding gene to increase the tiller number of the recipient rice plant, wherein the OsD3 is a protein whose amino acid sequence is SEQ ID No. 1, the 644th amino acid of the OsD3 is the 644th amino acid of SEQ ID No. 1, and the 644th amino acid is leucine; and the mutation comprises mutating the codon encoding the 644th amino acid of the Os D3 in the coding gene in the target rice genome into a codon encoding other amino acids.

3. Application, characterized in that, The application is the application of the protein or a substance that regulates the expression of a gene encoding the protein or a substance that regulates the activity and / or content of the protein in any of the following: M1) Regulate the number of plant tillers; M2) preparing products for regulating the number of tillers of plants; M3) Plant breeding; The protein is OsD3, and the OsD3 is a protein whose amino acid sequence is SEQ ID No.

1.

4. The use according to claim 3, characterized in that: The regulation is to inhibit, reduce or down-regulate the expression of the gene encoding OsD3 or the content or activity of OsD3.

5. The use according to claim 3, characterized in that: The substance is any of the following: C1) a nucleic acid molecule that inhibits, reduces or downregulates the expression of the gene encoding OsD3, C2) expressing a gene encoding the nucleic acid molecule described in C1), C3) an expression cassette containing the gene described in C2), C4) a recombinant vector containing the gene described in C2) or a recombinant vector containing the expression cassette described in C3), C5) a recombinant microorganism containing the gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4), C6) a transgenic plant cell line containing the gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4), C7) a transgenic plant tissue containing the gene described in C2), or a transgenic plant tissue containing the expression cassette described in C3), or a transgenic plant tissue containing the recombinant vector described in C4), C8) A transgenic plant organ containing the gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

6. Application, characterized in that, The application is the application of the protein or a substance that regulates the expression of a gene encoding the protein or a substance that regulates the activity and / or content of the protein in any of the following: M1) Regulate the number of plant tillers; M2) preparing products for regulating the number of tillers of plants; M3) Plant breeding; The protein is an OsD3 mutant, and the OsD3 mutant is a protein in which the amino acid at position 644 of SEQ ID No. 1 is mutated from leucine to serine while the other amino acids of SEQ ID No. 1 remain unchanged.

7. The use according to claim 6, characterized in that: The regulation is to upregulate, enhance or increase the expression of the gene encoding the OsD3 mutant or the content or activity of the OsD3 mutant.

8. A protein, characterized in that The protein is a protein in which the 644th amino acid of SEQ ID No. 1 is mutated from leucine to serine while the other amino acids of SEQ ID No. 1 remain unchanged.

9. A nucleic acid molecule, characterized in that A nucleic acid molecule encoding the protein of claim 1.

10. Biomaterial, characterized in that The biological material is any substance described in claim 5.

Images