A Beauveria bassiana HCSF-Bb001 for controlling Solenopsis invicta and its application

Abstract

The present invention discloses a Beauveria bassiana HCSF-Bb001 for controlling Solenopsis invicta, which relates to the technical field of microorganisms and has a preservation number of GDMCC NO: 64626. The present invention provides a strain of Beauveria bassiana HCSF-Bb001, which has a fast growth rate and a high sporulation amount, and is a strain with strong pathogenicity to the worker ants, larvae and pupae of Solenopsis invicta, with the most prominent pathogenicity to the larvae, followed by the pupae, and then the worker ants. This strain is a biocontrol strain with good application prospects in the sustainable control of Solenopsis invicta and can be widely used for the biological control of Solenopsis invicta.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and more specifically, to a Beauveria bassiana HCSF-Bb001 for controlling Solenopsis invicta Buren and its application. Background Art

[0002] Solenopsis invicta Buren, belonging to Hymenoptera and Formicidae, is a quarantine pest harmful to agriculture, forestry and imported plants, and is also one of the world's recognized 100 most dangerous invasive species. It not only damages the environment and facilities such as farmland, parks and roads, but also bites animals and humans, and can even cause death in severe cases.

[0003] At present, the main means of controlling Solenopsis invicta Buren is chemical control, but problems such as drug resistance, environmental pollution and damage to the ecosystem caused by using chemical drugs to kill Solenopsis invicta Buren are becoming increasingly serious. Biological control of pests is a sustainable prevention and control measure that uses natural enemies and specific pathogens of pests to control pest populations. Among them, due to the characteristics of strong selectivity, low resistance generation in pests, environmental friendliness and harmlessness to humans and livestock of entomopathogenic fungi, the use of environmentally friendly entomopathogenic fungi to control Solenopsis invicta Buren has become a research and development trend and an important means for the sustainable control of Solenopsis invicta Buren.

[0004] Therefore, providing more biological control products and / or methods for Solenopsis invicta Buren is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides a Beauveria bassiana HCSF-Bb001 for controlling Solenopsis invicta Buren and its application. Its conidia have strong pathogenicity to Solenopsis invicta Buren workers, larvae and pupae, are environmentally friendly and pollution-free, and are not prone to drug resistance. It is a biocontrol strain with good application prospects in the sustainable control of Solenopsis invicta Buren and can be widely used for the biological control of Solenopsis invicta Buren.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] A Beauveria bassiana HCSF-Bb001 for controlling Solenopsis invicta Buren, with a preservation number of GDMCC NO: 64626.

[0008] Another object of the present invention is to provide a microbial agent, including the above-mentioned Beauveria bassiana HCSF-Bb001.

[0009] Another object of the present invention is to provide the application of the above-mentioned Beauveria bassiana HCSF-Bb001 or the above-mentioned microbial agent in the preparation of a product for controlling Solenopsis invicta Buren or in controlling Solenopsis invicta Buren.

[0010] Another object of the present invention is a method for controlling red imported fire ants, which comprises spraying the mycelial suspension of the above Beauveria bassiana HCSF-Bb001 or the above microbial agent on red imported fire ants or irrigating the ant nests.

[0011] As a preferred embodiment, the application concentration of Beauveria bassiana HCSF-Bb001 is 1×10 7 ~1×10 8 spores / mL.

[0012] Beneficial effects: The present invention provides a strain of Beauveria bassiana HCSF-Bb001, which has a fast growth rate and a high sporulation amount. It has strong pathogenicity to the workers, larvae and pupae of red imported fire ants, with the most prominent pathogenicity to larvae, followed by pupae, and then workers. This strain is a biocontrol strain with good application prospects in the sustainable control of red imported fire ants and can be widely used in the biological control of red imported fire ants. Description of the Drawings

[0013] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained according to the provided drawings without creative efforts.

[0014] Figure 1 It is a schematic diagram of the colony of Beauveria bassiana HCSF-Bb001 of the present invention.

[0015] Figure 2 It is a diagram of the conidia of Beauveria bassiana HCSF-Bb001 of the present invention.

[0016] Figure 3 It is the symptom of a worker red imported fire ant infected by Beauveria bassiana HCSF-Bb001 of the present invention.

