Novel method for preparing circular RNA in vitro based on magnetic beads
Through the combination of magnetic bead method and T4 RNA ligase 2, the problems of low cyclization efficiency and introduction of foreign sequences in circular RNA preparation are solved, and efficient and accurate circular RNA preparation is achieved, suitable for industrial production and provides stable immunity Original.
Patent Information
- Application Number
- CN202410987589.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-23
- Publication Date
- 2024-12-20
AI Technical Summary
The existing circular RNA preparation methods have problems with low cyclization efficiency, heterocycle formation, foreign sequence introduction and stability, and it is difficult to meet the needs of industrial production.
Using a magnetic bead-based method, the DNA template is designed for in vitro transcription, and the complementary RNA strands are ligated into circular RNA using T4 RNA ligase 2, and the separation is carried out through magnetic beads to reduce the formation of foreign sequences and heterocycles and improve circular RNA sequence accuracy and ligation specificity.
It achieves efficient and accurate circular RNA preparation, reduces production costs, is suitable for industrial production, and provides stable and low-toxic immunogens for the research and development of circular RNA vaccines.
Smart Images
Figure CN119162173A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a novel method for preparing circular RNA in vitro based on magnetic beads, and belongs to the field of biotechnology. Background Art
[0002] Circular RNA (circRNA) is a type of RNA single-stranded molecule that does not have a 5' end cap and a 3' end poly (A) tail and forms a circular structure with covalent bonds. It is produced by special variable shearing and exists in large quantities in eukaryotic cells. Most of them are derived from exons, and a small number of circRNAs derived from introns exist in the cell nucleus. CircRNA has a closed circular structure, is not easily degraded by nuclease exonucleases, and is more stable than linear RNA, which makes circular RNA have obvious advantages in the development and application of new clinical diagnostic markers.
[0003] CircRNA is a complex that has multiple functions in the body, such as sponges for miRNA or proteins, regulating signaling pathways, and some circRNAs can be translated by ribosomes and encode polypeptides, thereby exercising regulatory functions. Most eukaryotic circRNAs are non-coding RNAs with potential regulatory functions in gene expression. Only a small number of endogenous circRNAs have internal ribosome entry sites (IRESs) that can serve as protein templates. The coding sequences in circRNAs can be translated into antigenic proteins / peptides by ribosomes, and therefore have the potential to be used as vaccines.
[0004] circRNA has its unique advantages. First, it is less prone to degradation and is more stable than mRNA vaccines and drugs. Second, the amount required for rolling circle translation is lower than that of messenger RNA, so it is less toxic. Removing purified byproducts from IVT and RNA cyclization processes may help circRNA avoid RNA sensors and reduce RNA-related natural immunogenicity. The prerequisite for achieving this goal is the need for a mature in vitro circRNA preparation method. Only large-scale in vitro synthesis of circRNA can meet the needs of large-scale industrial biomedical applications.
[0005] At present, the main methods for synthesizing circular RNA are as follows: 1) chemical ligation based on cyanogen bromide or similar condensing agents; 2) enzymatic method based on DNA or RNA ligase (represented by Millipore's Magna RIPTM RNA-BindingProtein Immunoprecipitation Kit); 3) ribozyme method based on intron self-splicing function
[0006] 1 Chemical ligation method
[0007] Chemical ligation of linear RNA can be achieved by cyanogen bromide (BrCN) or 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC). There is a serious problem with the chemical ligation method, because the phosphate migration will form a 2'-5' phosphate bond instead of the natural 3'-5' phosphodiester bond. Using 2' deoxynucleotides for ligation or cyclization at the 3' acid end of the oligonucleotide can effectively avoid the formation of 2' deoxynucleotide phosphate bonds. Traditional chemical synthesis methods often have low cyclization problems, and the length of nucleotides that can be synthesized is generally 70 to 80 nt.
[0008] 2 Enzymatic ligation
[0009] There are three enzymes commonly used for RNA circularization: T4 DNA ligase 1 (T4 Dnl1), T4 RNA ligase 1 (T4Rnl 1) and T4 RNA ligase 2 (T4 Rnl 2).
[0010] T4 DNA Ligase 1:
[0011] With ATP as a cofactor, the gaps of double-stranded DNA, double-stranded RNA or DNA-RNA hybrid chains can be connected. In the single-stranded RNA cyclization experiment, a DNA splint is usually designed to complement the sequences at both ends of the RNA gap to create a local hybrid double strand. This hybrid structure can be recognized by T4 DNA ligase 1, connecting the 5' end and the 3' end to form a phosphodiester bond, thereby obtaining a circularized RNA. Due to the low turnover efficiency of T4 DNA ligase I on RNA substrates, a large amount of enzyme is required to achieve RNA ligation.
[0012] T4 RNA Ligase 1:
[0013] Using ATP as a cofactor, it supports the connection of single-stranded RNA or single-stranded DNA. Under the action of the secondary structure of RNA, the 5' secondary phosphate and 3' nucleotides at both ends are close to the structure, and the connection is achieved under the action of T4 RNA ligase. Ligase has different preferences for the 5' terminal and 3' terminal nucleotides. The 3' terminal nucleotide preference is: A>G≥C>U, and the 5' terminal nucleotide preference is: pC>pU>pA>pG. In addition to the auxiliary role of RNA secondary structure, RNA splints can also be designed to bring the two ends close. It is necessary to design incompletely complementary splint sequences to maintain a single-stranded state at 2 to 3 nucleotides at both ends.
[0014] T4 RNA Ligase 2:
[0015] Relying on ATP, the 3'-OH of RNA can be connected to the 5' phosphate group of RNA or DNA, especially for double-stranded RNA, and complementary DNA or RNA splints are usually designed to promote the efficiency of intramolecular connection. The current methods that rely on enzymatic connection mainly rely on DNA or RNA splints, and the efficiency of cyclization using splints is low, mainly because the efficiency of cyclization of splints that rely on short sequence DNA or RNA cannot be guaranteed.
[0016] Currently, the companies that are developing circularization through T4 RNA ligase technology mainly include Gisai Biotechnology's T4 RNA ligase circularization system, which is based on T4 Rnl 2 and can achieve circularization without splints and auxiliary chains. The splint-independent T4 RNA ligase 2 circularization strategy arranges the sequence of the linear RNA precursor so that the 3' end is located in the double-stranded region. Although the circularization of short-sequence RNA is achieved, this method requires the addition of at least 3 consecutive base pairs to the 3' end of the linear RNA precursor.
[0017] 3 Ribozyme method
[0018] Ribozymes are a type of RNA with enzyme catalysis. The PIE system (type I intron or type II intron) and other ribozymes are used for RNA cyclization.
[0019] The PIE system is a commonly used method for RNA circularization based on the permuted introns and exons (PIE) function of intron self-splicing. It is based on the self-splicing function of type I or type II introns. In the presence of magnesium ions and free GTP, the splicing effect is achieved, leading to the circularization of introns and the connection of intermediate sequences, thereby generating circRNA.
[0020] PIE system-type I intron self-splicing:
[0021] The T4 td gene or the Anabaena tRNA Leu precursor gene is used to design the arranged intron exon (PIE) structure. The arrangement is as follows: the RNA intron and auxiliary exon fragments are divided into two parts, wherein the 5' end-containing sequence is transferred to the tail of the target sequence, and the 3' sequence is inserted into the front end of the target sequence. In the presence of GTP, this PIE structure will lead to self-circularization of sequences other than the intron.
[0022] In 2018, Daneil Aderson and others from the Massachusetts Institute of Technology (MIT) used type I introns with splicing activity to construct circRNA to express exogenous proteins, and applied for a patent for constructing circRNA.
[0023] In March 2021, Yuanyin Bio and Wei Wensheng's research team designed a circular RNA vaccine for the new coronavirus and its variants. Gisai Bio's circPreciseTM platform is also based on type I intron splicing.