[0017] Figure 4 It is the symptom of a pupa red imported fire ant infected by Beauveria bassiana HCSF-Bb001 of the present invention.

[0018] Figure 5 It is the symptom of a larva red imported fire ant infected by Beauveria bassiana HCSF-Bb001 of the present invention.

[0019] Figure 6 It is the result of the virulence determination of Beauveria bassiana HCSF-Bb001 of the present invention against worker red imported fire ants.

[0020] Figure 7 It is the result of the virulence determination of Beauveria bassiana HCSF-Bb001 of the present invention against larva red imported fire ants.

[0021] Figure 8 These are the results of the virulence assay of Beauveria bassiana HCSF-Bb001 of the present invention against the pupae of Solenopsis invicta. Detailed implementation manners

[0022] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0023] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains.

[0024] The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all commercially available products unless otherwise specified.

[0025] Example 1 Isolation, identification and preservation of strain HCSF-Bb001

[0026] 1. Isolation of the strain

[0027] Strain HCSF-Bb001 was obtained by isolation and purification from the sugarcane weevil cadavers collected from the sugarcane fields in Guohua Town, Pingguo City, Baise City, Guangxi Zhuang Autonomous Region.

[0028] 2. Identification of the strain

[0029] The obtained strain was cultured on PDA medium at 26 ± 1 °C. The colony was white at the initial stage, with a villous surface. The colony began to produce spores after 3 days of culture on PDA medium. When cultured to the 15th day, the colony diameter was about 75 mm. The colony was flat and powdery, with a white surface and a light yellow back (see attached Figure 1 ). The hyphae were colorless, smooth, septate, 2.0 - 3.2 μm wide; the conidiophores were produced from the vegetative hyphae, the conidiophores were solitary or branched, short cylindrical or long flask-shaped, with multiple sporogenous cells at the top or side; the sporogenous cells were cylindrical or flask-shaped; the conidia were colorless, single-celled, spherical or nearly spherical, with a smooth surface, 2.0 - 3.0 μm in diameter, and were borne on the "zigzag" structure formed by the extension of the sporogenous cells (see attached Figure 2 ), and was identified as Beauveria bassiana.

[0030] The rDNA-ITS sequence fragment of strain HCSF-Bb001 was amplified by PCR. The fragment was subjected to nucleotide sequence detection, and the sequence was blasted and aligned in the NCBI database. The results showed that the identity between strain HCSF-Bb001 and Beauveria bassiana reached 100%. Its taxonomic status is Deuteromycotina, Hyphomycetes, Moniliales, Moniliaceae, Beauveria.

[0031] The ITS sequence of strain HCSF-Bb001 is as follows:

[0032] TTCTGTGAACCTACCTATCGTTGCTTCGGCGGACTCGCCCC

[0033] AGCCCGGACGCGGACTGGACCAGCGGCCCGCCGGGGACCTCA

[0034] AACTCTTGTATTCCAGCATCTTCTGAATACGCCGCAAGGCAAA

[0035] ACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGG

[0036] CATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT

[0037] TGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCG

[0038] CCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTC

[0039] AACCCTCGACCTCCCCTTGGGGAGGTCGGCGTTGGGGACCGGC

[0040] AGCACACCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCG

[0041] GCGACCTCTGCGTAGTAATACAGCTCGCACCGGAACCCCGACG

[0042] CGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGA

[0043] ATCAGGTAGGACTACCCGCTGAACTTAAGCATATC, such as SEQ ID NO: 1.

[0044] 3. Preservation of the Strain

[0045] Beauveria bassiana HCSF-Bb001 was deposited in the Guangdong Provincial Culture Collection of Microorganisms with the deposit number GDMCC NO: 64626. Its taxonomic name is Beauveria bassiana. The deposit date was May 16, 2024. The deposit address is the 5th Floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences.