[0024] However, this method also has its shortcomings, such as different RNA sequences will lead to great differences in the final circRNA domain, the introduction of exogenous exon sequences will cause the final circRNA sequence to differ from the original linear RNA precursor sequence, and may cause immunogenicity. The conventional PIE cyclization method will retain the auxiliary exon sequence, and it is necessary to strictly design the RNA sequence and introduce RNA sequences similar to the auxiliary exon sequence to prepare circRNA without exogenous genes.
[0025] PIE system-type II intron self-splicing:
[0026] Similar to type I introns, circularization is achieved based on the self-splicing function of introns. Type II introns are derived from the yeast mitochondrial genome. Compared with the type I intron PIE system, the use of type II introns does not require auxiliary exon sequences to generate the expected circRNA sequence. The platforms based on type II intron self-splicing ribozymes mainly include:
[0027] Circular RNA production platform of Circacode Biotechnology and Clean PIE circularization system of CoreMed can avoid the introduction of additional exon sequences during the circularization process, improve the sequence accuracy of circular RNA molecules, and have a higher circularization efficiency.
[0028] Although the circular RNA prepared by this method has no residual foreign sequences, the preparation efficiency is low and it is currently difficult to prepare it industrially. In addition, the wide applicability of this method still needs more research and verification.
[0029] The PIE system has great potential in the preparation of long-sequence circular RNA (circRNA). At present, reasonable circularization rate improvement strategies (such as adding homology arms, inserting spacer sequences, and replacing introns) can achieve the circularization of sequences up to 5kb. However, the main problem with the PIE structure is that the longer the sequence, the lower the circularization rate. Studies have also found that in the presence of magnesium ions, longer circRNAs are more likely to break and open, resulting in a decrease in the yield of circRNA. Therefore, this method is inefficient in preparing circular RNA and cannot meet industrial needs for the time being.
[0030] Hairpin ribozyme (HPR)
[0031] Hairpin ribozymes are small RNA fragments with ribozyme functions. They exist in RNA satellites of plant viruses. They were first discovered in the negative strand of satellite RNA of tobacco ringspot virus (TRSV), where they undergo rolling circle transcription with a single-stranded DNA template to generate a long, repeating linear RNA precursor that forms small circRNAs by self-cleavage. This method can be used to prepare large quantities of 50-150nt circRNAs, but off-target effects may occur because the ribozyme sequence is also present in the circRNA sequence. In addition, the activity of HPR is affected by a variety of factors (such as freezing, ionic conditions, and other auxiliary factors), which interfere with the dynamic balance of HPR-catalyzed segmentation and ligation, making the generated circRNA unstable. Summary of the invention
[0032] In view of the above problems, the present invention provides a new method for preparing circular RNA based on magnetic beads. Compared with the prior art, the present invention has the following beneficial effects:
[0033] 1. The present invention can obtain the target RNA through in vitro transcription, which can reduce the preparation cost.
[0034] 2. The present invention requires artificial design, synthesis or primer amplification of DNA templates to generate target RNA using DNA templates, which can strictly control the sequence of target RNA and accurately obtain target RNA. On this basis, it is easier to realize the industrial production of circular RNA.
[0035] 3. The present invention forms double-stranded RNA with the target linear RNA through a biotin-labeled complementary RNA chain, and then connects the linear double-stranded structure into a circular double-stranded structure through T4 RNA ligase 2. Compared with the traditional PIE system, there is no need to introduce foreign sequences, and it has the potential for industrial production. Compared with T4 RNA ligase 1, the connection specificity is higher. Compared with other methods based on T4 RNA ligase 2, the sequence of circular RNA is fixed, the double-stranded connection specificity is higher, the occurrence of heterocycles is reduced, and there is no need to design foreign sequences and repeated bases, which can reduce the impact of non-specific exogenous sequences on circular RNA in vivo.
[0036] 4. The present invention melts the double-stranded structure by high temperature, and then separates the complementary strand from the target strand by magnetic beads. The experimental steps are simple, the experimental materials are easily available, and the production cost is low.
[0037] 5. The present invention obtains circular RNA only through in vitro experiments, which can realize automated mass production and provide sufficient immunogens for the research and development of circular RNA vaccines.
[0038] The object of the present invention is achieved through the following technical scheme, a new method for preparing circular RNA based on T4 RNA ligase 2 and magnetic beads method, characterized in that it includes the following steps: 1) designing a DNA template of a target RNA; designing a DNA template complementary to the target RNA; 2) using the DNA template to perform in vitro transcription to obtain the target RNA and the complementary RNA chain; 3) purifying the in vitro transcribed RNA; 4) annealing: annealing the target RNA with the complementary RNA chain with biotin to form a complementary linear double-stranded RNA structure; 5) connecting: using T4 RNA ligase 2 to connect the linear double-stranded RNA structure into a circular double-stranded RNA structure; 6) magnetic separation: fully mixing streptavidin magnetic beads with double-stranded RNA; dissociating the circular hybrid double-stranded at high temperature, and separating the biotin-labeled RNA and the target circular RNA with streptavidin magnetic beads; 7) removing the linear double-stranded RNA by using RNase III; 8) degrading the linear DNA; 9) using RNase R degradation of linear single-stranded RNA; 10) purification of circular RNA; 11) qRT-PCR identification: design and synthesize primers for amplifying circular and linear RNA, use fluorescent quantitative PCR instrument for amplification, and analyze amplification curves and melting curves; 12) agarose gel electrophoresis analysis of the size and purity of circular RNA.
[0039] Furthermore, a new method for preparing circular RNA based on magnetic beads is characterized in that the method of obtaining the target RNA by in vitro transcription in steps 1, 2, and 3) is: for the study of different target RNAs, the corresponding DNA template is artificially designed, synthesized or primer-amplified, and after obtaining the purified DNA template, the target RNA is obtained by in vitro transcription and purification.
[0040] Further, a novel method for preparing circular RNA in vitro based on magnetic beads is characterized in that the method for preparing circular double-stranded RNA in step 4) is: annealing the target RNA obtained in step 3) with the complementary RNA chain (with biotin label) to form a linear double-stranded RNA structure. Specific steps: adding the target RNA and complementary RNA to the reaction system in a ratio of 1:1, adding 5× RNA annealing buffer, the RNA annealing buffer solution includes: 100mM Tris (pH 7.0-7.5), 250ml KCl, 10mM MgCl2, 25% glycerol, and using a PCR instrument to implement the annealing procedure.
[0041] Furthermore, a novel method for preparing circular RNA in vitro based on magnetic beads is characterized in that the method for preparing circular double-stranded RNA in step 5) is: the linear double-stranded RNA obtained in step 4) is connected to the 3' hydroxyl group and the 5' phosphate group of the linear double-stranded RNA chain by T4 RNA ligase 2, and the main step is to add T4 RNA ligase 2 and corresponding buffer to the linear double-stranded RNA system. The connection temperature is 25°C. The connection time is 2-24 hours or more.
[0042] Furthermore, a novel method for preparing circular RNA in vitro based on magnetic beads is characterized in that the method for preparing and separating circular double-stranded RNA in step 6) is as follows: the circular double-stranded RNA obtained in step 5) is fully mixed with streptavidin magnetic beads and mixed at room temperature for 1.5-2 hours. After incubation at 95°C for 5-10 minutes, it is immediately placed in a magnetic separator for separation, and then the supernatant in the centrifuge tube is quickly aspirated and placed in a new centrifuge tube.
[0043] Furthermore, a new method for preparing circular RNA in vitro based on magnetic beads is characterized in that the method for removing circular double-stranded RNA in step 7) is: adding RNase III, i.e., ribonuclease III and its buffer, to the supernatant obtained in step 6), and incubating at 37°C for 20 minutes to shear the circular double-stranded RNA.