[0046] Example 2 Biological Characteristics of Beauveria bassiana HCSF-Bb001

[0047] Determination of colony growth rate and sporulation amount: Beauveria bassiana HCSF-Bb001 was inoculated in the center of a PDA plate medium by the drop method and cultured in a constant temperature incubator at a temperature of (26±1)°C, a photoperiod of L:D = 12h:12h, and a relative humidity of 80%. The colony diameter was measured daily by the cross method, with 5 replicates for each treatment, and observed for a total of 10 days. At the same time, the time of sporulation onset was recorded. Since sporulation began, the spores were washed down with a sterile 0.05% Tween-80 aqueous solution every day, diluted to an appropriate multiple, and then the spore concentration was measured with a hemocytometer and converted into the sporulation amount per unit area. The experiment was repeated 3 times.

[0048] The measurement results of the growth rate and sporulation amount of Beauveria bassiana HCSF-Bb001 on PDA medium are shown in Table 1 and Table 2 respectively.

[0049] Table 1 Growth Rate of Beauveria bassiana HCSF-Bb001 on PDA Medium

[0050]

[0051] Table 2 Sporulation Amount of Beauveria bassiana HCSF-Bb001 on PDA Medium

[0052]

[0053]

[0054] Note: The data in the table are mean ± standard deviation; different lowercase letters in the table indicate significant differences (P < 0.05).

[0055] As can be seen from Table 1, Beauveria bassiana HCSF-Bb001 grew well on PDA medium at 26 ± 1 °C. It grew relatively fast. When cultured for 1 - 2 days, the colony growth rate was slow; on the 3rd day, the colony grew faster, reaching 0.71 cm / d; the average colony growth rate from the 4th to the 10th day was 0.46 - 0.52 cm / d.

[0056] As can be seen from Table 2, Beauveria bassiana HCSF-Bb001 started sporulating on the 2nd day when cultured on PDA medium, and the spore production was 0.20×10 8 spores / cm 2 ; subsequently, the spore production gradually increased, and reached the maximum on the 7th day, which was 2.90×10 8 spores / cm 2 .

[0057] The above results indicate that the biological characteristics of the strain HCSF-Bb001 of the present invention are good, with a fast growth rate and a high spore production.

[0058] Example 3 Toxicity determination of Beauveria bassiana HCSF-Bb001 against Solenopsis invicta

[0059] Test insect source: Solenopsis invicta nests were collected from the scientific research experimental base of Guangxi Academy of Agricultural Sciences, Xixiangtang District, Nanning City, Guangxi Zhuang Autonomous Region. The nests were dug with a shovel and placed in a large storage box and transported back to the laboratory. After standing for 2 days for the ant colony to rebuild the nest, the ant colony was separated by the water-dropping method and transferred to a plastic box (40 cm long, 30 cm wide, 20 cm high) with the inner wall coated with Teflon. A water test tube, a 10% sucrose water test tube and Tenebrio molitor were placed in the breeding box, and after being bred in the laboratory for 1 - 2 weeks, healthy worker ants, larvae and pupae with basically the same size were selected for bioassay respectively.

[0060] Experimental treatment: Conidia of Beauveria bassiana HCSF-Bb001 were scraped from the PDA plate and prepared into 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 and 1×10 8A spore suspension of [[spores per mL]] is prepared for later use. Red imported fire ant workers, larvae, and pupae are separately placed into the prepared spore suspension. After being immersed for 5 s, they are taken out and placed on sterile filter paper to absorb the excess moisture on the surface of the insects. The workers, larvae, and pupae are respectively placed into plastic bowls lined with moist filter paper. 30 test insects are placed in each bowl, and a layer of Teflon is applied around the bowl mouth to prevent the red imported fire ants from escaping. 1 cotton ball containing sterile water and 1 cotton ball containing 10% sucrose solution are placed in each bowl. Treatment with a sterile 0.05% Tween-80 aqueous solution is used as a control. 30 test insects are used for each treatment, and the experiment is repeated with 3 ant nests, and each ant nest is repeated 3 times. For the larvae and pupae after the immersion treatment, 30 untreated red imported fire ant workers from the same nest are added to the plastic bowls as brood-rearing ants. The experimental temperature is 26 - 28 °C, and the relative humidity is 70% ± 10%. The number of dead test insects is observed and recorded every day after the treatment, and they are picked into a petri dish lined with moist filter paper for moisturizing culture to confirm whether they died from infection by the test strain. The mortality rate and the rate of mummified insects are statistically analyzed. After the data are sorted out by Excel, they are processed and analyzed using SPSS 17.0 software.