[0044] Furthermore, a new method for preparing circular RNA in vitro based on magnetic beads is characterized in that the method for removing DNA heterochains in step 8) is: adding an appropriate amount of DNase I (Chinese name: deoxyribonuclease I) to the supernatant obtained in step 7) and incubating at 37°C for 15 minutes.
[0045] Furthermore, a new method for preparing circular RNA in vitro based on magnetic beads is characterized in that the method for purifying circular RNA in steps 9) and 10) is: first add RNase R and corresponding buffer to the supernatant obtained in step 8), incubate at 37°C for 30 minutes to remove linear RNA, and then purify it using an RNA purification kit. The specific steps are shown in the kit manual.
[0046] Furthermore, a new method for preparing circular RNA in vitro based on magnetic beads is characterized in that the step 11) verifies the method of circular RNA: the purified circular RNA obtained in step 10) is subjected to real-time fluorescence quantitative PCR detection using specific primers, and the specific steps are: ① reverse transcribing the obtained circular RNA; ② designing and synthesizing primers for amplifying linear RNA and circular RNA according to the circular RNA sequence; ③ amplifying the reverse transcribed product by PCR, and the detailed steps are shown in the PCR reagent manual.
[0047] Furthermore, a new method for preparing circular RNA in vitro based on magnetic beads is provided, characterized in that, in the step 12) verifying the method for circular RNA, the product obtained in step 11) is subjected to agarose gel electrophoresis and developed. BRIEF DESCRIPTION OF THE DRAWINGS
[0048] Figure 1 Schematic diagram of circular RNA synthesis
[0049] Figure 2. Circular RNA product verification effect diagram: Figure 2A. Amplification curves of RT-PCR products of the method of the present invention and the splint method ( Figure 2A-1 ) and melting curve ( Figure 2A-2 ) Figure 2B . The bar graph shows the Cq value of RT-PCR of the products of the method of the present invention and the splint method Figure 2C Agarose gel electrophoresis diagram showing the molecular weight of the product after RT-PCR amplification of circular RNA synthesized by the method of the present invention and the splint method DETAILED DESCRIPTION
[0050] The reagents and solutions used in the examples are as follows:
[0051] Double-stranded DNA (Beijing Qingke Biotechnology), biotin-labeled single-stranded DNA (Shenggong), T4 RNA ligase 2 and 10 RNA) ligation reaction buffer (Biyuntian), PEG8000 (Biyuntian), RNase inhibitor (MCE), sterile enzyme-free water (Solarbio), T7 in vitro transcription kit (Zhishengyougu), Waals TM RNA purification kit (Waals), (Thermo), Streptavidin Magnetic Beads (MCE), RNaseR (Biyuntian), RT Master Mix for qPCR II (MCE), SYBR Green qPCR Master Mix (MCE)
[0052] Example 1
[0053] 1. DNA template design
[0054] Design the template DNA of the target circular RNA, a total of 118bp. The solid of the DNA template was synthesized by Qingke Biotechnology. The total synthetic product is 2OD. (Synthesized by Qingke Biotechnology)
[0055] Design a DNA chain complementary to the template DNA, and Jinkairui Biosynthesizes a solid of the DNA template. The total amount of the synthetic product is 2OD. (Synthesized by Jinkairui Bio)
[0056] 2. In vitro transcription
[0057] 2.1 In vitro synthesis of target RNA template 1
[0058] The reagents provided by the T7 RNA Transcription Kit are configured as follows:
[0059]
[0060] Gently mix the reaction solution and incubate at 37°C for 2 to 8 hours; 2.2 In vitro synthesis of RNA template complementary to the target RNA
[0061]
[0062] Gently mix the reaction solution and incubate at 37°C for 2 to 8 hours; 3. RNA Purification.
[0063] Waals TM The steps provided by the RNA purification kit are as follows:
[0064] 1. [Note] The RNA solution for a single reaction should be 100 μL (if less than 100 μL, sterile enzyme-free water can be used to make up to 100 μL). If it is greater than 100 μL, the amount of reagents in step 6 should be increased proportionally, and it is still applicable to make up to 1 mL with pre-cooled anhydrous ethanol. 2. Add an equal volume of Phenol:Chloroform:Isopentanol and mix thoroughly (vortex for 15 seconds). 3. Centrifuge at 14,000 rpm for 10 minutes at room temperature. 4. Take the supernatant to a new sterile enzyme-free centrifuge tube, add an equal volume of chloroform, and mix thoroughly (vortex for 15 seconds). 5. Centrifuge at 14,000 rpm for 10 minutes at room temperature, and take the supernatant to a new sterile enzyme-free centrifuge tube. 6. Add 15 μL Salt solution I, 5 μL Salt solution II, 1 μL Enhancer, and 880 μL pre-cooled anhydrous ethanol to each tube. 7. Mix by inversion and place at -20℃ or -80℃ for at least 1 hour or overnight to precipitate RNA. 8. Centrifuge the tube at 14,000rpm, 4pm for 30 minutes and discard the supernatant. 9. Add 1ml of 80% anhydrous ethanol and centrifuge at 14,000rpm, 4℃ for 15 minutes, discard the supernatant and air dry. 10. Dissolve the RNA precipitate with 10-20μL Nuclease-free water and place on ice or store at -80℃.
[0065] 4. RNA-RNA Annealing
[0066]
[0067] 5. Enzyme ligation
[0068] Based on T4 RNA ligase, the 3' hydroxyl group and 5' phosphate group of dsRNA are connected. Refer to the table below to prepare the following reaction system in an ice bath:
[0069]
[0070] 6. RNA pull down based on biotin magnetic beads, the specific operation is as follows:
[0071] 6.1 Magnetic Bead Preparation
[0072] 1. Resuspend the magnetic beads and transfer 50 μL into an enzyme-free centrifuge tube.
[0073] 2. Place the centrifuge tube on a magnetic rack, collect the magnetic beads and discard the supernatant.
[0074] 3. Resuspend the magnetic beads in RNA IP Buffer.
[0075] 4. Place the centrifuge tube on a magnetic rack, collect the magnetic beads and discard the supernatant.
[0076] 5. Repeat steps 3 and 4. Repeat this step four times.
[0077] 6. Resuspend the magnetic beads in 50 μL 10× RNA IP Buffer.
[0078] 6.2 Reaction of Magnetic Beads with Biotin-labeled Oligonucleotides
[0079] 7. Add the solution obtained in step 5 to a centrifuge tube, add 10× RNA IP Buffer in proportion, and mix on a rotating mixer at room temperature. Rotation Incubate for 120 min.
[0080] 6.3 RNA pull down using magnetic beads
[0081] After incubation, incubate the target RNA at 95°C for 5-10 minutes and immediately place it on a magnetic rack. Quickly collect the supernatant and place it in a new centrifuge tube.
[0082] 7. Digestion of circular double-stranded RNA
[0083] The circular double-stranded RNA in step 6 was removed based on RNase III (Biyuntian). The specific steps are as follows:
[0084]
[0085] 8. Digestion of linear DNA
[0086] Removal of linear DNA in step 7 based on DNase I (Biyuntian)
[0087] a. Add 1U DNase I to each transcription reaction containing 0.5μg template DNA. Note: In some cases, the amount of DNase I required for complete digestion of template DNA needs to be determined experimentally.
[0088] b. Incubate at 37°C for 15 minutes.