[0061] The infection symptoms of red imported fire ant workers, larvae, and pupae by Beauveria bassiana HCSF-Bb001 are shown in Appendix Figure 3 , Appendix Figure 4 , and Appendix Figure 5 respectively.

[0062] The results of the virulence determination show that Beauveria bassiana HCSF-Bb001 has relatively high virulence against red imported fire ant workers, larvae, and pupae. As the spore concentration increases and the treatment time progresses, the mortality rates of red imported fire ant workers, larvae, and pupae all gradually increase (see Appendix Figure 6 , Figure 7 , and Figure 8 ). On the 10th day after the treatment, the mortality rates of red imported fire ant workers, larvae, and pupae treated with spore suspensions at different concentrations (1×10 4 - 1×10 8 spores per mL) are 28.33% - 100%, 52.22% - 100%, and 49.63% - 100% respectively. In particular, the spore suspensions at high concentrations (1×10 7 , 1×10 8 spores per mL) have relatively strong pathogenicity against red imported fire ants. The cumulative mortality rates of red imported fire ant workers, larvae, and pupae reach 95.93% - 100% on the 10th day after the treatment.

[0063] Applying the Probit model, the pathogenicity regression equation of Beauveria bassiana HCSF-Bb001 against red imported fire ant workers on the 10th day is y = -3.83 + 0.80x (χ 2 = 2.73, P = 0.44), the LC 50 is 6.05×10 4 spores per mL, and the 95% confidence interval is 4.02×104 ~8.72×10 4 spores / mL; The pathogenicity regression equation of red imported fire ant larvae is y = -2.19 + 0.53x (χ 2 = 24.12, P = 0.00), and the LC 50 is 1.26×10 4 spores / mL, and the 95% confidence interval is 72.27~7.43×10 4 spores / mL; The pathogenicity regression equation of red imported fire ant pupae is y = -2.59 + 0.62x (χ 2 = 7.05, P = 0.07), and the LC 50 is 1.44×10 4 spores / mL, and the 95% confidence interval is 3.41×10 3 ~3.61×10 4 spores / mL. It shows that Beauveria bassiana HCSF-Bb001 has strong pathogenicity to red imported fire ant workers, larvae and pupae.

[0064] The results of Examples 2 and 3 above show that Beauveria bassiana HCSF-Bb001, CGMCC No.40929 is a strain isolated from naturally infected beetle cadavers that has strong pathogenicity to red imported fire ant workers, larvae and pupae. Its pathogenicity to red imported fire ant larvae is the strongest, followed by red imported fire ant pupae, and then red imported fire ant workers. This strain is suitable for growth on PDA medium at a temperature of 26±1°C. It has a fast growth rate, a fast spore production rate and a large spore production amount, and a good insecticidal effect. It is a biocontrol strain with good application prospects in the sustainable control of red imported fire ants and can be widely used in the biological control of red imported fire ants.

[0065] In this specification, each embodiment is described in a progressive manner. The key point of each embodiment is to illustrate the differences from other embodiments. For the same or similar parts among the embodiments, reference can be made to each other.

[0066] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be obvious to those skilled in the art. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but will conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A Beauveria bassiana HCSF-Bb001 for controlling Solenopsis invicta, characterized in that, The preservation number of the HCSF-Bb001 is GDMCC NO: 64626, and the HCSF-Bb001 has strong pathogenicity to the larvae of Solenopsis invicta.

2. A microbial inoculant, characterized in that, It includes the Beauveria bassiana HCSF-Bb001 described in claim 1.

3. Use of the Beauveria bassiana HCSF-Bb001 described in claim 1 or the microbial agent described in claim 2 in the preparation of a Solenopsis invicta control product or for controlling Solenopsis invicta.

4. A method for controlling red imported fire ants, characterized in that, Spray the suspension of the Beauveria bassiana HCSF-Bb001 described in claim 1 or the microbial agent described in claim 2 on Solenopsis invicta or irrigate the ant nest.

5. The method for preventing and controlling red imported fire ants according to claim 4, wherein The application concentration of Beauveria bassiana HCSF-Bb001 is 1×10 7 ~1×10 8 spores / mL.

Images