[0089] 9. Digestion of Linear RNA
[0090] The linear RNA in step 8 was removed based on RNaseR (Biyuntian). The specific steps are as follows:
[0091] a. Prepare the following reaction system on ice according to the table below:
[0092]
[0093] b. Reaction conditions: 37℃ for 10-30min
[0094] 10. RNA Purification
[0095] Purify RNA as described in step 3
[0096] 11.qRT-PCR
[0097] The specific steps are as follows:
[0098] 11.1 Reverse transcription
[0099]
[0100] Add 5 μL of 4× Super RT Mix (containing gDNA digestion inhibitor) to the mixture from step 2 (15 μL). Mix the components thoroughly and collect by brief centrifugation. Incubate the mixture in a PCR instrument or water bath in the following program:
[0101]
[0102] 11.2 Real Time PCR
[0103] Primer design; known target RNA sequence
[0104] 5'-gccatcggtggccggagcgcttttgcgggctgccttagtggccaactgtttgcgtggcgccttgccaccag tagacttccgagcagtttgcttagtgcg-3'
[0105] Design primers for synthesizing linear RNA;
[0106] Linear Primer-F:5'-cgcactaagcaaactgctcg-3'
[0107] Linear Primer-R:5'-ttttgcgggctgccttagtg-3'
[0108] Primers for circular RNA synthesis:
[0109] circ Primer-F:5'-gctcgtcaaacgaatcacgc-3'
[0110] circ Primer-R:5'-gttccgcggtgcgtttgt-3'
[0111] RT-PCR reaction system:
[0112] The recommended template amount is 10-100ng (genomic DNA) or 1-10ng (cDNA template). Prepare the PCR reaction solution according to the following components (please prepare the reaction solution on ice)
[0113]
[0114] The RT-PCR reaction program was set up as follows:
[0115]
[0116]
[0117] 12. Agarose gel electrophoresis
[0118] The specific steps are as follows;
[0119] 1. First prepare 1% agarose gel (Qingke)
[0120] 2 Mix the PCR product obtained in step 8 with the loading buffer and add 10ul of the mixture to the loading well.
[0121] Add enough electrophoresis buffer to the electrophoresis tank until the surface of the gel is covered. Turn on the power and start electrophoresis until the dye reaches the appropriate position of the gel.
[0122] 3. Development
[0123] The synthesis was verified using the embodiment of the present invention, and the target sequence was
[0124] 5'-gccatcggtggccggagcgcttttgcgggctgccttagtggccaactgtttgcgtggcgccttgccaccagtagacttccgagcagtttgcttagtgcg-3' circular RNA, Figure 2A, Figure 2B and Figure 2C The original data, statistical graphs, and agarose gel electrophoresis effect diagrams of RT-PCR using the method of the present invention and the splint method are shown in Figure 2.
[0125] 5'-gccatcggtggccggagcgcttttgcgggctgccttagtggccaactgtttgcgtggcgccttgccaccag tagacttccgagcagtttgcttagtgcg-3' was used as the research object to form a circular RNA, and amplified by linear primers and circular primers (Figure 2A) (three replicate wells). The amplified product in Figure 2A was then subjected to agarose gel electrophoresis. Figure 2B At the same time, the amplified products of the splint method were used as controls.
[0126] The method of the present invention has high stability and can obtain stable circular RNA products, indicating that the present invention successfully synthesizes circular RNA.
[0127] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution and its application of the present invention and are not limiting; those skilled in the art should understand that modifications or equivalent substitutions of the technical solution of the present invention should be included in the scope of the claims of the present invention.
Claims
1. A new method for preparing circular RNA in vitro based on magnetic beads It is characterized in that The steps include: 1) Design and synthesize a DNA template for generating target RNA; design and synthesize a biotin-labeled DNA complementary to the target RNA sequence 2) Use DNA template for in vitro transcription to obtain target RNA and complementary RNA chain (with biotin label) 3) Purify the RNA obtained by in vitro transcription 4) Annealing: Anneal the target RNA with the complementary RNA containing biotin to form a double-stranded RNA structure with sticky ends 5) Ligation: Use T4 RNA ligase 2 to connect the double-stranded RNA structure into a circular double-stranded structure 6) Magnetic separation: After the streptavidin magnetic beads are fully mixed with the double-stranded RNA, the double-stranded RNA structure is dissociated at high temperature, and the biotin-labeled circular RNA and the target circular RNA are separated using the streptavidin magnetic beads. 7) Removal of circular double-stranded RNA using RNase III 8) Degradation of linear DNA 9) Degradation of linear RNA using RNase R 10) Purification of circular RNA 11) qRT-PCR identification: design and synthesize primers for amplifying circular and linear RNA, use fluorescent quantitative PCR instrument for amplification, and analyze amplification curves and melting curves 12) Agarose gel electrophoresis was used to analyze the size and purity of circular RNA.
2. A novel method for preparing circular RNA in vitro based on magnetic beads according to claim 1, It is characterized in that The method for obtaining the target RNA by in vitro transcription in steps 1, 2 and 3) is: for the study of different target RNAs, the corresponding DNA template is obtained by artificial design, synthesis or primer amplification, and the target RNA is obtained by in vitro transcription and purification.
3. A novel method for preparing circular RNA in vitro based on magnetic beads according to claim 1, It is characterized in that The method for preparing circular double-stranded RNA in step 4) is: annealing the target RNA obtained in step 3) with the complementary RNA chain (with biotin label) to form a double-stranded structure. Specific steps: adding the target RNA and the complementary RNA chain into the reaction system at a ratio of 1:1, adding 5× RNA annealing buffer, the RNA annealing buffer solution includes: 100mM Tris (pH 7.0-7.5), 250mlKCl, 10mM MgCl 2 , 25% glycerol, and perform annealing procedure using a PCR instrument.
4. A novel method for preparing circular RNA in vitro based on magnetic beads according to claim 1, It is characterized in that The method for preparing circular double-stranded RNA in step 5) is: the linear double-stranded RNA obtained in step 4) is connected to the 3' hydroxyl group of the double-stranded RNA and the 5' phosphate group of the RNA chain by T4 RNA ligase 2, and the main step is to add T4 RNA ligase 2 and corresponding buffer to the linear double-stranded RNA system. The connection temperature is 25° C. and the connection time is 2-24 hours or more.
5. A novel method for preparing circular RNA in vitro based on magnetic beads according to claim 1, It is characterized in that The method for preparing and isolating circular double-stranded RNA in step 6) is as follows: the circular double-stranded RNA obtained in step 5) is fully mixed with streptavidin magnetic beads at room temperature for 1.5-2 hours. After incubation at 95° C. for 5-10 minutes, it is immediately placed in a magnetic separator for separation, and then the supernatant in the centrifuge tube is quickly aspirated and placed in a new centrifuge tube.
6. A novel method for preparing circular RNA in vitro based on magnetic beads according to claim 1, It is characterized in that The method for removing the circular double-stranded RNA in step 7) is as follows: adding RNase III, i.e., ribonuclease III and its buffer, to the supernatant obtained in step 6), and incubating at 37° C. for 20 minutes to shear the circular double-stranded RNA.
7. A novel method for preparing circular RNA in vitro based on magnetic beads according to claim 1, It is characterized in that The method for removing DNA impurities in step 8) is as follows: adding an appropriate amount of DNase I (Chinese name: deoxyribonuclease I) to the supernatant obtained in step 7) and incubating at 37° C. for 15 minutes.
8. A novel method for preparing circular RNA in vitro based on magnetic beads according to claim 1, It is characterized in that The method for purifying circular RNA in steps 9 and 10) is as follows: first, add RNase R and corresponding buffer to the supernatant obtained in step 8), incubate at 37° C. for 30 minutes to remove linear RNA, and then purify using an RNA purification kit. For specific steps, see the kit manual.
9. A novel method for preparing circular RNA in vitro based on magnetic beads according to claim 1, It is characterized in that The method for verifying circular RNA in step 11) is as follows: the purified circular RNA obtained in step 10) is subjected to real-time fluorescence quantitative PCR detection using specific primers, and the specific steps are as follows: ① reverse transcribing the obtained circular RNA; ② designing and synthesizing primers for amplifying linear RNA and circular RNA according to the circular RNA sequence; ③ amplifying the reverse transcribed product by PCR, and the detailed steps are shown in the PCR reagent manual.
10. A novel method for preparing circular RNA in vitro based on magnetic beads according to claim 1, It is characterized in that The method for verifying circular RNA in step 12) is to perform agarose gel electrophoresis on the product obtained in step 11) and develop it.